Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

La purification de l'ADN de haut poids moléculaire Génomique de oïdium pour le séquençage de longue Lire

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

Les champignons oïdium sont un groupe d'agents pathogènes des plantes fongiques économiquement importantes. On sait peu de choses sur la biologie moléculaire et de la génétique de ces agents pathogènes, en partie en raison d'un manque de ressources génétiques et génomiques bien développées. Ces organismes ont de grands génomes répétitifs, qui ont fait le séquençage du génome et de l'assemblage prohibitive difficile. Nous décrivons ici les méthodes de collecte, de l' extraction, la purification et l' évaluation du contrôle de la qualité de l' ADN génomique de haut poids moléculaire d'une espèce de oïdium, Golovinomyces cichoracearum. Le protocole décrit comprend une rupture mécanique de spores suivi d'un phénol optimisé / chloroforme extraction de l'ADN génomique. Un rendement typique était de 7 pg d'ADN par 150 mg de conidies. L'ADN génomique est isolé en utilisant cette procédure est appropriée pour le séquençage de longue lecture ( par exemple,> 48,5 kpb). mesures de contrôle de la qualité pour assurer la taille, le rendement et la pureté de l'ADN génomique sont égalementdécrit dans le présent procédé. Le séquençage de l'ADN génomique de la qualité décrite ici permettra l'assemblage et la comparaison des génomes multiples de l'oïdium, qui à son tour conduire à une meilleure compréhension et un meilleur contrôle de ce pathogène agricole.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Oïdium sont un groupe de plantes fongique biotrophe obligatoire des agents pathogènes qui, lorsqu'ils sont pris ensemble, sont la principale cause de maladies des plantes dans le monde entier 1. Il y a plus de 900 espèces décrites de l' oïdium, qui ont été regroupées en cinq taxonomiquement tribus au sein de la famille Erisyphaceae 2. En raison de leur importance à la fois économique et la relation intime qu'ils développent avec leurs hôtes, les maladies oïdium ont fait l'objet de la recherche pour> 100 ans. Lors de l'infection, l'oïdium provoquent des changements radicaux dans la structure cellulaire, le métabolisme et la biologie moléculaire de leurs hôtes, de bénéficier de ce pathogène. Cependant, l'étude de l' oïdium est particulièrement difficile en raison de leur mode de vie obligatoire, et la croissance du champignon en culture pure n'a pas encore été décrit 3, 4, 5,"xref"> 6, 7, 8. Fiable, la transformation génétique stable de l' oïdium a pas encore été accompli, bien que la transformation transitoire a été rapportée chez certaines espèces 9, 10.

Le séquençage et l'assemblage des génomes oïdium est avéré difficile en raison d'un certain nombre de caractéristiques du génome lui-même. Génomes de l' oïdium sont grandes (120-180 Mbp) par rapport à d' autres génomes fongiques, et se composent de 60 - 90% des éléments répétitifs répartis uniformément 11. Ces éléments comprennent des répétitions terminales non-longues, ainsi que des éléments répétitifs non catégorisés. Deux formae d'une Speciales seule espèce oïdium, Blumeria graminis f. sp. hordei et f. sp. tritici (BGH et Bgt, respectivement), ainsi que l'oïdium de la vigne Erysiphe necator, ont abeillen séquencés, et les projets de génomes pour plusieurs autres ont été réalisées 12, 13, 14. Le caractère répétitif des génomes a fait l' assemblage difficile, et le génome Bgh complété a été assemblé en 6,989 supercontigs avec un L50 de 2 Mb 12.

Malgré le grand génome, les oïdium semblent avoir un petit nombre de gènes codant pour des protéines, avec 5,845 et 6.540 gènes prédits dans Bgh et Bgt, respectivement. Les oïdium séquencés semblent également manquer au moins 99 gènes essentiels qui sont essentiels dans d' autres champignons, ce qui est cohérent avec la dépendance des champignons sur leur plante hôte pour la survie 11, 12, 13, 14.

séquences répétitives proches de télomères, centromères, ribosomal RNA matrices de gènes et des régions enrichies en éléments transposables sont mal assemblés à partir de stratégies de séquençage courte lecture et sont souvent sous-représentés dans les assemblages de génome 15. Ces régions sont considérées comme responsables de bon nombre des lacunes qui se produisent dans des séquences du génome, et cela vaut pour les oïdium avec leur vaste expansion des éléments répétitifs 16. Très régions du génome plastique sont souvent trouvés dans ces régions répétitives 3. Ils servent un site de réarrangements chromosomiques et encodent souvent des gènes sous forte pression sélective, tels que les gènes codant pour des protéines effectrices et les gènes codant pour des enzymes du métabolisme secondaire. Les progrès des technologies de séquençage à long lecture seule molécule offrent une solution potentielle pour le séquençage à travers les régions répétitives des génomes 15. Par exemple, Faino et al. (2015) ont trouvé que l'inclusion de longue séquence de lecture optique et des technologies mapping leur a permis de produire une séquence du génome de fente inférieure à deux souches de l'agent pathogène des plantes fongique dahlia Verticillium, triplant la proportion de séquences d'ADN répétitives dans le génome, ce qui augmente le nombre d'annotations de gènes (et réduire le nombre d'annotations de gènes partielles ou manquantes ) et le génome révélateur réarrangements 17.

Pour utiliser ces technologies de séquençage de longue lecture, de fortes concentrations d'ADN génomique de haute qualité, avec des tailles minimum> 20 kbp, sont nécessaires. Nous décrivons ici nos méthodes de collecte conidies, la purification de l' ADN à haut poids moléculaire de conidies et nos évaluations de contrôle de la qualité en utilisant la cichoracearum de l'espèce de oïdium Cultivé sur le concombre 18. Ce protocole est basé sur un protocole développé dans le groupe B. laboratoire Keller (Université de Zürich, Zürich Suisse) 13, 19et comprend plusieurs modifications qui ont conduit à des rendements accrus d'ADN et une proportion plus élevée d'ADN> 48,5 kpb de taille. Le protocole comprend également des mesures de contrôle de la qualité en fonction des recommandations du ministère américain de l' énergie Joint Genome Institute 20, 21, 22.

La fonction de chaque réactif inclus dans le tampon de lyse, et la justification de chaque étape de purification, sont tels que décrits dans Henry (2008) 23. Protocoles publiés disponibles pour l' isolement de l' ADN génomique de haut poids moléculaire à partir de tissus végétaux et microbiens ont également été consultés lors de la conception de ce protocole 24, 25, 26, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Préparation du matériel Fungal

  1. De plus en plus oïdium
    1. Faire pousser des plantes dans des chambres de culture avec les conditions suivantes: 22 ° C Température de jour, température de 20 ° C la nuit, 80% d' humidité relative, jour de longueur de 14 h et une intensité lumineuse de 125 uE / m2 / s (fournies par l' éclairage fluorescent ).
    2. Infectent plants de concombre (Cucumis sativa variété Champion Bush) avec la UCSC1 de souche Golovinomyces comme décrit 18, 29.
  2. La récolte oïdium conidies
    1. conidies de récolte de plantes infectées à 7 - 10 jours après l'inoculation au moyen d'un petit aspirateur avec une sur laquelle les conidies accumulent filtre (11 pm) en ligne. En appliquant une légère pression, exécuter la buse d'aspiration le long de la surface de la feuille pour collecter les conidies.
      NOTE: Le rendement moyen de G. cichoracearum est de 20 mg de conidies à partir d' un très infeDECCT feuille de concombre d'environ 130 cm 2 de surface.
    2. Brosser environ 150 mg de conidies (environ 375 ul de volume, ou conidies de 7-8 feuilles de concombre infectées) du filtre sur une feuille de papier propre. A partir de là, transférer conidies dans 2 ml cryotubes avec deux 5 / diamètre de 32 pouces pré-refroidie (dans de l'azote liquide) billes de broyage en acier. retourner immédiatement tubes à l'azote liquide. des tubes de conserver à -80 ° C.
  3. Briser ouvert conidies par broyage à boulets
    1. des plaques d'aluminium gel éclair de broyeur à billes dans de l'azote liquide. Charge cryotubes dans le rack broyeur à boulets. agiter vigoureusement les cryotubes avec des boules de conidies et de l'acier dans le broyeur à boulets pendant 30 s à 30 cycles / s (à température ambiante). Immédiatement recongeler cryotubes dans de l'azote liquide.
      NOTE: Dans un premier temps, accéder à un échantillon de conidies par microscopie à grossissement 100X pour l'efficacité de la rupture de la paroi cellulaire au cours du broyage. Si nécessaire, rectifier pendant encore 1 - 2 tours de 30 s pour 30 cycles / s, but garder le nombre de tours au minimum. une évaluation systématique de rupture conidies par microscopie à ce stade est inutile une fois que les conditions optimales ont été établies.

2. Génomique de purification d'ADN

  1. conidies lyse
    1. Travailler rapidement pour éviter conidies de décongélation, retirez les billes d'acier de cryoampoules avec un aimant. Ajouter 700 ul 65 ° C tampon de lyse (tableau 1) et vortex 5 - 10 s jusqu'à ce qu'une pâte se forme.
    2. Ajouter 300 ul préchauffé (65 ° C) 5% (v / v) de sarcosyle et inverser doucement pour mélanger (1 inversion par 3 s) cinq fois. Incuber les tubes pendant 30 minutes à 65 ° C; inverser doucement 3 fois à 10, 20 et 30 min. En utilisant une pointe de pipette de grand diamètre, transfert solution complète au nouveau tube de 2 ml. A toutes les étapes ultérieures, mélanger doucement, l'inversion lente et transférer les solutions contenant de l'ADN avec grand diamètre des embouts de pipette.
  2. Extraction de l'ADN I
    1. Ajouter 1 volume de chloroforme: alcool isoamylique (24: 1 v / v) à la solution de lyse et inverser doucement pour mélanger cinq fois. Incuber pendant 10 min à température ambiante, en inversant doucement pour mélanger cinq fois au niveau du point à mi-chemin et à nouveau à la fin de l'incubation. Centrifuger à température ambiante pendant 15 min à 14 000 x g. Utilisation de la pointe de pipette de grand diamètre, transférer soigneusement la phase aqueuse dans un nouveau tube de microcentrifugeuse de 2 ml; éviter d'inclure du contenu de l'interface.
  3. ADN Précipitations I
    1. Ajouter 1 volume température ambiante 100% de l'isopropanol (environ 750 pi) et inverser doucement pour mélanger six fois. Centrifuger à température ambiante pendant 15 min à 14 000 x g. Retirez délicatement le surnageant et le jeter.
    2. Ajouter 450 ul de pré-refroidie (-20 ° C) 70% d'éthanol. Centrifuger pendant 5 minutes à la température ambiante à 14 000 x g. Retirez délicatement le surnageant et le jeter. Centrifuger à 1000 g pendant 3 s, retirez délicatement le surnageant avec une pointe de pipette fine et jeter. Sécher à l'air la pastille pendant 15 min unt température ambiante. Ne pas sécher pendant plus de 15 min.
    3. Remettre en suspension le culot dans 300 ul de TE (10 mM Tris-Cl, 1 mM d'acide ethylene diamine tétra-acétique, pH 8,0). Incuber pendant une nuit à 4 ° C. tapotez doucement pour remettre en suspension tout matériau résiduel qui ne va pas dans la solution.
  4. Pour éliminer la contamination de l'ARN, ajouter 10 pi RNase A (10 mg / ml). Retournez délicatement mélanger trois fois. Centrifuger à 1000 g pendant 3 s. Incuber à 37 ° C pendant 2 h.
  5. Extraction de l'ADN II
    1. Ajouter 300 ul de phénol: chloroforme: alcool isoamylique (25: 24: 1 v / v) et inverser doucement pour mélanger cinq fois. Incuber 10 min à température ambiante, en inversant doucement pour mélanger cinq fois à la mi-course et à nouveau à la fin de l'incubation. Centrifuger 15 min à température ambiante à 14 000 x g. En utilisant une pointe de pipette de grand diamètre, transférer le surnageant à nouveau 1,5 ml microtube.
  6. ADN II Précipitations
    1. Ajouter 0,01 volume de 3 M à pH 5,2 d'acétate de sodium (approximately 3 ul), inverser doucement pour mélanger cinq fois. Ajouter 2,5 volumes de pré-refroidie (-20 ° C) 100% d'éthanol (environ 750 pi). Retournez délicatement pour mélanger cinq fois. Incuber pendant une nuit à -20 ° C
    2. Centrifuger 30 min à 4 ° C à 14000 x g. Retirez délicatement le surnageant et le jeter.
    3. Ajouter 450 ul de pré-refroidie (-20 ° C) 70% d'éthanol. Centrifuger pendant 5 minutes à 4 ° C à 14000 x g. Retirez délicatement le surnageant et le jeter. Centrifuger à 1000 g pendant 3 s. Retirez délicatement le surnageant avec une pointe de pipette fine et défausse.
    4. Sécher à l'air la pastille pendant 30-60 min à température ambiante. Remettre en suspension le culot dans 27,5 ul de TE. Incuber pendant une nuit à 4 ° C. tapotez doucement pour remettre en suspension tout matériau résiduel qui ne va pas dans la solution.
    5. Aliquote de 2,5 ul dans 22,5 ul de TE (volume final 25 ul) pour les tests de contrôle de qualité (voir ci-dessous). Des échantillons d'ADN de conserver à 4 ° C jusqu'à ce que la transmission pour le séquençage. Pour stockage à long terme, des échantillons de magasinà -80 ° C et réduire les cycles de gel-dégel pour éviter le cisaillement.
      REMARQUE: Faites attention lors de pipetage à cette étape que l'ADN génomique de haut poids moléculaire peut être difficile à pipette, et il est important de veiller à ce que « QC aliquote » est une représentation précise de l'échantillon d'ADN génomique.

3. Contrôle de la qualité

  1. Pureté échantillon
    1. L'utilisation d'un blanc TE, évaluer la pureté de l'échantillon de l'ADN en chargeant 1 pi du QC aliquote sur un spectrophotomètre petit volume. Enregistrez A260 / A280 et A260 / A230. Lectures L'ADN pur aura un rapport A260 / A280 d'environ 1,8 et A260 / A230 rapport entre 1,8 et 2,2.
  2. Quantification de l'ADN génomique
    1. Effectuer la quantification de la portion aliquote QC en utilisant un kit de dosage de quantification d'ADN double brin commercial conformément aux instructions du fabricant.
  3. ADN évaluation de la qualité I
    1. Charge d'environ 60 ng d'ADN génomique etEchelle d'ADN sur un gel d'agarose à 0,7% en TAE 1X (40 mM de Tris, 20 mM d'acide acétique, et 1 mM d'EDTA, pH 8,0). Appareil de gel de fonctionner à 70 V pendant 40 - 45 min jusqu'à ce que les bandes d'ADN génomique sont d'environ 2 cm de la séparation de puits et la bande de l'échelle est apparente. Ces conditions peuvent devoir être ajustée en fonction de l'appareil d'électrophorèse sur gel disponible.
  4. ADN qualité II Évaluation
    1. Charge d'environ 60 ng d'ADN génomique et une échelle d'ADN de poids moléculaire élevé (adapté à l'électrophorèse sur gel en champ pulsé) sur un gel d'agarose à 1% dans 0,5 x TBE (44,5 mM de Tris, d'acide borique 44,5 mM, EDTA 1 mM, pH 8,3) et exécuter dans un tampon de migration 0,5 x TBE en utilisant un 5 - Protocole d'électrophorèse sur gel 80 de forme d'onde kpb en champ pulsé pendant 16 h.
  5. Évaluation des bactéries, des champignons et des contaminants végétaux
    1. Effectuer une réaction en chaîne par polymérase (PCR) pour amplifier les espaceurs transcrits internes (ITS) appropriées régions des gènes ribosomiques en utilisant des amorces et des conditions d'amplification listeed dans le tableau 2. Charge: 10 ul de la réaction résultant sur un gel.
      NOTE: Une bande représentant le oïdium région ITS devrait être amplifié avec les amorces ITS fongiques. L'ADN de ce amplicon et tout amplicon généré avec les bactéries, ou des amorces végétales doivent être séquencés pour déterminer l'origine de la contamination. Seulement oïdium des séquences ITS doit être trouvée dans le amplicon fongique.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Un exemple représentatif de 60 ng d' ADN génomique purifié à partir de G. cichoracearum sur un gel d' agarose en utilisant une électrophorèse sur gel et par électrophorèse sur gel en champ pulsé sont représentés sur les figures 1 et 2, respectivement. Des préparations d'ADN génomique qui passent, passent légèrement et échouent le contrôle de la qualité sont représentés. Des préparations d'ADN génomique qui passent entièrement le contrôle de la qualité sont idéales pour le séquençage en utilisant des approches de séquençage du génome à long lecture. Les préparations qui passent légèrement contrôle de la qualité sont acceptables, mais les préparations qui passent complètement sont préférés. Les préparatifs qui ne contrôle de la qualité ne sont pas acceptables pour les approches de séquençage du génome à long lecture.

Figure 1
Figure 1: Electrophorèse sur gel d' agarose de l' ADN génomique purifié. Piste 1: Lane 2: ADN génomique qui a passé le contrôle de qualité; Lane 3: l' ADN génomique qui a été considéré comme marginal; et Lane 4: l' ADN génomique qui a échoué le contrôle de la qualité. échantillons d'ADN génomique acceptables et marginales ont une seule bande en cours d'exécution au-dessus de 20 kbp avec un minimum de maculage à <20 kbp. Les échantillons d'ADN génomiques qui ne contrôle de qualité ont maculage en dessous de 20 kbp, et peuvent inclure des fragments de bas poids moléculaire d'environ 100 pb (*). électrophorèse en champ pulsé est nécessaire de faire la distinction entre les échantillons d'ADN acceptables et marginales. Le bromure d'éthidium a été ajouté au gel avant l'électrophorèse pour visualiser l'ADN génomique. Les échantillons ont été soumis à une électrophorèse à 60 V pendant 50 min. Le gel a été imagée sous lumière UV en utilisant un système de documentation de gel.

Figure 2
Figure2: Gel Electrophoresis en champ pulsé (ECP) purifiée oïdium ADN génomique. La piste 1: étalons de masse moléculaire, avec la plus grande bande à 48,5 kbp et la plus faible à 8,1 kpb. Les pistes 2 et 5: étalons de masse moléculaire présentant des bandes de 20, 10, 7, 5, 4, 3, 2 et 1,5 kpb (en bas de l'image du gel). Piste 3: un échantillon d'ADN marginal, avec la majorité de l'ADN entre 20 et 48,5 kpb de taille. Piste 4: un échantillon d'ADN acceptable, avec la majorité de l'ADN> 48,5 kbp (*). Les échantillons ont été effectués à 75 V pendant 15 h en utilisant un programme de forme d'onde de PFGE 5-80 kpb. colorant ADN-coloration a été ajouté au gel après électrophorèse et le gel a été imagée sous lumière UV en utilisant un système de documentation de gel.

Réactif Concentration finale
Metab de potassiumisulfite (K 2 S 2 O 5) 0,25 M
Tampon Tris pH 7,5 0,2 M
l'acide éthylènediaminetétraacétique (EDTA) 50 mM
Le chlorure de sodium (NaCl) 2 M
le bromure de cétyltriméthylammonium (CTAB) 2% v / v

Tableau 1: Préparation du tampon de lyse. Porter à un volume de 5 ml avec dH 2 O.

Cible Nom Primer séquence primaire Tm (° C) Taille du produit attendu (pb)
Fungal ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56 à 61,3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52,1
Bactérienne 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63,8 à 66,5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46,9 à 53,8
Bactérienne 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60,8 à 66,5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43,9 à 53,8
Fungal 18S V4 FW CCAGCASCYGCGGTAATTCC 58,7 à 61,5 431
RV ACTTTCGTTCTTGATYRA 43,2 à 48,3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63,8 750
R CsPDS GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66,6

Tableau 2: Amorces pour évaluation de la contamination.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Afin d'obtenir de l' ADN pur, génomique de haut poids moléculaire de la obligatoire champignons de l' oïdium biotrophe, une version modifiée de procédés décrits précédemment a été développé 30. Le rendement moyen en utilisant ce protocole optimisé est de 7 pg d'ADN par 150 mg de conidies, un doublement du rendement obtenu avec un protocole antérieur. En outre, la taille moyenne est passée d'environ 20 kbp à plus de 48,5 kbp. Ce protocole a été optimisé dans le système G. cichoracearum cucumber-. Afin d'obtenir la meilleure qualité et de l'ADN de pureté la plus élevée dans d'autres oïdium ou champignons biotrophe oblige, une modification supplémentaire de ce protocole peut être nécessaire. À l'avenir, ce protocole peut être utilisé pour obtenir de l'ADN de poids moléculaire élevé appropriés pour le séquençage d'ADN long lue à partir d'autres champignons biotrophes obligatoires, bien que d'autres modifications peuvent être nécessaires.

Équilibre entre un rendement élevé d'ADN et de haut poids moléculaire de l'ADN extrait a été une préoccupationlors de l'optimisation de ce protocole. Des mesures ont été éliminés, dont tourbillonnement afin de minimiser le cisaillement de l'ADN, et ont été remplacés en mélangeant doucement par inversion. Ce changement a amélioré la qualité de l'ADN extrait sans réduire de manière significative le rendement. En outre, l'enlèvement des billes d'acier au début de l'étape de lyse des cellules a augmenté de manière significative le rendement en ADN par rapport à laisser les billes dans la solution jusqu'à la fin de l'étape de lyse.

Non G. cichoracearum conidies est restée intacte après la procédure de broyage à boulets à l' étape 1.3. Pour obtenir de bons rendements de l'ADN génomique de haut poids moléculaire, il est crucial que la paroi cellulaire fongique est perturbée au cours de cette étape. l'intégrité Conidial peut être évaluée au microscope, et le broyage à boulets ou méthodes de perturbation alternatives peuvent être nécessaires pour d'autres espèces fongiques.

Certains conidies fongiques, notamment les sp Blumeria., Contiennent des pigments qui peuvent Contextraction de l'ADN aminer et les tentatives de purification. Dans ces cas, nous recommandons d' inclure l'étape de filtration de l' ADN tel que décrit dans le Bourras et al. (2015) 19 protocole et une étape de lavage supplémentaire avec du TE après l'étape de filtration. L'ajout de l'étape de filtration a entraîné une augmentation faible mais significative de la dégradation de l'ADN, et ne devrait être inclus si la pigmentation excessive reste après la seconde étape de précipitation de l'ADN. Ces pigments, si on les laisse rester en solution, peuvent interférer avec une analyse ultérieure de la qualité et de la quantité d'ADN et pourraient interférer avec les réactions de séquençage.

Ce protocole comprend à la fois une étape d'électrophorèse sur gel d'agarose classique et une étape d'électrophorèse sur gel en champ pulsé. La première est une évaluation initiale de la fraction d'ADN qui est> 20 kbp et la fraction qui fonctionne comme un frottis à <20 kpb. Aux fins des réactions de séquençage en aval nécessaire pour mil poudreusegénomes de rosée, la fraction de l' ADN <20 kbp devrait être minime (voir la figure 1, la piste 2 par rapport à la piste 4). L'analyse d'électrophorèse sur gel en champ pulsé fournit une meilleure estimation de la taille que l'ADN> 20 kbp peuvent être séparés selon leur taille. ADN de> 48,5 kpb est souhaitable pour une utilisation dans des réactions de séquençage suivantes (voir la figure 2, piste 4).

Le matériau fongique utilisé dans ces expériences a été propagée dans des chambres de croissance et de limiter la contamination en utilisant des protocoles d'isolement et des contrôles stricts du personnel. Pour cette raison, la contamination par d' autres, les agents pathogènes de moisissure non poudreux était minime, et le séquençage de la région ITS amplifiée en utilisant des amorces spécifiques aux champignons récupérés seulement G. séquences cichoracearum. Cela peut ne pas être le cas pour l'oïdium recueillies à partir de sites de terrain ou les serres ne possèdent pas les mêmes contrôles d'isolement, et l'évaluation de la contamination dans ces CASes seront critiques pour l'ensemble de génomes de haute qualité à partir de l'ADN extrait.

Pas une modification des différents protocoles d'isolement d'ADN fongique était unique importante. Au contraire de légères modifications à de nombreuses étapes ont donné lieu à des rendements relativement élevés de l'ADN de l'oïdium de haut poids moléculaire rapporté ici.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
La purification de l&#39;ADN de haut poids moléculaire Génomique de oïdium pour le séquençage de longue Lire
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter