Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

단일 셀 TCR 고립과 Retroviral 벡터 생체 외에서 의 생성과 Vivo에서 표현의 인간의 TCRs 간소화

doi: 10.3791/55379 Published: September 10, 2017

Summary

단일 셀 쌍 인간의 TCR 알파와 베타 체인 시퀀싱과 현재 프로토콜 결합 유선형 retroviral 벡터 생체 외에서 그리고 vivo에서 TCR 식와 호환의 세대.

Abstract

단 T 세포에서 쌍체 T 세포 수용 체 (TCR) 알파와 베타 체인의 시퀀싱에 대 한 여러 가지 방법을 개발 되었습니다, 하지만 아무도 지금까지 왔다 TCR heterodimers의 기능 분석에 다운스트림 도움이 vivo에서 . 우리 인간의 TCR 알파와 베타 체인의 전체 변수 영역에 걸쳐 PCR 제품 귀착되는 2 단계 멀티 플렉스 중첩 PCR에 기반으로 하는 향상 된 프로토콜을 개발 했습니다. 식별 하는 고유한 제한 사이트 PCR 뇌관으로 그들을 통합 함으로써, 우리는 만들어 PCR 제품 템플릿 retroviral 벡터에 직접 하위 복제와 호환. 결과 retroviral 구조 공상 인간/마우스 TCR 마우스 셀에서 또는 vivo에서 마우스 모델에서 작동 되는 마우스 세포내 도메인으로 인코딩합니다. 전반적으로, 여기에 설명 된 프로토콜 인간 단일 셀 쌍 TCR 알파와 베타 체인 식별 생체 외에서 그리고 vivo에서 TCR 표현 위한 retroviral 벡터 쉽게 적응의 유선형된 세대와 결합 합니다. 중요 한 단계는 뒤 및 잠재적인 함정을 피할 수 있도록 비디오와 함께 제공 된 자료 PCR, 단일 셀의 매우 상세한 설명을 제공 하도록 설계 됩니다. 또한, 우리는 복제 식 벡터를 생성 하는 데 필요한 단계에 대 한 자세한 설명을 제공 합니다. 일단 마스터, TCR 식 정렬 단일 셀에서 모든 절차는 짧은 2 주 기간에 수행 수 있습니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

T 세포 수용 체 (TCR) T 세포 운명 결정 개발, 안정 상태/항상성, 그리고 주변1,2,3항 원 자극 동안 지시. 깊은 기술을 시퀀싱의 최근 확장 이전 받는 TCR 다양성 내의 항 원 특정 한 T 세포 응답을 발견 했다. TCR 다양성 기능적으로 광범위 한 T 세포 응답에 대 한 잠재력을 제안합니다. TCR 시퀀스 레 퍼 토리 분석 TCR 기능적인 분석 실험, 통합 하려면 시퀀싱 방법 실험 시스템과 vivo 모델 선택의 후속 기능 분석에 대 한 활용에 호환 되도록 설계 되어야 한다 TCRs입니다. 우리 인간의 TCR 시퀀스 격리에 대 한 효율적인 접근 방식을 개발 하 고 하위 TCR 식 HLA humanized 쥐4와 호환 공상 인간/마우스 TCR 서식 파일 벡터에 클로닝 간소화. Heterodimeric TCRs의 해당 알파와 베타 체인의 절연 단일 셀에서 두 체인의 PCR 증폭을 해야합니다. 비록, 여러 단일 셀 TCR 복제 프로토콜 개발 되 고 활용, 아무도 지금까지 있다 높은 처리량 유선형 직접 복제의 알 수 없는 Vα/Vβ TCRs retroviral 벡터 재 식 vivo에서 필요한에 쉽게 호환 4,5,,67. 이전 연구 두 가지 주요 방법, 선택적으로 시퀀스를 추정 하거나 전체 TCR 시퀀스4,,56 증폭 충분 한 TCR의 일정된 부분을 증폭에 활용 , 7. 첫 번째 접근 방식을 통해 얻은 TCR 시퀀스의 하류 기능 분석 필요 비용 실리콘에 어셈블리와 드 노 보 의 건설에 TCR의. 두 번째 방법은 제공 하지만 완전 한 TCR 순서, 인간의 지속적인 지역 마우스 모델에서 복제 TCRs의 비보에 식이 호환 되지 않습니다. 우리의 접근 방식은 특히 vivo에서 기능 분석 TCRs의 마우스 모델에서 호환 되도록 설계 되었습니다. 우리는 효율적이 고 간소화 된 단일 셀 직접 서브 클로닝 PCR 파편의 템플릿 식 벡터에 대 한 수 PCR 프로토콜을 개발.

우리의 접근 방식을 매우 민감한 멀티 플렉스 중첩 PCR 반응이 두 단계에서 수행 되는 사용 합니다. 첫 번째 다중 반응에서 40 뇌관 모든 V 베타 체인에 대 한 특정의 수영장과 44 뇌관 V-알파 사슬 TCR 알파 또는 베타 TCR 시퀀스 (표 1)의 사전 지식 없이 증폭 하는 데 사용 됩니다 모든 특정의 수영장 단계. 앞으로 뇌관에는 5' PCR 제품의 통합 어댑터 시퀀스를 있다. 반전 뇌관 TCR의 일정 영역을 기반으로 합니다. 우리가 확인 독특한 제한 사이트 인간의 변수 또는 접합 TCR 지역에서 결 석 하 고 새로 디자인 된 TCRα 및 TCRβ 뇌관 (그림 1)에이 통합. 두 번째 중첩 된 반응에서 어댑터 시퀀스에 대 한 특정 뇌관 및 일정 지역 내에서 중첩 된 역방향 뇌관 TCR 체인으로 증가 (표 1, 그림 1) 증폭에 사용 됩니다. 단일 셀 격리 후 PCR의 라운드 2 (첫 번째 반응 Vα와 Vβ 뇌관의 풀과 함께 두 번째 어댑터 뇌관) 수 직접 하위 복제 될 템플릿 retroviral 벡터에 PCR 제품에서 결과. 단 하나 열려있는 독서 프레임 (ORF), 마우스 일정 지역 '자체 cleaving' 단백질 순서에 의해 연결 된와 함께 인간의 변수 영역에에서 최종 TCR 구문 인코딩할 것 이다 P2A (hVα-mCα-P2A-hVβ-mCβ)8. P2A 시퀀스 여러 시스템에서 사용 되 고 특히 TCRs8,9,,1011의 표현에 대 한 광범위 하 게 테스트 되었습니다. 비록, P2A 시퀀스 남아의 대부분에 연결 후 번역의 알파 사슬의 베타 체인 신호 순서는 추가 프롤린,이 수정 유연한 링커로 연결 C terminus는 TCR 기능에 해로운 영향을 주지 않습니다. 마우스 일정 지역 하류 신호 구성 요소와 잠재적인 변경된 상호 작용을 피하기 위해 인간 대신 구문에 사용 됩니다 때 다시 마우스 세포에 표현. 단일 ORF 알파와 베타 체인9,11의 화학 량 론 별도 식에서 발생 합니다. 현재 프로토콜 시 약 및 널리 사용할 수 있는, 접근에 근거 하 고 간소 하 고 효율적인 방식으로 수행 하도록 설계 되었습니다. 비록 우리가 구체적으로 TCRs self-reactive T 세포 자가 면역 당뇨병에 연루에서 분석 결과를이 기술을 사용, 우리는이 프로토콜 식별 및 인간의 TCRs 대 한 특정의 기능 평가 대 한 광범위 하 게 적용 될 수 있습니다 예상 면역 epitopes, 암 epitopes, 또는 병원 균 및 백신에 대 한 응답.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 관심의 T 세포 인구를 식별.

참고: 항 원 자극에 대 한 응답에서 그들의 확산을 기반으로 항 원 (Carboxyfluorescein succinimidyl 에스테 르, CFSE) 처럼 세포 분열 염료와 함께에서 특정 확산 T 세포를 분리 사용할 수 있습니다. PBMCs에서 시작 하는 경우 7 일에서 체 외에 확장은 항 원 특정 CFSE 낮은 인구 12를 식별 하기 위해 충분 해야 한다.

  1. 믹스 PBMCs 일치 하는 MHC 피더 세포와 라벨 5 µ M CFSE 세포 분열 염료와 1:1.
  2. 접시 2-2.5 x 10 5 셀 잘 당 96 잘 라운드-하단에 문화 접시 200 µ L 10 %FCS 완전 한 RPMI 미디어에.
    참고: 완전 한 RPMI 포함 2 m m l-글루타민, 나트륨 pyruvate 1 m m, 100 µ M MEM 불필요 한 아미노산, 5 mM HEPES, 5.5 × 10 − 5 2-mercaptoethanol의 단위, 100ml U − 1 페니실린과 100 µ g mL − 1 스.
  3. 25 µ M 펩 티 드 항 원 가진 세포를 자극.
  4. 문화의 4 번째 날에 신중 하 게 제거 하 고 대체 미디어의 100 µ L.
    참고: T 세포 항 원 특정 식별에 대 한 더 최적의 접근 펩 티 드-HLA tetramers 13의 사용 이다. HLA-제한 뿐 아니라 항 원 특이성의 동시 평가 허용 tetramer 얼룩.

2. 단일 셀 정렬 설정.

  1. 수행 후드 또는 지정 된 영역에서 모든 절차는 증폭 된 서식 파일의 무료. Aliquot을 피하기 위해 오염, 시 약 모든 작업 표면 청소 및, 경우, 10%와 장비 PCR 설치 전에 표 백제. 사용 하 여 필터 팁, RNAse와 DNAse 무료 시 약 및 모든 PCR 및 벡터 클로닝 단계에서 플라스틱. 주요 시 약 재료의 테이블에서에서 찾을 수 있습니다.
    참고: 다중 PCR 반응이 매우 민감한 및 오염 물질의 낮은 수준이 증폭된 제품에서 발생할 수 있습니다.
  2. 생성 10 RT 반응 배를 결합 하 여 반전 녹음 방송 마스터 믹스 버퍼, 25 X DNTPs, 9 U RT 효소, 0.01 %0.7 U RNAse 억제제, 트리톤 X 383 및 살 균 pipetting 저수지에서 (표 1에 나열 된) 각 RT TCR 뇌관의 nM. 각 96 잘 접시 메이크업 10 추가 반응 (전체 106)에 대 한 충분 한 마스터 믹스 pipetting 동안 액체의 손실에 대 한 보상. 반응의 구성 요소와 잘 당 금액 표 2를 참조 하십시오.
  3. 준비 96 잘 PCR 컬렉션 플레이트 멀티 채널 피 펫 잘 당 반전 녹음 방송 마스터 믹스의 pipetting 6 µ L에 의해 정렬 셀. 얼음 이나 차가운 블록 플레이트를 유지.
  4. 세포 표면 마커 (등 CD4, CD3, 또는 CD8 CD3, 각각 2 µ g/mL, 세포 분열 염료 또는 tetramer 얼룩이 함께)에 항 체와 함께 셀 라벨.
  5. 정렬 T 세포에서 셀 음, 부정적인 컨트롤 될 것입니다 12 행을 건너뛰는 당.
    참고: 정렬의 효율성 뿐만 아니라 셀과 cDNA 반응 전에 낮은 온도에 번호판 플레이트 홀더 내의 정확한 컬렉션 판 정렬에 따라 달라 집니다. 컬렉션 접시 보관 한다 얼음에 항상 제외 하 고 정렬 때 냉각 플레이트 내에서 해결 하는 동안. 모든 종류로 온도 조절된 플레이트 홀더; 장착 그러나, 하나의 사용이 좋습니다. 종류는 일반적으로 접시 당 약 10-15 분 소요, 이후 있다 RNA 저하에 대 한 증가 잠재력 접시 낮은 온도에서 유지 되지 않습니다.
  6. 긍정적인 컨트롤로 추가 (100 셀)의 많은 수 수동으로 피 펫과 우물 중 하나를이 단계에서. 또는, 이전 절연 풀링된 세포에서 RNA에서 사용하실 수 있는 긍정적인 제어로 10 ng 잘 당.
    참고: 정화 제어 RNA 정밀 플라스틱 및 다른 우물과 거짓 긍정적인 결과의 상호 오염을 피하기 위하여 신경.
  7. 접착제 필름, 격판덮개 및 4에서 5 분 동안 1000 x g에서 스핀 다운 ° c.
  8. 즉시 녹음 RNA cDNA를 10 분, 45 분 동안 37 ° C에서 25 ° C에서 접시를 배양 하 여 10 분에 85 ° c
    참고: 효율적인 PCR 반응 되도록 첫 번째 PCR 반응 같은 날 수행 될 것이 좋습니다. 또는, 베낀된 접시 보관 하실 수 있습니다-80 ° C에서 최대 2 개월.

3. 멀티플렉스 중첩 PCR 수행

참고: 오염을 피하기 위하여 템플릿-무료 깨끗 한 지역에서 모든 마스터 믹스 준비.

    각 reconstitute
  1. 가변 지역 뇌관 DNAse과 RNAse 무료 H 2 o. 100 µ M 다음, 20 µ L V-알파 뇌관 풀 생성 하 44 뇌관의 각각의 결합. V-베타 생성 뇌관 풀 20 µ L 40 V-베타 뇌관의 각각 플러스 DNAse과 RNAse 무료 H 2 o. 뇌관 순서는 표 1에 나와 있습니다 80 µ L의 결합. 풀링, 일단 믹스에 각 뇌관의 농도 2.3 µ M.
  2. DNAse 100 µ M 재고 솔루션을 일정 지역 뇌관 reconstitute 자유롭고 RNAse H 2 o. Dilute 10 µ M 작업 솔루션을 사용 하기 위해 약 수 상수 지역 뇌관.
  3. 는 TCR 알파와 베타 TCR 확대를 위한 두 개의 별도 마스터 믹스를 준비합니다. 5 X를 결합 하 여 믹스 마스터를 생성, 80 µ M dNTPs, 3 %DMSO, 2 µ M 뇌관 수영장 버퍼 (46의 최종 농도 각 뇌관에 대 한 nM), 200 nM TCR 상수 지역 역 뇌관, 1 U DNA 중 합 효소, 그리고 DNAse과 RNAse 무료 H 2 O (표 2 < / >). Pipetting 동안 액체의 손실을 보상 하기 위해 10 추가 반응 (전체 106)에 대 한 충분 한 마스터 믹스 메이크업 각 96 잘 접시.
    참고: 계산 기반 22.5 µ L 마스터 PCR 혼합 2.5 µ L cDNA 서식 파일을 함께 잘 당 25 µ L의 최종 PCR 볼륨.
  4. 얼음 또는 차가운 블록에서 cDNA와 플레이트를 유지합니다. 멀티 채널을 사용 하 여 새로운 96-잘 PCR 격판덮개로 TCR 베타 반응의 22.5 µ L 플라스틱. 다음 PCR 접시에 cDNA의 2.5 µ L를 전송 하는 멀티 채널을 사용 하 여.
  5. 는 멀티 채널을 사용 하 여 포함 하는 cDNA의 나머지 접시에 직접 TCR 알파 반응의 22.5 µ L 플라스틱.
  6. 4 1000 x g 5 분에서 내려와 접착제, 부드럽게 소용돌이, 스핀 번호판 봉인 ° c.
  7. 멀티플렉스 PCR 반응 다음 사이클 실행: 95 ° C에서 5 분 뒤에 20의 34 주기 s 95 ° C, 30에서 54 ° c, s 및 72 ° C에서 1 분 72에 7 분 뒤 ° c.
  8. 멀티플렉스 PCR 혼합물의 2.5 µ L를 사용 하 여 템플릿으로
  9. 수행 25의 마지막 볼륨에 중첩 된 PCR 반응 밖으로 µ L
    1. 100 µ m와 DNAse과 RNAse 무료 H 2 o. 확인 10 µ M aliquots 작업 사진에 대 한 내부와 어댑터 뇌관 reconstitute.
    2. 는 TCR 알파와 베타 TCR ampl에 대 한 두 개의 별도 마스터 믹스를 준비ification입니다. 믹스 5 버퍼 25 X DNTP, 3 %DMSO, 200 nM 앞으로 어댑터 뇌관, 200 nM 역 중첩 된 뇌관, 1 U DNA 중 합 효소와 DNA 중 합 효소, nuclease 무료 H X 22.5 µ L (표 2)의 최종 볼륨에 대 한 2 O. 에 대 한 각 96 잘 접시 메이크업 10 추가 반응 (전체 106)에 대 한 충분 한 마스터 믹스 pipetting 동안 액체의 손실에 대 한 보상.
      참고: 두 번째 PCR 반응 사용에서 5 X PCR 버퍼 agarose 젤 로드를 촉진 하기 위하여 포함 된 로드 염료.
    3. 는 멀티 채널을 사용 하 여 두 개의 새로운 96-잘 PCR 접시에 잘 당 22.5 µ L에서 TCR 알파와 TCR 베타 반응에 대 한 마스터 믹스 플라스틱.
    4. 잘 당 2.5 µ L에서 다중 PCR 반응 템플릿 추가.
      참고: 나머지 첫 번째 PCR 반응 해야 봉인, 하 고 필요한 경우 추가 서식 파일의 원본으로-20 ° C에 저장 (4.3 참고 단계 참조).
    5. 인감 플레이트, 부드럽게 소용돌이, 그리고 스핀 다운 1000 x g 5 분에서 4 ° c.
    6. 중첩된 PCR 반응 다음 사이클 실행: 95 ° C에서 5 분 뒤에 20의 34 주기 95 ° C, 30에서 s s 56 ° C에서 72 ° C에서 1 분에 72 7 분 다음 ° c.
    7. 1 %agarose 밖으로 최종 반응의 실행 5 µ L 젤 포함 ethidium 평범한 사람 (를 포함 하 여 부정과 긍정적인 제어 우물).
      참고: 예상된 밴드는 약 500 bp 크기에서 실행 해야 합니다. 예제 반응을 그림 2에 표시 됩니다.
    8. 96 잘 형식 PCR 정화 키트를 사용 하 여 두 번째 반응 (20 µ L)의 나머지를 정화 하 고 70 ° C H 2 O 잘, 당 15 µ L 함께 elute 하 고, 수행 생어 시퀀싱. 적절 한 TCR 알파 또는 베타 TCR 어댑터 앞으로 뇌관을 사용 하 여 시퀀싱 (표 1).
      참고: 시퀀스는 온라인 사용 가능한 immunogenetics 소프트웨어와 함께 분석할 수 있습니다.

4. 알파와 베타 PCR 체인 하위 복제.

참고: 첫 번째 반응에서 앞으로 프라이 머 및 두 번째 PCR 반응에서 역방향 뇌관의 풀 제한 사이트를 통합 하는 데 사용 됩니다. 따라서, 얻은 알파와 베타 체인 PCR 제품은 순차적으로 하위 템플릿 retroviral 벡터 ( 그림 1)에 복제 될 준비가.

베타에서
  1. 다이제스트 순화 PCR 제품 중첩 반응 BstbI와 MfeI (표 3).
    참고: 5 µ g 삽입을 초과 하지 마십시오.
  2. 병렬로 소화 BstbI와 MfeI (표 3) 서식 파일 벡터. TCR 당 서식 파일 벡터의 1-2 µ g를 사용 합니다. Agarose 젤에 소화 벡터를 실행 하 고 큰 밴드 (~ 7500 bp)를 분리 합니다. DNA 정제 키트 젤 벡터 정화.
    참고: 제한 효소 다이제스트 동안 템플릿 murine TCR 베타 변수 지역의 제거 되 인간의 TCR 베타 변수 영역의 추가 대 한 허용.
  3. PCR 정화 키트를 사용 하 여 소화 PCR 제품을 정화.
    참고: 확인; 키트에 포함 된 열의 DNA 정화 능력 여러 열을 사용 하 여 필요한 경우. 순화 삽입 성공적인 결 찰 반응에 필요한 최소 금액은 50 ng 10 ng / µ L의 최소 농도에. 순화 삽입 금액 성공적인 결 찰에 대 한 충분 하지 않은 경우 두 번째 PCR 반응을 반복 될 수 있다.
  4. 열 비활성화 75에서 10 분 뒤 각자 결 찰을 방지 하기 위해 37 ° C에서 10 U CIP 효소 1 h에 대 한 서식 파일 벡터 치료 ° C. Purify DNA PCR 정화 키트 (표 3).
  5. Ligate TCR-베타 삽입 하 고 실 온에서 30 분 동안 삽입의 6 어 금 니 과잉에서 20 µ L 총 볼륨에 DNA 리가 사용 하 여 벡터.
    참고: 총, 결 찰 반응 해야 포함 약 150 ng의 DNA (표 3).
  6. 변환, 화학적으로 유능한 대장균 DH5α 세포 (자료 테이블)의 80 µ L로 결 찰 반응의 8 µ L를 혼합 하 고 30 분 45 미 추가 500 µ L 42 ° C에서 열 충격에 대 한 얼음에 품 어 슈퍼 Catabolite 억제 (S.O.C.) 매체와 쉐이크 1.5 h 37에 대 한 최적의 국물 ° c.
  7. 판 250 개 µ L 세균성 문화 Lysogeny 국물 (파운드) 한 천 배지를 포함 하는 암 피 실린에의. 하룻밤 플레이트 (~ 16 h) 37 품 어 ° c.
  8. 다음날 세균성 식민지를 선택 하 고 3 mL 파운드 매체 암 피 실린을 포함 하는 것은 하룻밤 사이에 그들을 자라. DNA 플라스 미드 정화 키트를 사용 하 여 플라스 미드 DNA 분리.
  9. 는 BstbI 및 MfeI 금지 효소로 소규모 테스트 다이제스트 베타 체인의 성공적인 삽입을 확인합니다. 12 µ L 총 반응 볼륨에 결합 200-500 µ g 플라스 미드 DNA, 각 효소의 0.25 µ L 10 X 효소 버퍼 (표 3). Ethidium 평범한 사람 삽입 밴드의 크기를 확인 하려면 포함 하는 1 %agarose 젤에 반응 밖으로 실행 (~ 500 bp).
  10. IRES 역방향 뇌관 (표 1)를 사용 하 여 벡터의 TCR 베타 섹션 순서는 삽입의 존재를 확인 한 후.
  11. 알파 변수 영역의 삽입에 대 한 비슷한 프로세스를 수행 하는 TCR-베타 삽입의 시퀀스 확인. 알파 중첩 된 반응, 그리고 벡터, SnaBI와 SacII를 포함 하는 새로 생성 된 TCR 베타 삽입에서 순화 된 PCR 제품을 소화.
    참고: 제한 효소 다이제스트 동안 템플릿 murine TCR 알파 변수 지역의 제거 인간의 TCR 알파 변수 영역의 추가 대 한 허용.
  12. Ligate 알파 실 온에서 30 분 동안 삽입의 6 어 금 니 과잉에서 20 µ L 총 볼륨에 DNA 리가 사용 하 여 해당 베타 가변 영역을 인코딩 하는 TCR 벡터에 삽입.
    참고: 총, 결 찰 반응 해야 포함 약 150 ng의 DNA (표 3).
  13. 변환, 화학적으로 유능한 대장균 DH5α 세포 (자료 테이블)의 80 µ L로 결 찰 반응의 8 µ L를 혼합 하 고 30 분 45 미 추가 500 µ L S.O.C. 42 ° C에서 열 충격에 대 한 얼음에 품 어 매체와 쉐이크 1.5 h 37에 대 한 ° C.
  14. 판 250 개 µ L 세균성 문화 Lysogeny 국물 (파운드) 한 천 배지를 포함 하는 암 피 실린에의. 하룻밤 플레이트 (~ 16 h) 37 품 어 ° c.
  15. 다음날 세균성 식민지를 선택 하 고 3 mL 파운드 매체 암 피 실린을 포함 하는 것은 하룻밤 사이에 그들을 자라. DNA 플라스 미드 정화 키트를 사용 하 여 플라스 미드 DNA 분리.
  16. 소규모 테스트-다이제스트 제한 효소 SnaBI 및 SacII 알파 체인의 성공적인 삽입을 확인합니다. 12 µ L 총 반응 볼륨에 결합 200-500 µ g 플라스 미드 DNA, 각 효소의 0.25 µ L 10 x 효소 버퍼 (표 3). Ethidium 평범한 사람 삽입 밴드의 크기를 확인 하려면 포함 하는 1 %agarose 젤에 반응 밖으로 실행 (~ 500 bp).
  17. 삽입의 존재를 확인 한 후 MSCV2 앞으로 뇌관 (표 1)를 사용 하 여 벡터의 TCR 알파 섹션 순서.
  18. 알파 체인 시퀀스의 유효성을 검사 하는 일단 TCR-베타-리버스 및 IRES 반전 뇌관 (표 1) 연속 완전 한 TCR 삽입 확인 합니다.

5. TCR 세포 표면 표현 및 특이성을 확인 합니다.

참고: HEK293T 셀 성공적인 TCR 체인 커플을 테스트 하는 데 사용 됩니다ng와 세포 표면 식 ( 그림 3A) 8. 펩 티 드 MHC tetramer 얼룩도 수행할 수 있습니다 transfected HEK293T 세포 항 원 특이성 게시물 TCR 유전자 분리 ( 그림 3B)의 보존에 대 한 테스트.

각 새로운 TCR에 대 한 별도 우물을 지정 충분 한 세포
  1. 접시 당 1 mL 전체 DMEM 미디어 포함 5 %FCS, 잘 1 x 10 5 셀에서 12 음 조직 문화 접시와 문화 37에서 하룻밤에 HEK293T 세포 ° C. 접시 컨트롤 템플릿 TCR 벡터, CD3 벡터만, TCR 벡터, 그리고 비 페를 잘 제어.
    참고: 템플릿 사용 하 여 완전히 마우스 TCR Transfection mCD3εγδζ pMIG 벡터, 혼자, mTCR pMIA 벡터와 결합에서 (mTCR-pMIA) 벡터와 mCD3εγδζ pMIG 벡터 혼자 긍정적이 고 부정적인 컨트롤로 사용 됩니다.
    참고: 완전 한 DMEM 포함 2 m L-글루타민, 1mm 나트륨 Pyruvate, 100 µ M m 비 필수 아미노산, 5 mM HEPES 버퍼, 10 -5 단위 2-mercaptoethanol, 100 U/ml 페니실린/스 x 5.5.
  2. 다음 날 transfect 1 µ g 공상 h/mTCR-pMIA 벡터, 1 µ g 마우스 CD3εγδζ-pMSCVII-GFP (pMIG) 벡터와 liposome에 기초를 둔 transfection 시 약 제조업체 지침에 따라 셀.
  3. 각 TCR 100 µ L 실내 온도, 혈 청 무료 DMEM 6 µ L transfection 시 약 추가. 짧게 소용돌이, 15 분에 대 한 실 온에서 품 어와
  4. 별도 1.5 ml에서 튜브 결합 TCR pMIA 벡터의 1 µ g 1 µ g 마우스 CD3εγδζ-pMSCVII-GFP (pMIG) 벡터, 또는 컨트롤에 대 한 별도 각 벡터의 1 µ g.
  5. Dropwise, 벡터 DNA를 포함 하는 튜브를 transfection 시 약/DMEM 솔루션을 추가 합니다. 15 분에 대 한 실 온에서 품 어
  6. Dropwise, HEK293T 세포 transfection 시 약/DMEM/DNA 솔루션을 추가 합니다. 부드럽게 섞어 접시를 누릅니다. 24 h. 위해 37 ° C에서 품 어
  7. 후 24 h는 미디어를 대체 하 고 셀 추가 24 헤에 대 한 문화를 유지
  8. 활기찬 pipetting으로 접시에서 셀을 제거 하 고 얼룩 방지 마우스 CD3 항 체 (2.5 µ g/mL) 공상 TCR의 표면 표현 cytometry에 의해 확인 된 셀.
  9. CD3 식 비슷한 수준, transfected 있던 세포 사이 비교 하기 위해 게이트 형광 기자 분자 (GFP, 복잡 한 c d 3에 대 한 그리고 TCR 식 벡터에 대 한 애)의 비슷한 높은 수준을 표현 하는 셀에 대 한 분석. GFP + 애 + 10 셀에 분석 해야 문이 하는 최적, 10 5 형광 강도 ( 그림 3A) 4.
    참고: 공상 구조와 페 셀에서 CD3 식의 수준 컨트롤 마우스 (원래 템플릿) 벡터 ( 그림 3A)를 비교 해야 합니다. 생성 된 TCR retroviral 벡터는 앞에서 설명한 4 식 시스템 vivo에서 호환.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

멀티플렉스 중첩 PCR 반응의 효율성 단계 3.2.7 (그림 2)는 agarose 젤에 두 번째 반응의 5µL에 밖으로 실행 하 여 확인 됩니다. 평균 TCR 베타 증폭의 효율 TCR 알파 반응의 효율은 일반적으로 낮은, 약 50%에서 80%, 약 될 것으로 예상 된다4. 만 쌍된 TCR 알파와 베타 TCR 사슬 TCR 식; 사용할 수 있습니다. 그러나, 모든 PCR 제품 TCR 시퀀스 및 레 퍼 토리 정보 시퀀싱 될 수 있습니다.

유전자 침묵만 주어진된 T 세포에 표현 될 하나의 TCR 베타 체인을 허용 합니다. 그러나, T 세포는 두번째 TCR 알파 사슬을 다시 정렬 하 고 T 세포의 약 25%는 14체인 두 번째 프레임에서 TCR 알파를 표현. 그것은 고립 된 TCR 알파 사슬의 일부 비율 "올바른" 알파 체인 대신 보조 알파 것으로 예상 된다. 2 차 알파 체인은 종종 TCR 베타 체인; 최적의 바인딩 파트너 따라서, 모든 복제 TCRs 안정 세포 표면에 표현 하 고 복잡 한 양식 것으로 예상 된다. 따라서, 적절 한 TCR 사슬 페어링 및 셀 표면 식 transfecting HEK293T 셀 (그림 3A)에 의해 확인 될 수 있다.

Figure 1
그림 1 . 효율적인된 멀티 플렉스 중첩 PCR 그리고 단일 T 세포에서 retroviral 구조 개발. PCR의 2 라운드 결과 해당 TCR 알파와 베타 체인의 확대. 금지 사이트 뇌관에 포함 유선형 하위 복제 및 마우스 셀에 식에 대 한 인간/마우스 공상 벡터의 생성을 허용 합니다. 서식 파일 마우스 벡터 인간, 마우스 세포에 공상 인간/마우스 TCR retroviral 벡터 식와 호환을 생성에 대 한 변수 마우스 영역 전환 쉽게 사용할 수 있습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 . 단 세포 PCR의 예. 한 96 잘 접시에 정렬 하는 단일 인간 T 세포에서 T 세포 수용 체 베타와 알파 체인의 중첩 된 PCR 증폭 멀티플렉스할. 단일 셀에서 해당 (위쪽 및 아래쪽) PCR 제품 증폭 TCR 베타와 인간 PBMCs. NC-서식 파일 통제, PC-긍정적인 통제에서에서 TCR 알파 사슬. Agarose 젤 (5 µ L)에 반응의 작은 부분을 실행 하 여 단일 셀 알파와 베타 체인 PCR 반응의 효율성은 PCR 제품. 을 시퀀싱 하기 전에 확인 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 . 세포의 표면 공상 TCR 표현과 특이성. (A) HEK293T 셀으로 페 했다 TCR 또는 인간/마우스 마우스 마우스 CD3εγδζ과 함께에서 공상 TCR. 세포 표면 TCR 식 안티-mCD3ε 항 체를 측정 했다. 게이팅 전략: 첫째, 분석 (G2) 애 고 GFP 두 배 긍정적인 세포에 문이. 단일 벡터 제어의 경우는 게이팅 단일 형광 (G1)에 근거해 있다. 둘째, G1 및 g 2에서 셀 CD3ε 식의 수준에 대 한 분석 된다. (B) TCR 특이성 tetramer DRB1 293T 세포의 얼룩에 의해 확인 된다 * 0401:GAD115-127 tetramer. (A)와 같이 분석 GFP + 애 + CD3ε + 셀에 문이 있다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

대상 유전자 뇌관 방향 시퀀스
반전 녹음 방송
TRAC cDNA AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
TCR 알파 PCR 반응 1
TRAV1-1 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
td > TRAV17 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 앞으로 CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC 외부 역 CAGACAGACTTGTCACTGGATTTAGAGTCTC TCRbeta PCR 반응 1 TRBV2 앞으로 CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 앞으로 CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 앞으로 CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 앞으로 CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 앞으로 CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 앞으로 CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 앞으로 CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 앞으로 CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 앞으로 CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 앞으로 CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 앞으로 CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 앞으로 CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >앞으로 CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 앞으로 CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 앞으로 CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 앞으로 CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 앞으로 CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 앞으로 CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 앞으로 CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 앞으로 CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 앞으로 CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC 외부 역 GTGGCCAGGCACACCAGTGTG TCR 알파 PCR 반응 2 TRAC 내부 역 CAGCTGGTACAccgcggGGTCAGGGTTCTG TRAV 어댑터 앞으로 CGGTTCAGCAGGAATGCCtacgtaATG TCR 베타 PCR 반응 2 TRBC 내부 역 CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV 어댑터 앞으로 CAGAAGACGGCATACGAGATcaattgATG 시퀀싱 뇌관 pMSCV-II 앞으로 CCTCCTCTTCCTCCATCCGCC TCRbeta 역 GCCAAGCACACGAGGGTAGCC IRES 역 AACGCACACCGGCCTTATTCC * 소문자 뇌관 순서 내의 법인된 제한 효소 절단 위치 표시

표 1: 전사, PCR, 및 시퀀싱 뇌관 역.

2.2 단계 잘 당 금액
RT-PCR 반응 (6μL) (Μ)
10 x 버퍼 0.6
2 x dNTP 0.24
10% 트리톤 X 0.06
3 TCR 특정 뇌관 (10 m m ea 코리아) 0.23 ea. (x 3 = 0.69)
효소 0.18
Rnase 억제제 0.28
NF(nuclease-free)-H2O 3.95
3.1 단계
PCR 반응 1 (25μL) (Μ) b PCR 반응 1 (25μL) (Μ)
5 x 버퍼 5 5 x 버퍼 5
dNTP (10 mM) 1 dNTP (10 mM) 1
DMSO 0.75 DMSO (3%) 0.75
수영장 (F 뇌관) (2.3μM) 0.3 b 풀 (F 뇌관) (2.3μM) 0.5
외부 R 뇌관 (10uM) 0.6 b 외부 R 뇌관 (10μM) 1
Dna 중 합 효소 0.2 Taq 중 합 효소가 0.2
RT-PCR cDNA 2.5 RT-PCR cDNA 2.5
NF-H2O 14.65 NF-H2O 14.05
단계 3.8
PCR 반응 2-동일 a와 b (25μL) (Μ)
5 x 버퍼 5
dNTP (10 mM) 1
DMSO 0.75
어댑터 F 뇌관 (10μM) 1
내부 R 뇌관 (10μM) 1
Dna 중 합 효소 0.2
PCR rxn 1 제품 2.5
NF-H2O 13.55

표 2입니다. 반전 녹음 방송 그리고 PCR 반응입니다.

4.2 및 4.3 단계
TRBV 소화 반응 (50μL) (Μ) mTCR pMIA 벡터 다이제스트 (500μL) (Μ)
DNA (~ 20μg) DNA (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x 버퍼 5 10 x 버퍼 50
H2O H2O
4.4 단계
CIP 반응 (100μL) (Μ) DNA(~1.5mg)
> 소화 & 벡터 DNA를 정화 84 10 x 버퍼 10 CIP 효소 6 4.5 단계 결 찰 반응 (20μL) (Μ) 소화/CIPed 벡터 DNA (삽입 및 벡터 총계는 ~ 150ng) DNA를 삽입 (6 어 금 니에 대 한 액세스 벡터) 리가 버퍼 x 2 10 리가 효소 1 H2O 단계 4.9 테스트 다이제스트 반응 (12μL) (Μ) DNA (100-300ng) 1 MfeI 0.25 BstbI 0.25 10 x 버퍼 1.2 H2O 9.3 단계 4.11 TRAV 다이제스트 반응 (60μL) (Μ) 베타 포함-mTCR pMIA 벡터 다이제스트 (120μL) DNA(~1.5μg) DNA (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x 버퍼 6 10 x 버퍼 10 H2O H2O

표 3입니다. 벡터 클로닝 반응입니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

현재 프로토콜에서 우리가 단일 셀 TCR 증폭 및 후속 하위 복제 쌍된 TCR 알파와 베타 체인의 템플릿 retroviral 식 벡터에 대 한 효율적인 방법을 설명 합니다. 비록, 여러 단 세포 PCR 프로토콜을 개발 하 고, 아무도 지금까지 있다 식 벡터에 즉시 하위 복제와 호환. 대부분의 경우, 높은 변수 CDR3 영역을 포괄 하는 부분 시퀀스는 증폭, 변수 영역을 추정 하는 것 충분 한 순서. 이 작은 PCR 제품 크기 높은 PCR 효율을 지원 하지만 드 노 보 TCR 유전자 합성 기능 연구 필요로 합니다. 현재 프로토콜 전체 변수 영역 복제에 대 한 적합을 포함 하는 더 긴 amplicon 저조한 동시에 이전에 게시 CDR3 중심 단일 셀 TCR 시퀀싱 프로토콜의 효율성을 유지 합니다. 따라서, 시스템 설명 주는 기능 출력 뿐만 아니라 양적 시퀀스에 증가 한 융통성이 있다.

해결 하는 과학적 질문에 따라 소스 및 분석 하는 T 세포의 특이성은 달라질 수 있습니다. 그러나, 경우에 프로젝트의 최종 목표는 TCR 기능 vivo에서 의 분석, 고립 된 T 세포의 HLA 제한 알고 필요가 있다. 현재 프로토콜 TCR 식 HLA humanized 쥐에서 vivo에서 호환 되도록 특별히 설계 되었습니다. 이러한 쥐의 많은 생성 된 고 지금 상업적으로 사용할 수 있습니다, HLA DQ8 HLA A2.1 포함 (HLA-DQA1 * 301, HLA DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11시 01분/K), HLA-B2705, HLA-A24, 그리고 HLA-B * 0702 유전자 변형 종자. 이 프로토콜 인간의 TCRs4,,1516의 retroviral 중재 골 수 줄기 세포 표현에 대 한 이전 게시 프로토콜 성공적으로 결합 될 수 있다. 우리는 인간 답게 TCR retrogenic 시스템 될 것으로 기대 및 다양 한 인간의 TCRs의 기능 분석을 위한 매우 유용한 면역, 암, 그리고 감염 모델.

현재 단일 셀 PCR 프로토콜 중요 한 단계를 설명 하 고 짝된 TCR 알파와 베타 TCR 시퀀스의 성공적인 증폭에 필요한 제안 제공. 첫 번째 중요 한 단계는 cDNA 전사의 적시 성능과 다중 PCR의 후속 첫 번째 라운드입니다. 적절 한 시기에 관련 된 모든 단계를 수행 해야 하 고 모든 시 약 및 셀 RNA, cDNA 저하를 방지 하기 위해 얼음에 보관. 둘째, 프로토콜을 서식 파일의 낮은 수준에 매우 민감한 되도록 설계 하기 때문에 그것은 오염에 매우 취약. 따라서, 증폭 된 PCR 제품 또는 TCR 벡터 클로닝 템플릿 무료 지역에서 일 하는 것이 필수적입니다. 별도 방 또는 후드 cDNA 및 PCR 반응 설정에 사용 되어야 한다. 서식 파일 첫 번째 PCR 반응에서 PCR 설정 어디에서 다른 영역에 추가 되어야 합니다. 그것은 aliquoted 시 약의 분리 된 단일 셀 PCR 실험을 위해 사용 되는 것이 좋습니다.

이 프로토콜은 특별히 최적화 되었습니다 재료의 테이블에에서 나열 된 시 약을 사용 하 고 어떤 대체 시 약에 추가 최적화를 필요 합니다. 항 원 특정 셀의 초기 식별 펩 티 드 MHC tetramers를 사용 하 여 수정할 수 있습니다. HLA-제한 뿐 아니라 항 원 특이성의 동시 평가 tetramer 얼룩 수 있습니다. 조기 활성화 표식의 upregulation 등 염증 성 cytokines의 분 비 항 원 반응의 검출을 위한 다른 방법 tetramer 시 약의 부재에 여겨질 수 있다. 예를 들어 이중 특이성 융합 항 체는 T 세포 항 원 및 IFNγ에 대 한 특정 항 원 반응 IFNγ 생산 세포에 대 한 풍부 하 게 자석 구슬 절연 결합할 수 있습니다.

동안 마우스 세포와 호환성을 보장 하는 우리의 프로토콜에서 설명 하는 공상 인간/마우스 구조, 복잡 한 인간 c d 3와의 호환성의 수준 불명 하다. 우리가 테스트 하지 공식적으로, 비록 다른 공상 TCR 구문 murine 일정 영역17인간 림프 톨 표면에 표현 될 수 있다 하는 것이 나타났습니다. 이 murine TCR 일정 지역 인간의 CD3 신호 복잡 한 상호작용을 지원할 수 있습니다 나타냅니다. 그러나, 목표 식별된 TCRs 인간의 1 차 셀 또는 Jurkat 세포 등 인간의 세포 라인에 표현 하는 더 최적의 접근 완전히 인간의 구성 개념을 사용 하 여 수 있습니다. 이것은 인간의 일정 영역 벡터 내의 murine 일정 영역을 교환 하 여 수행할 수 있습니다.

확인 된 TCR 변수 영역 복제에 사용 되는 제한 사이트 중 하나를 포함, TCR 셔틀 벡터에 삽입 되어야 하 고 이후에 변경 제한 내에서 자동 뉴클레오티드 변화를 유도 하는 사이트 감독 mutagenesis 키트를 사용 하 사이트를 잘라. 다른 접근 방법 원치 않는 제한 사이트를 제외 하도록 수정 하는 관심의 TCR 변수 영역의 드 노 보 합성입니다.

이 기술의 주요 제한은 보조 '세포질' 알파 체인의 증폭을 제거 하는 무 능력입니다. TCR 알파 유전자 이동 하지 마십시오 통해 TCR 베타 유전자, 같은 유전자 제외 따라서 T 세포의 상당한 비율이 보조 '세포질' 알파 체인14를 표현 합니다. 설명된 PCR 프로토콜 하지만 증폭된 알파 체인 증폭 된 베타 체인 쌍 하지 않을 수 있습니다 '세포질' 알파 체인은 하나의 TCR 알파 체인의 확대에만 발생 합니다. 따라서, 성공적인 체인 연결 되도록 HEK293T 셀에 TCR 셀 표면 식을 테스트 하는 것이 필수적입니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

이 연구는 JDRF 1-FAC-2014-243-A-N, 이다 7-14-JF-07, NIH 5 P30 DK079638-05 파일럿 PJ, 그리고는 로버트와 제 니스 맥 네 어 재단에 의해 투자 되었다.

우리는 산드라 페 냐와 Andrene 맥도날드 환자 모집, 새뮤얼 블 럼 박사 조지 Makedonas 항 체 및 제어 PCR 최적화에 사용 하는 DNA의 선물에 대 한 기술 지원에 대 한 감사.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
단일 셀 TCR 고립과 Retroviral 벡터 <em>생체 외에서 </em>의 생성과 <em>Vivo에서</em> 표현의 인간의 TCRs 간소화
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter