Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Reinigung von High Molecular Weight genomischer DNA aus Echten Mehltaus für Long-Read-Sequenzierung

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

Die Echten Mehltaupilze sind eine Gruppe von wirtschaftlich bedeutenden pilzliche Pflanzenpathogene. Relativ wenig ist von gut entwickelten genetischen und genomischen Ressourcen auf einen Mangel auf Grund über die Molekularbiologie und Genetik dieser Erreger, teilweise bekannt. Diese Organismen haben große, sich wiederholende Genome, die gemacht haben Genom-Sequenzierung und Montage prohibitiv schwierig. Hier beschreiben wir Methoden zur Erfassung, Extraktion, Reinigung und Bewertung der Qualitätskontrolle von hochmolekularem genomischer DNA aus einem echten Mehltau - Arten, Golovinomyces cichoracearum. Das beschriebene Protokoll umfasst mechanische Störung durch eine optimierte Phenol / Chloroform-Extraktion genomische DNA gefolgt Sporen. Eine typische Ausbeute betrug 7 & mgr; g DNA pro 150 mg Konidien. Die genomische DNA , die dieses Verfahren isoliert wird , verwendet , ist geeignet für die Lang lesen Sequenzierung (dh> 48,5 kbp). Maßnahmen zur Qualitätskontrolle, die Größe, die Ausbeute und Reinheit der genomischen DNA, um sicherzustellen, sind auchin diesem Verfahren beschrieben. Die Sequenzierung der genomischen DNA der hier beschriebenen Qualität wird für die Montage und den Vergleich von mehreren Mehltau Genome, die wiederum erlauben zu einem besseren Verständnis führen wird und eine verbesserte Steuerung dieser landwirtschaftlichen Erreger.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Echte Mehltaupilze sind eine Gruppe von obligater biotrophen pilzliche Pflanzenpathogene , dass, wenn sie zusammengenommen, ist die größte Ursache für Pflanzenkrankheiten weltweit 1. Es gibt über 900 beschriebene Arten von Mehltau, der taxonomisch in fünf Stämme innerhalb der Familie Erisyphaceae 2 zusammengefasst wurde. Sowohl auf ihre wirtschaftlichen Bedeutung und die intimen Beziehung, die sie mit ihren Wirten zu entwickeln haben, Mehltau Krankheiten für> 100 Jahre sind der Gegenstand der Forschung. Bei Infektion, entlocken Echte Mehltau drastische Veränderungen in der Zellstruktur, den Stoffwechsel und Molekularbiologie ihrer Wirte, diese Erreger zu profitieren. Das Studium der Echten Mehltau ist jedoch besonders schwierig aufgrund ihres obligater Lebensstil, und das Wachstum des Pilzes in Reinkultur ist noch nicht 3 beschrieben wurde, 4, 5,"Xref"> 6, 7, 8. Zuverlässige, stabile genetische Transformation von Echten Mehltau hat auch noch nicht erreicht worden, obwohl transiente Transformation 9 bei einigen Arten berichtet, 10.

Die Sequenzierung und Montage von Echtem Mehltau Genome hat sich als schwierig erwiesen, aufgrund einer Reihe von Merkmalen des Genoms selbst. Mehltaus Genomen sind groß (120-180 MBP) relativ zu anderen Pilz-Genomen, und bestehen aus 60 bis 90% gleichmäßig verteilt repetitiven Elementen 11. Diese Elemente sind nicht-long terminal repeats, sowie uncategorized repetitive Elemente. Zwei formae speciales einer einzigen echten Mehltau - Arten, Blumeria graminis f. sp. hordei und f. sp. tritici (Bgh und Bgt, respectively) sowie die Traubenmehltau Erysiphe necator, haben Bienenn sequenziert und Entwurf Genomen für mehr andere wurde 12 abgeschlossen, 13, 14. Die sich wiederholenden Natur der Genome hat Montage erschwert und das fertige Bgh - Genom wurde in 6.989 supercontigs mit L50 von 2 Mb 12 montiert.

Trotz des großen Genoms scheint der Echte Mehltau eine kleine Anzahl von Protein - kodierenden Genen zu haben, mit 5.845 und 6.540 Genen vorhergesagt in Bgh und Bgt ist. Die sequenzierten echte Mehltaue scheinen auch mindestens 99 Kern Gene zu fehlen , die in anderen Pilzen wesentlich sind, die mit der Abhängigkeit der Pilze auf ihrer Wirtspflanze für das Überleben 11, 12, 13, 14 im Einklang steht.

Repetitive Sequenzen nahe Telomere, Centromere, ribosomale RNEin Gen - Arrays und Regionen in transponierbaren Elementen angereichert sind schlecht aus Kurz gelesen Sequenzierungsstrategien zusammengesetzt und sind oft unterrepräsentiert in Genomanordnungen 15. Solche Bereiche für viele der Lücken verantwortlich sein wird angenommen , dass in Genomsequenzen auftreten, und dies gilt auch für die echte Mehltaue mit ihren umfangreichen Erweiterung von repetitiven Elementen 16. Highly Kunststoff Genomregionen oft in einem solchen repetitiven Regionen 3 gefunden. Sie dienen als Gebiet von Chromosomenumlagerungen und oft codieren Gene unter starkem Selektionsdruck, wie beispielsweise die Gene, die für Proteine ​​Effektor und die Gene Enzyme des Sekundärstoffwechsels kodieren. Die Fortschritte in der Einzelmolekül - Lang lesen Sequenzierungstechnologien bieten eine mögliche Lösung für die Sequenzierung durch sich wiederholende Regionen von Genomen 15. Zum Beispiel Faino et al. (2015) fanden heraus, dass auch lange Sequenz gelesen Technologien und m optischenapping ließ sie für zwei Stämme der pilzliche Pflanzenpathogen Verticillium Dahlia eine lückenlose Genomsequenz erzeugen, den Anteil der sich wiederholenden DNA - Sequenzen in das Genom zu verdreifachen, die Anzahl der Gen Annotationen erhöht (und die Verringerung der Anzahl von Teil oder fehlende Gen Annotationen ) und aufschlussreich Genom - Rearrangements 17.

Um diese langfris las Sequenzierungstechnologien, hohe Konzentrationen von hohen Qualität genomischer DNA, mit minimalen Größen> 20 kbp zu verwenden, benötigt. Hier beschreiben wir unsere Methoden zur konidiale Sammlung, Reinigung von hochmolekularer DNA von Konidien und unsere Qualitätskontrolle Einschätzungen Mehltauart Golovinomyces cichoracearum auf Gurken angebaut mit 18. Dieses Protokoll basiert auf einem Protokoll im Labor Gruppe B. Keller entwickelt (Universität Zürich, Zürich Schweiz) 13, 19und umfasst mehrere Modifikationen, die zu einem erhöhten DNA-Ausbeuten und einen höheren Anteil an DNA> 48,5 kbp in Größe geführt. Das Protokoll enthält auch die Qualitätskontrolle Schritte basieren auf den Empfehlungen aus den Vereinigten Staaten Department of Energy Joint Genome Institute 20, 21, 22.

Die Funktion jedes Reagenz in dem Lysepuffer enthalten ist , und die Gründe für jeden Reinigungsschritt werden , wie in Henry (2008) 23 beschrieben. Verfügbare veröffentlichte Protokolle zur Isolierung von hochmolekulare genomische DNA aus pflanzlichen und mikrobiellen Geweben wurden auch bei der Gestaltung dieses Protokolls 24, 25, 26 angehört, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Herstellung von Pilzmaterial

  1. Wachsende Echten Mehltaus
    1. Wachsen Pflanzen in Wachstumskammern mit den folgenden Bedingungen: 22 ° C Tagestemperatur, 20 ° C Nachttemperatur, 80% relative Luftfeuchtigkeit, 14 h Tag-Länge und eine Lichtintensität von 125 & mgr; E / m 2 / s (bereitgestellt von Leuchtstofflampen ).
    2. Infect Gurkenpflanzen (Cucumis sativa Sorte Bush Meister) mit Golovinomyces cichoracearum Stamm UCSC1 wie beschrieben 18, 29.
  2. Ernte Echten Mehltaus Konidien
    1. Ernte Konidien von infizierten Pflanzen auf 7 bis 10 Tage nach der Inokulation ein kleines Vakuum mit einem in-line-Filter (11 & mgr; m), auf dem die Konidien akkumulieren. Leichten Druck, führen Sie die Vakuumdüse entlang der Oberfläche des Blattes der Konidien zu sammeln.
      HINWEIS: Die durchschnittliche Ausbeute von G. cichoracearum beträgt 20 mg von Konidien aus einem stark InFECTED Gurkenblatt von etwa 130 cm 2 Fläche.
    2. Bürste um 150 mg der Konidien (ungefähr 375 & mgr; l Volumen oder Konidien 7-8 infizierte Gurkenblätter) von dem Filter auf ein Blatt Papier sauber. Von hier aus übertragen Konidien in 2 ml-Kryoröhrchen mit zwei 5/32-Zoll-Durchmesser vorge gekühlt (in flüssigem Stickstoff) Stahl Mahlkugeln. Unmittelbar Rohre flüssigen Stickstoff zurück. Speicher Röhrchen bei -80 ° C.
  3. Brechen öffnen Konidien durch Kugelmahlen
    1. Flash Aluminiumplatten der Kugelmühle in flüssigem Stickstoff einzufrieren. Last Kryoröhrchen in Kugelmühlenständer. Kräftig schütteln die Kryoröhrchen mit Konidien und Stahlkugeln in der Kugelmühle für 30 s bei 30 Zyklen / s (bei Raumtemperatur). Unmittelbar Kryoröhrchen in flüssigem Stickstoff wieder einfrieren.
      HINWEIS: Am Anfang Zugriff auf eine Probe von Konidien durch Mikroskopie bei 100-facher Vergrößerung für die Effizienz der Zellwand Bruch während des Schleifens. Bei Bedarf mahlt für weitere 1 bis 2 Runden von 30 s für 30 Zyklen / s, but hält die Anzahl der Runden auf ein Minimum. Routine Beurteilung der konidiale Bruch durch Mikroskopie in diesem Stadium ist nicht erforderlich, wenn optimale Bedingungen festgelegt wurden.

2. Genomic DNA Purification

  1. Konidien Lysis
    1. schnell arbeitet Auftauen Konidien zu vermeiden, die Stahlkugeln aus Kryovials mit einem Magneten entfernen. Hinzufügen 700 & mgr; l 65 ° C Lysepuffer (Tabelle 1) und vortex von 5 bis 10 s , bis eine Aufschlämmung gebildet wird.
    2. Hinzufügen von 300 & mgr; l vorgewärmtes (65 ° C) 5% (v / v) Sarkosyl und sanft invertieren mischen (1 Invertierung pro 3 s) fünfmal. Die Röhrchen für 30 min bei 65 ° C; invertieren sanft 3-mal bei 10, 20 und 30 min. Unter Verwendung einer Breitbohrungspipettenspitze übertragen gesamte Lösung neues 2 ml-Mikrozentrifugenröhrchen. In allen nachfolgenden Schritten, Mischung durch schonendes, langsames Inversion und überträgt die DNA-haltige Lösungen mit weiter Bohrung Pipettenspitzen.
  2. DNA-Extraktion I
    1. 1 Volumen von ChlorForm: Isoamylalkohol (24: 1 v / v) zu der Lyselösung und sanft invertieren fünfmal zu mischen. Inkubieren für 10 min bei Raumtemperatur, auf halber Strecke fünfmal zu mischen und erneut am Ende der Inkubation vorsichtig invertieren. Zentrifuge bei Raumtemperatur für 15 min bei 14.000 x g. Breitbohrungspipettenspitze, überträgt sorgfältig die wässrige Schicht zu neuen 2 ml-Mikrozentrifugenröhrchen; einschließlich Material von der Oberfläche vermeiden.
  3. DNA-Niederschlag I
    1. 1 Volumenraumtemperatur 100% Isopropanol (etwa 750 ul) und Invertzucker sanft sechsmal zu mischen. Zentrifuge bei Raumtemperatur für 15 min bei 14.000 x g. Entfernen Sie vorsichtig den Überstand und entsorgen.
    2. Hinzufügen 450 ul vorgekühlten (-20 ° C) 70% Ethanol. Zentrifuge 5 min bei Raumtemperatur bei 14000 x g. Entfernen Sie vorsichtig den Überstand und entsorgen. Zentrifuge bei 1000 × g für 3 s, entfernen Sie vorsichtig den Überstand mit feiner Pipettenspitze und entsorgen. Luft-Trocknen des Pellets für 15 min eint Raumtemperatur. Trocknen Sie nicht länger als 15 min.
    3. Das Pellet in 300 ul TE (10 mM Tris-Cl, 1 mM Ethylendiamintetra-Essigsäure, pH 8,0). Inkubiere über Nacht bei 4 ° C. Flick vorsichtig jegliches Restmaterial zu suspendieren, die nicht in Lösung ging.
  4. Um RNA-Kontamination zu entfernen, mit 10 ul RNase A (10 mg / ml). vorsichtig umdrehen dreimal zu mischen. Zentrifuge bei 1000 × g für 3 s. Inkubieren bei 37 ° C für 2 h.
  5. II DNA Extraction
    1. In 300 ul Phenol: Chloroform: Isoamylalkohol (25: 24: 1 v / v) und vorsichtig invertieren fünfmal zu mischen. Inkubiere 10 Minuten bei Raumtemperatur sanft am Ende der Inkubation bei der Halbzeit fünf Mal zu mischen und wieder umgekehrt wird. Zentrifuge 15 min bei Raumtemperatur bei 14000 x g. Unter Verwendung einer Breitbohrungspipettenspitze, den Überstand in neue 1,5 ml-Mikrozentrifugenröhrchen.
  6. DNA-Präzipitation II
    1. 0.01 Volumen 3 M Natriumacetat pH 5,2 (approximately 3 & mgr; l), invertieren fünfmal sanft zu mischen. Hinzufügen 2,5 Volumen vorgekühlten (-20 ° C) 100% Ethanol (etwa 750 ul). vorsichtig umdrehen fünf Mal mischen. Inkubieren über Nacht bei -20 ° C
    2. Zentrifuge 30 min bei 4 ° C bei 14000 x g. Entfernen Sie vorsichtig den Überstand und entsorgen.
    3. Hinzufügen 450 ul vorgekühlten (-20 ° C) 70% Ethanol. Zentrifuge 5 min bei 4 ° C bei 14000 x g. Entfernen Sie vorsichtig den Überstand und entsorgen. Zentrifuge bei 1000 × g für 3 s. Entfernen Sie vorsichtig den Überstand mit feiner Pipettenspitze und entsorgen.
    4. Luft-Trocknen des Pellets für 30-60 min bei Raumtemperatur. Resuspendieren des Pellets in 27,5 & mgr; l TE. Inkubiere über Nacht bei 4 ° C. Flick vorsichtig jegliches Restmaterial zu suspendieren, die nicht in Lösung ging.
    5. 2,5 ul Aliquot in 22,5 & mgr; l TE (Endvolumen 25 ul) für Qualitätskontrolltests (siehe unten). Store-DNA-Proben bei 4 ° C bis zur Vorlage für die Sequenzierung. Für die langfristige Lagerung, Aufbewahrung von ProbenGefrier-Auftau-Zyklen bei -80 ° C und Scher minimieren zu verhindern.
      HINWEIS: Achten Sie bei bei diesem Schritt als hochmolekulare genomische DNA Pipettieren kann schwierig sein, richtig zu pipettieren, und es ist wichtig, um sicherzustellen, dass „QC Aliquot“ ist eine genaue Darstellung der genomischen DNA-Probe.

3. Qualitätskontrolle

  1. Probe Reinheit
    1. Verwendung eines TE blank, beurteilen die Probe Reinheit der DNA durch Laden von 1 & mgr; l Aliquot des QC auf einem kleinvolumigen Spektrophotometer. Nehmen Sie A260 / A280 und A260 / A230 Lesungen. Reine DNA wird ein A260 / A280-Verhältnis von etwa 1,8 und A260 / A230-Verhältnis zwischen 1,8 und 2,2 aufweist.
  2. Quantifizierung von genomischer DNA
    1. Führen Quantifizierung von QC Aliquot Kommerzielle doppelsträngige DNA Quantifizierungsassay-Kit nach den Anweisungen des Herstellers.
  3. DNA Quality Assessment I
    1. Last etwa 60 ng genomische DNA und eineDNA-Leiter auf einem 0,7% Agarosegel in 1X TAE (40 mM Tris, 20 mM Essigsäure und 1 mM EDTA, pH 8,0). Führen Gelvorrichtung bei 70 V für 40 bis 45 min bis genomische DNA-Banden sind ungefähr 2 cm von dem Bohrloch und Bandtrennung in dem Leiter ist offensichtlich. Diese Bedingungen müssen basierend auf den verfügbaren Gelelektrophorese Vorrichtung angepasst werden.
  4. DNA Quality Assessment II
    1. Last etwa 60 ng genomischer DNA und einen hochmolekulare DNA-Leiter (geeignet für Pulsfeld-Gel-Elektrophorese) auf einem 1% igen Agarosegel in 0,5 × TBE (44,5 mM Tris, 44,5 mM Borsäure, 1 mM EDTA, pH 8,3) und läuft in 0,5x TBE Laufpuffer unter Verwendung eines 5 - 80 kbp Wellenform Pulsfeld-Gel-Elektrophorese-Protokoll für 16 h.
  5. Beurteilung von Bakterien-, Pilz- und Pflanzen Kontaminanten
    1. Durchführen der Polymerase-Kettenreaktion (PCR) die entsprechenden internen transkribierten Abstandshalter (ITS) Regionen der ribosomalen Gene zu amplifizieren unter Verwendung der Primer und Amplifikationsbedingungen Listeed in Tabelle 2. Last 10 & mgr; l der erhaltenen Reaktions auf einem Gel.
      HINWEIS: Eine Bande, die den echten Mehltau ITS-Region sollte mit dem Pilz-ITS-Primer amplifiziert werden. DNA aus diesem Amplicon und jeden erzeugten Amplikons mit den bakteriellen, pflanzlichen oder Primer sollte den Ursprung der Verunreinigung zu bestimmen, sequenziert werden. Nur Mehltau ITS-Sequenzen sollten in der Pilz-Amplikon zu finden.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ein repräsentatives Beispiel für gereinigter genomischer DNA aus G. 60 ng cichoracearum auf einem Agarosegel unter Verwendung von Gelelektrophorese laufen und unter Verwendung von Pulsfeld - Gelelektrophorese sind in den 1 bzw. 2 gezeigt. Genomische DNA-Präparate, die verstreichen, geringfügig übergeben und die Qualitätskontrolle nicht vertreten sind. Genomische DNA-Präparate, die vollständig Qualitätskontrolle passieren sind ideal für die Sequenzierung unter Verwendung von Lang lesen Genomsequenzierung Ansätzen. Zubereitungen, die geringfügig Qualitätskontrolle passieren sind akzeptabel, aber Präparate, die bevorzugt sind vollständig passieren. Die Vorbereitungen, die Qualitätskontrolle versagen sind nicht akzeptabel für die Langlesegenomsequenzierung Ansätze.

Abbildung 1
Abbildung 1: Agarosegelelektrophorese gereinigter genomischer DNA. Spur 1: Spur 2: genomische DNA , die Qualitätskontrolle durchlaufen; Spur 3: genomische DNA , die in Betracht gezogen wurden marginal; und Bahn 4: genomische DNA , die fehlgeschlagen Qualitätskontrolle. Akzeptable und marginal genomischen DNA-Proben haben eine einzelne Bande bei <20 kbp oberhalb von 20 kbp mit minimalem Verschmieren läuft. Genomische DNA-Proben, die Qualitätskontrolle nicht haben unter 20 kbp Verschmieren und können niedermolekulare Fragmente mit etwa 100 bp (*) enthalten. Puls-Feld-Gel-Elektrophorese ist erforderlich zwischen akzeptablen und marginal DNA-Proben zu unterscheiden. Ethidiumbromid wurde zu dem Gel vor der Elektrophorese zugegeben, um die genomische DNA zu visualisieren. Die Proben wurden bei 60 V für 50 Minuten elektrophoretisch aufgetrennt. Das Gel wurde unter UV-Licht abgebildet, um ein Gel-Dokumentationssystem.

Figur 2
Zahl2: Pulsfeld-Gelelektrophorese (PFGE) gereinigtes Echten Mehltaus genomischer DNA. Spur 1: Molekulargewichtsstandards, mit dem höchsten Band bei 48,5 kbp und den niedrigsten Wert bei 8,1 kbp. Spuren 2 und 5: Molekulargewichtsstandards zeigen Banden von 20, 10, 7, 5, 4, 3, 2 und 1,5 kbp (am unteren Rande des Gels Bildes). Spur 3: eine marginale DNA - Probe, wobei die Mehrheit der DNA zwischen 20 und 48,5 kbp groß. Spur 4: eine akzeptable DNA - Probe, wobei die Mehrheit der DNA> 48,5 kbp (*). Die Proben wurden für 15 h bei 75 V laufen ein 5-80 kbp PFGE Wellenform-Programm. DNA-Anfärbung Farbstoff wurde nach der Elektrophorese auf das Gel gegeben, und das Gel wurde unter UV-Licht abgebildet, um ein Gel-Dokumentationssystem.

Reagens Endkonzentration
Kalium Metabisulfite (K 2 S 2 O 5) 0,25 M
Tris-Puffer pH 7,5 0,2 M
Ethylendiamintetraessigsäure (EDTA) 50 mM
Natriumchlorid (NaCl) 2 M
Cetyltrimethylammoniumbromid (CTAB) 2% v / v

Tabelle 1: Herstellung von Lysepuffer. Bringen auf ein Volumen von 5 ml mit dH 2 O.

Ziel Primer - Name Primer - Sequenz Tm (° C) Erwartete Produkt - Größe (bp)
Fungal ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61,3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52.1
Bakterielle 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63,8-66,5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46,9-53,8
Bakterielle 16S-V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60,8-66,5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43,9-53,8
Pilz-18S V4 FW CCAGCASCYGCGGTAATTCC 58,7-61,5 431
RV ACTTTCGTTCTTGATYRA 43,2-48,3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63,8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66,6

Tabelle 2: Primer für die Kontamination Beurteilung.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Um rein, hochmolekulare genomische DNA aus den obligaten biotrophe echten Mehltaupilzen zu erhalten, eine modifizierte Version des zuvor beschriebenen Verfahrens wurde 30 entwickelt. Die durchschnittliche Ausbeute dieses optimierten Protokoll 7 ug DNA pro 150 mg Konidien, eine Verdoppelung der Ausbeute bei einem früheren Protokoll erhalten. Auch erhöhte sich die durchschnittliche Größe von etwa 20 kbp auf über 48,5 kbp. Dieses Protokoll wurde in dem Gurken- G. cichoracearum System optimiert. Um die beste Qualität und höchste Reinheit DNA in anderen echten Mehltau oder obligaten biotrophen Pilze, zusätzliche Modifikation dieses Protokolls zu erhalten, kann erforderlich sein. In Zukunft kann dieses Protokoll verwendet werden, hochmolekulare DNA geeignet für lange ablesbare DNA-Sequenzierung von anderen obligaten biotrophe Pilzen zu erhalten, obwohl weitere Modifikation erforderlich sein kann.

Auswuchten hohe DNA-Ausbeute und mit hohem Molekulargewicht des extrahierten DNA wurde ein Anliegenbei der Optimierung dieses Protokolls. Schritte einschließlich Vortexen wurden zu minimieren, um Scherung der DNA eliminiert und wurden durch vorsichtiges Mischen durch Umdrehen ersetzt. Diese Änderung erhöht die Qualität der extrahierten DNA, ohne die Ausbeute deutlich zu reduzieren. Zusätzlich Entfernen der Stahlkugeln zu Beginn des Zelllyseschritt signifikant erhöhte Ausbeute DNA im Vergleich zu den Kugeln in der Lösung, bis zum Ende des Lyseschritt verlassen.

No G. cichoracearum Konidien blieb intakt , nachdem der Ball Fräsvorgang in Schritt 1.3. Um gute Ausbeuten an hochmolekulare genomische DNA zu erhalten, ist es entscheidend, dass die Pilzzellwand während dieser Stufe unterbrochen wird. Konidien Integrität kann mikroskopisch untersucht werden, und zusätzliche Kugelmahlen oder alternative Verfahren zur Störung kann für andere Pilzarten erforderlich.

Einige Pilz Konidien, insbesondere die Blumeria sp., Enthalten Pigmente, die cont könnenaminatboden DNA-Extraktion und Reinigung versucht. In diesen Fällen empfiehlt sich die DNA einschließlich Filtrationsschritt , wie in der Bourras et al beschrieben. (2015) Protokoll 19 und ein zusätzlicher Waschschritt mit TE nach dem Filtrationsschritt. Die Zugabe des Filtrationsschritt führte zu einer kleinen, aber signifikanten Anstieg der DNA-Abbau, und nur aufgenommen werden sollten, wenn eine übermäßige Pigmentierung bleibt nach dem zweiten DNA-Fällungsschritt. Diese Pigmente, wenn man sich in Lösung bleibt, können mit späterer Analyse der Qualität und Quantität der DNA stören und könnten möglicherweise mit Sequenzierungsreaktionen stören.

Dieses Protokoll beinhaltet sowohl einen herkömmlichen Agarosegelelektrophorese Schritt und einen Schritt Gelelektrophorese Pulsfeld. Die erste ist eine erste Beurteilung der Fraktion von DNA, die> 20 kbp, und die Fraktion, die als ein Abstrich läuft bei <20 kbp. Für die Zwecke der nachfolgenden Sequenzierungsreaktionen für pulvrige mil erforderlichdew Genomen, sollte der Anteil der DNA <20 kbp minimal sein (siehe Figur 1, Spur 2 gegenüber der Spur 4). Die Pulsfeld-Gelelektrophorese Beurteilung liefert eine bessere Schätzung der Größe als DNA> 20 kbp können nach Größe getrennt werden. DNA von> 48,5 kbp ist wünschenswert für die Verwendung in nachfolgenden Sequenzierungsreaktionen (siehe Figur 2, Spur 4).

Das Pilzmaterial in diesen Experimenten verwendet wurde, in Wachstumskammern vermehrt und Kontamination wurde unter Verwendung von strengen Isolationsprotokollen und Personalkontrollen beschränkt. Wegen dieses Kontamination mit anderen, nicht-Erreger des Echten Mehltaus war minimal, und die Sequenzierung der ITS - Region amplifiziert Fungi-spezifischen Primern unter Verwendung von nur zurückgewonnen G. cichoracearum Sequenzen. Dies kann nicht der Fall für Echten Mehltau von Feldstandorten oder Gewächshäusern fehlen die gleiche Isolation Kontrollen und Kontamination Beurteilung in dieser cas gesammelt werdenes wird für die Montage von hochwertigen Genome aus der extrahierten DNA kritisch sein.

Keine Änderung der verschiedenen Pilz-DNA-Isolierungsprotokolle war eindeutig wichtig. Eher leichte Modifikationen an vielen Schritten in Folge der relativ hohen Ausbeuten von hochmolekularem Mehltau DNA hier berichtet.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
Reinigung von High Molecular Weight genomischer DNA aus Echten Mehltaus für Long-Read-Sequenzierung
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter