Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

تنقية عالية الوزن الجزيئي الحمض النووي الجينوم من البياض الدقيقي لونغ-مقروءة التسلسل

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

الفطريات البياض الدقيقي هي مجموعة من مسببات الأمراض الهامة اقتصاديا النبات الفطرية. لا يعرف إلا القليل نسبيا عن علم الأحياء وعلم الوراثة من هذه الجراثيم الجزيئي، ويرجع ذلك جزئيا إلى نقص الموارد الوراثية والجينوم متطورة. هذه الكائنات الحية لديها كبيرة، الجينوم المتكررة، التي جعلت تسلسل الجينوم والتجمع الصعب باهظة. هنا، نحن تصف أساليب لجمع واستخراج وتنقية ومراقبة الجودة تقييم عالية الوزن الجزيئي الجيني DNA من أنواع البياض الدقيقي واحد، Golovinomyces cichoracearum. ويتضمن بروتوكول صفها اضطراب الميكانيكي للجراثيم تليها الأمثل الفينول / الكلوروفورم استخراج الحمض النووي الجيني. وكان العائد نموذجي 7 DNA ميكروغرام لكل 150 غبيرات ملغ. الحمض النووي الجيني أن يتم عزل باستخدام هذا الإجراء هو مناسبة لتسلسل قراءة طويلة (أي> 48.5 KBP). تدابير مراقبة الجودة لضمان حجم، والغلة، ونقاء من الحمض النووي الجيني أيضاووصف في هذا الأسلوب. وتسلسل الحمض النووي الجيني نوعية الموصوفة هنا تسمح لتجميع ومقارنة الجينوم متعددة البياض الدقيقي، والتي بدورها سوف تؤدي إلى فهم أفضل وتحسين السيطرة على هذا الممرض الزراعي.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

بياض دقيقي هي مجموعة من إلزام مصنع الفطرية biotrophic مسببات الأمراض التي، عندما تؤخذ معا، هي أكبر سبب للأمراض النبات في جميع أنحاء العالم 1. وهناك أكثر من 900 نوع وصفها البياض الدقيقي، والتي تم تجميعها تصنيفيا إلى خمس قبائل داخل الأسرة Erisyphaceae 2. بسبب على حد سواء لأهميتها الاقتصادية والعلاقة الحميمة أن تتطور مع مضيفيهم، كانت أمراض البياض الدقيقي موضوع البحث ل> 100 سنة. على العدوى، بياض دقيقي تثير تغييرات جذرية في بنية الخلية، والتمثيل الغذائي والبيولوجيا الجزيئية من مضيفيهم، للاستفادة هذا الممرض. ومع ذلك، فإن دراسة بياض دقيقي هي تحديا من نوع خاص أسلوب حياتهم تلزم، ولم يتم بعد وصف نمو الفطريات في ثقافة نقية 3 و 4 و 5 نظرا ل،"XREF"> 6 و 7 و 8. كما لم يتم حتى الآن إنجاز موثوق بها، التحول الجيني مستقر للبياض دقيقي، على الرغم من التحول عابرة وقد ورد في بعض الأنواع 9 و 10.

وقد ثبت أن تسلسل الجينوم وتجميع البياض الدقيقي الصعب يرجع ذلك إلى عدد من الميزات الموجودة في الجينوم نفسه. الجينوم البياض الدقيقي كبيرة (120-180 م ب ب) بالنسبة إلى العوامل الوراثية الفطرية الأخرى، وتتكون من 60-90٪ موزعة بالتساوي العناصر المتكررة 11. وتشمل هذه العناصر يكرر الطرفية غير طويلة، فضلا عن العناصر المتكررة غير مصنف. اثنين speciales formae من نوع البياض الدقيقي واحدة، Blumeria graminis و. س. hordei وو. س. الحنطة (محكمة العدل الاتحادية وبغت، على التوالي)، وكذلك العنب البياض الدقيقي الفقاقة الفتاكة، يكون النحلالتسلسل ن، وقد تم الانتهاء من مشروع الجينوم للعديد من الآخرين 12 و 13 و 14. وقد جعلت الطبيعة التكرارية للجينومات الصعب التجمع، وتجميعها في محكمة العدل الاتحادية الجينوم الانتهاء في 6989 supercontigs مع L50 من 2 ميجا بايت 12.

وعلى الرغم من الجينوم كبير، تظهر بياض دقيقي لديها عدد قليل من البروتين الجينات الترميز، مع 5845 و6540 الجينات وتوقع في محكمة العدل الاتحادية وبغت، على التوالي. يظهر بياض دقيقي متسلسلة أيضا تفتقر إلى لا يقل عن 99 الجينات الأساسية التي لا غنى عنها في الفطريات الأخرى، وهو ما يتسق مع الاعتماد على الفطريات على النبات المضيف من أجل البقاء على قيد الحياة 11، 12، 13، 14.

تسلسل المتكررة قرب تيلومرات، القسيم، RN الريباسيوالمصفوفات والمناطق المخصب في جين قافز الجين يتم تجميعها بشكل سيئ من استراتيجيات التسلسل قراءة قصيرة وغالبا ما تكون ممثلة تمثيلا ناقصا في المجالس الجينوم 15. ويعتقد أن هذه المناطق لتكون مسؤولة عن العديد من الثغرات التي تحدث في تسلسل الجينوم، وهذا ينطبق على بياض دقيقي مع التوسع واسعة من العناصر المتكررة 16. غاية غالبا ما توجد مناطق الجينوم البلاستيكية في تلك المناطق المتكررة 3. وهي بمثابة موقع لإعادة ترتيب الكروموسومات، وغالبا ما ترميز الجينات تحت ضغط انتقائي قوي، مثل الجينات ترميز البروتينات المستجيب والجينات التي تكود إنزيمات الأيض الثانوية. التقدم في جزيء واحد تقنيات التسلسل قراءة طويلة توفر حلا ممكنا لتسلسل عبر المناطق المتكررة من الجينوم 15. على سبيل المثال، Faino وآخرون. (2015) وجدت أن بما في ذلك سلسلة طويلة قراءة التقنيات وم البصريةيسمح apping لهم لإنتاج تسلسل الجينوم الفجوة أقل للسلالتين من نبات فطري الممرض الداليا الكبكوبية، ثلاثة أضعاف نسبة تسلسل الحمض النووي المتكررة في الجينوم، وزيادة عدد من الشروح الجين (وخفض عدد جزئية أو مفقودة شروح الجين ) والجينوم يكشف إعادة ترتيب 17.

لاستخدام هذه التقنيات التسلسل قراءة طويلة، على تركيزات عالية من جودة عالية الحمض النووي الجيني، مع أحجام الحد الأدنى> 20 KBP، وهناك حاجة. نحن هنا وصف الأساليب لدينا لجمع بوغي، وتنقية عالية الوزن الجزيئي الحمض النووي من غبيرات وتقييمنا لمراقبة الجودة باستخدام cichoracearum الأنواع البياض الدقيقي Golovinomyces نمت على الخيار 18. ويستند هذا البروتوكول على بروتوكول المتقدمة في المجموعة مختبر B. كيلر (جامعة زيورخ، سويسرا) 13، 19ويشمل العديد من التعديلات التي أدت إلى زيادة الغلة DNA ونسبة أعلى من DNA> 48.5 KBP في الحجم. ويتضمن البروتوكول أيضا خطوات لمراقبة الجودة بناء على توصيات من وزارة الطاقة الأمريكية المشتركة الجينوم معهد 20 و 21 و 22.

وظيفة كل كاشف المدرجة في تحلل العازلة، والأساس المنطقي لكل خطوة التنقية، وكما هو موضح في هنري (2008) 23. تم التشاور البروتوكولات المنشورة المتاحة لعزل عالية الوزن الجزيئي الجيني DNA من الأنسجة النباتية والجراثيم أيضا خلال تصميم هذا البروتوكول 24، 25، 26، 27، 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. إعداد الفطرية المواد

  1. تزايد البياض الدقيقي
    1. تنمو النباتات في غرف النمو فقا للشروط التالية: 22 ° C اليوم درجة الحرارة 20 درجة مئوية درجة الحرارة ليلا، و 80٪ الرطوبة النسبية، 14 ساعة يوم طول وشدة الضوء من 125 μE / م 2 / ث (المقدمة من الإضاءة الفلورسنت ).
    2. تصيب نباتات الخيار (كوكوميس البركة متنوعة بوش بطل) مع Golovinomyces cichoracearum UCSC1 سلالة كما هو موضح 18، 29.
  2. حصاد البياض الدقيقي غبيرات
    1. حصاد غبيرات من النباتات المصابة في 7-10 أيام بعد التلقيح باستخدام فراغ صغير مع مرشح في الخط (11 ميكرون) التي وغبيرات تتراكم. تطبيق ضغط لطيف، قم بتشغيل فوهة فراغ على سطح ورقة لجمع غبيرات.
      ملاحظة: متوسط العائد من G. cichoracearum هي 20 ملغ من غبيرات من infe بشدةالمديرية رقة الخيار ما يقرب من 130 سم 2 في المنطقة.
    2. فرشاة حوالي 150 ملغ من غبيرات (حوالي 375 حجم ميكرولتر، أو غبيرات 7-8 يترك الخيار المصابة) من مرشح على ورقة نظيفة. من هنا، ونقل غبيرات إلى 2 مل cryovials مع اثنين من 5/32 بوصة قطر قبل المبردة (في النيتروجين السائل) كرات الصلب طحن. العودة فورا إلى أنابيب النيتروجين السائل. أنابيب مخزن في -80 ° C.
  3. كسر المفتوحة غبيرات بواسطة طحن الكرة
    1. فلاش تجميد لوحات الألومنيوم من مطحنة الكرة في النيتروجين السائل. تحميل cryovials إلى رف الكرة مطحنة. هزة بقوة في cryovials مع غبيرات وكرات الصلب في طاحونة الكرة لمدة 30 ثانية في 30 دورة / ق (في درجة حرارة الغرفة). على الفور اعادة تجميد cryovials في النيتروجين السائل.
      ملاحظة: في البداية، والوصول إلى عينة من غبيرات بواسطة المجهر في التكبير 100X لكفاءة تمزق جدار الخلية خلال طحن. إذا لزم الأمر، وطحن لمزيد من 1-2 جولات من 30 ثانية لمدة 30 دورات / ث، بالتحرير إبقاء عدد من الجولات إلى أدنى حد ممكن. التقييم الروتيني الكسر بوغي بواسطة المجهر في هذه المرحلة لا لزوم لها مرة واحدة وضعت الظروف المثلى.

2. الجينوم DNA تنقية

  1. غبيرات تحلل
    1. العمل بسرعة لتجنب ذوبان غبيرات، وإزالة كرات الصلب من cryovials مع المغناطيس. إضافة 700 ميكرولتر 65 ° C العازلة تحلل (الجدول 1) ودوامة 5-10 الصورة حتى يتم تشكيل الطين.
    2. إضافة 300 ميكرولتر قبل حرارة (65 درجة مئوية) 5٪ (ت / ت) sarcosyl وعكس بلطف لمزج (1 انقلاب في 3 ق) خمس مرات. احتضان الأنابيب لمدة 30 دقيقة عند 65 درجة مئوية. عكس بلطف 3 مرات في 10 و 20 و 30 دقيقة. استخدام على نطاق تتحمل ماصة، ونقل الحل بأكمله إلى 2 الجديدة أنبوب مل microcentrifuge. في جميع الخطوات اللاحقة، مزيج من قبل طيف، قلب بطيئة ونقل الحلول التي تحتوي على الحمض النووي مع نصائح ماصة واسعة تتحمل.
  2. استخراج الحمض النووي I
    1. إضافة 1 حجم كلوروالنموذج: الكحول أيزو أميلي (24: 1 ت / ت) إلى حل تحلل وبلطف عكس لخلط خمس مرات. احتضان لمدة 10 دقيقة في درجة حرارة الغرفة، عكس بلطف لمزج خمس مرات عند نقطة في منتصف الطريق، ومرة ​​أخرى في نهاية الحضانة. أجهزة الطرد المركزي في درجة حرارة الغرفة لمدة 15 دقيقة في 14000 ز س. استخدام على نطاق تتحمل ماصة، ونقل بعناية الطبقة المائية إلى 2 الجديدة أنبوب مل microcentrifuge. تجنب بما في ذلك المواد من واجهة.
  3. DNA الهطول I
    1. إضافة 1 حجم درجة حرارة الغرفة 100٪ الأيزوبروبانول (حوالي 750 ميكرولتر) وعكس بلطف لمزج ست مرات. أجهزة الطرد المركزي في درجة حرارة الغرفة لمدة 15 دقيقة في 14000 ز س. إزالة بعناية طاف وتجاهل.
    2. إضافة 450 ميكرولتر قبل المبردة (-20 ° C) 70٪ من الإيثانول. أجهزة الطرد المركزي لمدة 5 دقائق في درجة حرارة الغرفة في 14000 ز س. إزالة بعناية طاف وتجاهل. أجهزة الطرد المركزي في 1000 x ج لمدة 3 ثوان، وإزالة بعناية طاف مع طرف ماصة على ما يرام وتجاهل. الهواء الجاف وبيليه لمدة 15 دقيقة لتي درجة حرارة الغرفة. لا تجف لمدة أطول من 15 دقيقة.
    3. إعادة تعليق بيليه في 300 ميكرولتر TE (10 ملي تريس الكلورين، 1 ملم الاثيلين ديامين رباعي حمض الخل، ودرجة الحموضة 8.0). احتضان بين عشية وضحاها في 4 درجات مئوية. نفض الغبار برفق لإعادة تعليق أي مادة المتبقية التي لم تذهب إلى الحل.
  4. لإزالة التلوث RNA، إضافة 10 ميكرولتر ريبونوكلياز A (10 ملغ / مل). عكس بلطف لمزج ثلاث مرات. أجهزة الطرد المركزي في 1000 x ج لمدة 3 ثوان. احتضان عند 37 درجة مئوية لمدة 2 ساعة.
  5. استخراج الحمض النووي II
    1. إضافة 300 ميكرولتر الفينول: كلوروفورم: كحول أيزو أميلي (25: 24: 1 ت / ت) وعكس بلطف لمزج خمس مرات. احتضان 10 دقيقة في درجة حرارة الغرفة، عكس بلطف لمزج خمس مرات في منتصف الطريق، ومرة ​​أخرى في نهاية الحضانة. أجهزة الطرد المركزي لمدة 15 دقيقة في درجة حرارة الغرفة في 14000 ز س. استخدام على نطاق تتحمل ماصة، طاف لنقل جديد أنبوب 1.5 مل microcentrifuge.
  6. DNA الهطول II
    1. إضافة 0.01 حجم 3 M خلات الصوديوم الرقم الهيدروجيني 5.2 (approximatelص 3 ميكرولتر)، عكس بلطف لمزج خمس مرات. إضافة 2.5 مجلدات قبل المبردة (-20 ° C) الإيثانول بنسبة 100٪ (حوالي 750 ميكرولتر). عكس بلطف لمزج خمس مرات. احتضان بين عشية وضحاها في -20 درجة مئوية.
    2. الطرد المركزي 30 دقيقة في 4 درجات مئوية في 14000 ز س. إزالة بعناية طاف وتجاهل.
    3. إضافة 450 ميكرولتر قبل المبردة (-20 ° C) 70٪ من الإيثانول. أجهزة الطرد المركزي لمدة 5 دقائق في 4 درجات مئوية في 14000 ز س. إزالة بعناية طاف وتجاهل. أجهزة الطرد المركزي في 1000 x ج لمدة 3 ثوان. إزالة بعناية طاف مع طرف ماصة على ما يرام وتجاهل.
    4. الهواء الجاف وبيليه لمدة 30-60 دقيقة في درجة حرارة الغرفة. إعادة تعليق بيليه في 27.5 ميكرولتر TE. احتضان بين عشية وضحاها في 4 درجات مئوية. نفض الغبار برفق لإعادة تعليق أي مادة المتبقية التي لم تذهب إلى الحل.
    5. قسامة 2.5 ميكرولتر إلى 22.5 ميكرولتر TE (الحجم النهائي 25 ميكرولتر) لاختبارات مراقبة الجودة (انظر أدناه). عينات من الحمض النووي مخزن في 4 درجات مئوية حتى تقديم لتسلسل. للتخزين، وعينات تخزين على المدى الطويلفي -80 ° C وتقليل تجميد أذاب دورات لمنع القص.
      ملاحظة: خذ الحذر عند pipetting لفي هذه الخطوة باعتبارها عالية الوزن الجزيئي الجيني DNA يمكن أن يكون من الصعب ماصة بشكل صحيح، وأنه من المهم لضمان أن "QC قسامة" هو تمثيل دقيق لعينة DNA الجينومية.

3. مراقبة الجودة

  1. الطهارة عينة
    1. باستخدام TE فارغة، تقييم نقاء عينة من الحمض النووي عن طريق تحميل 1 ميكرولتر من QC قسامة على معمل صغيرة الحجم. سجل A260 / A280 A260 و/ A230 القراءات. سوف DNA النقي لديهم نسبة A260 / A280 من حوالي 1.8 و A260 / A230 النسبة بين 1.8 و 2.2.
  2. الكمي من الحمض النووي الجيني
    1. أداء الكمي لQC قسامة باستخدام المزدوج تقطعت بهم السبل الحمض النووي الكمي عدة فحص التجارية وفقا لتعليمات الشركة الصانعة.
  3. DNA تقييم جودة I
    1. تحميل ما يقرب من 60 نانوغرام الحمض النووي الجيني وسلم DNA على هلام الاغاروز 0.7٪ في 1X TAE (40 ملي تريس، 20 ملم حمض الخليك، و1 ملم EDTA، ودرجة الحموضة 8.0). جهاز هلام تشغيل في 70 V ل40 - 45 دقيقة حتى العصابات DNA الجينومية ما يقرب من 2 سم من الفصل بشكل جيد والفرقة في سلم هو واضح. قد تحتاج إلى تعديل بناء على الجهاز الكهربائي للهلام المتاحة في هذه الظروف.
  4. DNA تقييم جودة II
    1. تحميل ما يقرب من 60 نانوغرام الحمض النووي الجيني والجزيئي عالية سلم الوزن DNA (مناسبة للهلام الكهربائي حقل نابض) على هلام الاغاروز 1٪ في TBE 0.5X (44.5 ملي تريس، 44.5 ملم حمض البوريك، 1 ملم EDTA، ودرجة الحموضة 8.3) و تشغيل في 0.5X TBE العازلة تشغيل باستخدام 5-80 KBP الموجي حقل نابض بروتوكول هلام الكهربائي لمدة 16 ساعة.
  5. تقييم البكتيرية، الفطرية، والملوثات النبات
    1. أداء تفاعل البلمرة المتسلسل (PCR) لتضخيم الفواصل كتب الداخلية المناسبة (ITS) مناطق الجينات الريباسي باستخدام بادئات والشروط التضخيم قائمةإد في الجدول 2. تحميل 10 ميكرولتر من رد الفعل الناتج عن مادة هلامية.
      ملاحظة: الفرقة التي تمثل البياض الدقيقي يجب تضخيم المنطقة ITS مع ITS الاشعال الفطرية. يجب أن تكون متسلسلة DNA من هذه amplicon وأي amplicon ولدت مع، أو الاشعال النبات البكتيرية لتحديد مصدر التلوث. البياض الدقيقي الوحيد ينبغي إيجاد تسلسل ITS في amplicon الفطرية.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

cichoracearum تشغيل مثال ممثل 60ng الحمض النووي الجيني النقي من G. على هلام الاغاروز باستخدام هلام الكهربائي واستخدام حقل نابض هلام الكهربائي وترد في أرقام 1 و 2 على التوالي. وتمثل الاستعدادات DNA الجينومية أن تمر، هامشي تمر وتفشل مراقبة الجودة. الاستعدادات DNA الجينومية التي تمر بالكامل مراقبة الجودة مثالية لتسلسل باستخدام نهج تسلسل الجينوم قراءة منذ فترة طويلة. الاستعدادات التي تمر هامشي مراقبة الجودة مقبولة، ولكن يفضل الاستعدادات التي تمر بالكامل. الاستعدادات التي تفشل مراقبة الجودة ليست مقبولة لنهج تسلسل الجينوم طويلة للقراءة.

شكل 1
الشكل 1: الاغاروز جل الكهربائي لتنقية الجينوم DNA. حارة 1: 2 لين: الحمض النووي الجيني التي مرت مراقبة الجودة. حارة 3: الحمض النووي الجيني التي كانت تعتبر هامشية. ولين 4: الحمض النووي الجيني الذي فشل مراقبة الجودة. عينات من الحمض النووي الجينومية مقبولة وهامشية لديها فرقة واحدة تعمل أكثر من 20 KBP مع الحد الأدنى من تلطيخ في <20 KBP. عينات من الحمض النووي الجينومية أن تفشل لمراقبة الجودة وتلطخ أقل من 20 KBP، ويمكن أن تشمل انخفاض شظايا الوزن الجزيئي في حوالي 100 سنة مضت (*). مطلوب الكهربائي للهلام الميدان نابض للتمييز بين عينات DNA مقبولة وهامشية. تمت إضافة بروميد إيثيديوم إلى هلام قبل الكهربائي لتصور الحمض النووي الجيني. تم electrophoresed عينات في 60 V لمدة 50 دقيقة. تم تصوير الجل تحت ضوء الأشعة فوق البنفسجية باستخدام نظام الوثائق هلام.

الشكل 2
الشكل2: نابض-الميدان جل الكهربائي (PFGE) من تنقية البياض الدقيقي الجينوم DNA. حارة 1: معايير الوزن الجزيئي، وفقا لأعلى الفرقة في 48.5 KBP و أدنى مستوى عند 8.1 KBP. الممرات 2 و 5: معايير الوزن الجزيئي تظهر عصابات من 20، 10، 7، 5، 4، 3، 2 و 1.5 KBP (في الجزء السفلي من صورة هلام). حارة 3: عينة DNA هامشية، مع غالبية DNA بين 20 و 48.5 KBP في الحجم. حارة 4: عينة DNA مقبولة، مع غالبية DNA> 48.5 KBP (*). تم تشغيل عينات في 75 V لمدة 15 ساعة باستخدام برنامج PFGE الموجي 5-80 KBP. تمت إضافة DNA تلطيخ صبغ للهلام بعد الكهربائي وتصوير الجل تحت ضوء الأشعة فوق البنفسجية باستخدام نظام الوثائق هلام.

الكاشف تركيز النهائي
البوتاسيوم متعبisulfite (K 2 S 2 O 5) 0.25 M
تريس درجة الحموضة عازلة 7.5 0.2 M
ثنائي أمين الإيثيلين رباعي حمض الخل (EDTA) 50 ملي
كلوريد الصوديوم (كلوريد الصوديوم) 2 M
بروميد الأمونيوم Cetyltrimethyl (CTAB) 2٪ ت / ت

الجدول 1: إعداد الاحتياطي تحلل. جلب لحجم 5 مل مع DH 2 O.

استهداف اسم التمهيدي تسلسل التمهيدي تيم (° C) المنتج المتوقع الحجم (بي بي)
الفطرية ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61،3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52.1
بكتيريا 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63،8-66،5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46،9-53،8
بكتيريا 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60،8-66،5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43،9-53،8
الفطرية 18S V4 FW CCAGCASCYGCGGTAATTCC 58،7-61،5 431
RV ACTTTCGTTCTTGATYRA 43،2-48،3
كوكوميس نبات الخيار PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63.8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66.6

الجدول 2: الاشعال لتقييم تلوث.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

من أجل الحصول على النقي، وارتفاع الوزن الجزيئي الجيني DNA من تلزم biotrophic فطريات البياض الدقيقي، وقد تم تطوير نسخة معدلة من الأساليب المذكورة سابقا 30. ومتوسط ​​العائد باستخدام هذا البروتوكول الأمثل هو 7 DNA ميكروغرام لكل 150 ملغ غبيرات، مضاعفة الغلة التي تم الحصول عليها مع بروتوكول مسبق. كما ارتفع متوسط ​​حجم من حوالي 20 KBP إلى أكثر من 48.5 KBP. وكان محسن هذا البروتوكول في النظام cichoracearum G. cucumber-. من أجل الحصول على أفضل جودة وأعلى نقاء DNA في البياض الدقيقي الآخرين أو إلزام الفطريات biotrophic، قد يحتاج إلى تعديل إضافي من هذا البروتوكول. في المستقبل، يمكن استخدام هذا البروتوكول للحصول على ارتفاع الوزن الجزيئي DNA مناسبة لقراءة طويلة تسلسل الحمض النووي من الفطريات biotrophic تلزم الأخرى، على الرغم مزيد من التعديل قد يكون مطلوبا.

موازنة العائد DNA عالية وعالية الوزن الجزيئي من الحمض النووي المستخرج كان مصدر قلقخلال الاستفادة المثلى من هذا البروتوكول. تم القضاء على الخطوات بما في ذلك vortexing لمن أجل تقليل القص من الحمض النووي، واستعيض عن طريق خلط بلطف بواسطة انقلاب. زاد هذا التغيير في نوعية الحمض النووي المستخرج من دون الحد بشكل كبير من العائد. بالإضافة إلى ذلك، إزالة كرات الصلب في بداية الخطوة خلية تحلل زيادة كبيرة في العائد DNA بالمقارنة مع ترك الكرات في الحل حتى نهاية الخطوة تحلل.

بقي لا G. cichoracearum غبيرات سليمة بعد العملية طحن الكرة في الخطوة 1.3. للحصول على عوائد جيدة من ارتفاع الوزن الجزيئي الجيني DNA، فمن الأهمية بمكان أن جدار الخلية الفطرية وتعطلت خلال هذه الخطوة. سلامة غبيري يمكن تقييم المجهر، وربما تكون هناك حاجة طحن الكرة إضافي أو طرق بديلة لتعطيل الأنواع الفطرية الأخرى.

بعض غبيرات الفطرية، ولا سيما س Blumeria، يحتوي على أصباغ التي يمكن للمقاولاتيؤمين استخراج الحمض النووي وتنقية المحاولات. في هذه الحالات، ونحن نوصي بما في ذلك خطوة الترشيح DNA كما هو موضح في Bourras وآخرون. (2015) بروتوكول 19 وخطوة غسيل إضافية مع TE بعد خطوة الترشيح. أدت إضافة خطوة الترشيح في زيادة صغيرة ولكنها كبيرة في تدهور DNA، وينبغي أن تدرج فقط إذا بقي تصبغ مفرط بعد خطوة DNA هطول الثانية. هذه الصبغات، إذا سمح له بالبقاء في حل، قد يتداخل مع تحليل لاحق من نوعية وكمية من الحمض النووي ويحتمل أن تتداخل مع ردود الفعل التسلسل.

ويشمل هذا البروتوكول كل من الاغاروز خطوة هلام الكهربائي التقليدية وخطوة الكهربائي للهلام الميدان نابض. الأول هو تقييم أولي لجزء من الحمض النووي الذي هو> 20 KBP وجزء الذي يعمل على تشويه في <20 KBP. لغرض ردود الفعل التسلسل التحويلية اللازمة لمل مساحيقالجينوم الندى، جزء من الحمض النووي <يجب أن تكون 20 KBP الحد الأدنى (انظر الشكل 1، 2 لين مقابل حارة 4). يوفر تقييم الكهربائي للهلام الميدان نابض تقدير أفضل لحجم وDNA> 20 KBP يمكن فصلها حسب الحجم. الحمض النووي لل> 48.5 KBP أمر مرغوب فيه لاستخدامها في التفاعلات التسلسل اللاحقة (انظر الشكل 2، حارة 4).

تم نشر المواد الفطرية المستخدمة في هذه التجارب في غرف النمو والتلوث كان محدودا باستخدام بروتوكولات عزلة صارمة وضوابط الموظفين. وبسبب هذا، كان التلوث مع مسببات الأمراض العفن الآخرين وعدم مساحيق-الحد الأدنى، وتسلسل المنطقة ITS تضخيم باستخدام بادئات-الفطريات محددة استعادت فقط G. تسلسل cichoracearum. قد لا يكون هذا هو الحال بالنسبة لبياض دقيقي تم جمعها من المواقع الميدانية أو الدفيئات الزراعية التي تفتقر إلى نفس الضوابط العزلة، وتقييم التلوث في هذه الاكاديميةوفاق ستكون حاسمة لتجميع الجينوم ذات جودة عالية من الحمض النووي المستخرج.

كان أي تعديل واحد من البروتوكولات المختلفة عزل الحمض النووي الفطرية فريد الأهمية. وبدلا من ذلك أدت تعديلات طفيفة في العديد من الخطوات في عوائد عالية نسبيا من ارتفاع الوزن الجزيئي مساحيق DNA العفن ذكرت هنا.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
تنقية عالية الوزن الجزيئي الحمض النووي الجينوم من البياض الدقيقي لونغ-مقروءة التسلسل
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter