Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

लंबे समय से पढ़ें अनुक्रमण के लिए ख़स्ता फफूंदी से उच्च आण्विक वजन जीनोमिक डीएनए की शुद्धि

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

पाउडर फफूंदी कवक आर्थिक रूप से महत्वपूर्ण कवक संयंत्र रोगजनकों के एक समूह है। अपेक्षाकृत कम अच्छी तरह से विकसित आनुवंशिक और जीनोमिक संसाधनों की कमी के कारण आण्विक जीव विज्ञान और इन रोगाणुओं की आनुवंशिकी, भाग में के बारे में जाना जाता है। ये जीव बड़े, दोहराए जीनोम, जो जीनोम अनुक्रमण और विधानसभा निषेधात्मक मुश्किल बना दिया है। यहाँ, हम संग्रह, निकासी, शुद्धि और गुणवत्ता नियंत्रण एक पाउडर फफूंदी प्रजातियों, Golovinomyces cichoracearum से उच्च आणविक भार जीनोमिक डीएनए के आकलन के लिए तरीकों की व्याख्या। प्रोटोकॉल में वर्णित एक अनुकूलित फिनोल / क्लोरोफॉर्म जीनोमिक डीएनए निष्कर्षण के बाद बीजाणुओं के यांत्रिक विघटन भी शामिल है। एक ठेठ उपज प्रति 150 मिलीग्राम conidia 7 माइक्रोग्राम डीएनए था। जीनोमिक डीएनए है कि इस प्रक्रिया का उपयोग कर अलग लंबे समय से पढ़ अनुक्रमण (यानी,> 48.5 KBP) के लिए उपयुक्त है। गुणवत्ता नियंत्रण के उपायों आकार, उपज, और जीनोमिक डीएनए की शुद्धता सुनिश्चित करने के लिए भी कर रहे हैंइस विधि में वर्णित है। गुणवत्ता यहाँ वर्णित के जीनोमिक डीएनए के अनुक्रमण विधानसभा और कई पाउडर फफूंदी जीनोम, जो बारी में एक बेहतर समझ के लिए नेतृत्व करेंगे की तुलना के लिए अनुमति देते हैं और इस कृषि रोगज़नक़ के नियंत्रण में सुधार होगा।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

चुरमुरा mildews लाचार biotrophic कवक संयंत्र के एक समूह रोगज़नक़ों कि, जब एक साथ लिया, संयंत्र रोग दुनिया भर में 1 के सबसे बड़े कारण हैं। वहाँ पाउडर फफूंदी के 900 से अधिक वर्णित प्रजातियों, जो taxonomically परिवार Erisyphaceae 2 के भीतर पांच जनजातियों के रूप में वर्गीकृत किया गया है। उनकी आर्थिक महत्व और अंतरंग संबंध वे उनके मेजबानों के साथ विकसित करने के लिए दोनों कारण, पाउडर फफूंदी रोगों> 100 साल के लिए शोध का विषय रहा है। संक्रमण होने पर, चुरमुरा mildews कोशिकीय संरचना, चयापचय और उनके भोजनदायी की आणविक जीव विज्ञान में भारी बदलाव को प्रकाश में लाना, यह रोगजनक लाभ के लिए। हालांकि, चुरमुरा mildews के अध्ययन के कारण लाचार जीवन शैली, और शुद्ध संस्कृति में कवक के विकास अभी तक नहीं 3 वर्णित किया गया है, 4, 5 विशेष रूप से चुनौतीपूर्ण है,"xref"> 6, 7, 8। विश्वसनीय, चुरमुरा mildews के स्थिर आनुवंशिक परिवर्तन भी अभी तक नहीं पूरा किया गया है, हालांकि क्षणिक परिवर्तन कुछ प्रजातियों 9, 10 में सूचित किया गया।

अनुक्रमण और पाउडर फफूंदी जीनोम की विधानसभा जीनोम ही की सुविधाओं की एक संख्या की वजह से कठिन साबित हुआ है। (- 180 MBP 120) अन्य कवक जीनोम के सापेक्ष, और 60 से मिलकर बनता है - पाउडर फफूंदी जीनोम बड़े हैं 90% समान रूप से वितरित दोहराए तत्वों 11। इन तत्वों को गैर लंबे टर्मिनल दोहराता है, साथ ही अवर्गीकृत दोहराव तत्व शामिल हैं। एक भी पाउडर फफूंदी प्रजातियों, Blumeria graminis च के दो formae speciales। सपा। hordei और च। सपा। tritici (BGH और BGT, क्रमशः) के साथ-साथ अंगूर पाउडर फफूंदी Erysiphe necator, मधुमक्खी हैn अनुक्रम, और कई अन्य के लिए मसौदा जीनोम 12, 13, 14 पूरी हो चुकी हैं। जीनोम का दोहराव प्रकृति विधानसभा मुश्किल बना दिया है, और पूरा BGH जीनोम 2 के L50 Mb 12 के साथ 6989 supercontigs में एकत्रित हो गया था।

बड़े जीनोम के बावजूद, चुरमुरा mildews 5845 और 6540 जीन क्रमश: BGH और BGT में भविष्यवाणी के साथ, प्रोटीन कोडिंग जीन की एक छोटी संख्या दिखाई देते हैं। अनुक्रम चुरमुरा mildews भी कम से कम 99 कोर जीन है कि अन्य कवक, जो अस्तित्व 11, 12, 13, 14 के लिए अपने मेजबान संयंत्र पर कवक की निर्भरता के साथ संगत है में आवश्यक हैं की कमी दिखाई देते हैं।

telomers, सेंट्रोमीयरों, राइबोसोमल आर.एन. पास दोहराव दृश्योंएक जीन सरणियों और transposable तत्वों में समृद्ध क्षेत्रों खराब कम पढ़ा अनुक्रमण रणनीतियों से इकट्ठा किया और कम प्रतिनिधित्व जीनोम विधानसभाओं 15 में अक्सर होते हैं। इस तरह के क्षेत्रों अंतराल कि जीनोम अनुक्रम में होते हैं के कई के लिए जिम्मेदार माना जाता है, और इस दोहराव तत्वों 16 के अपने विस्तृत विस्तार के साथ पाउडर mildews पर लागू होता है। अत्यधिक प्लास्टिक जीनोम क्षेत्रों अक्सर इस तरह के दोहराव क्षेत्रों 3 में पाए जाते हैं। वे गुणसूत्र rearrangements की एक साइट के रूप में सेवा और अक्सर इस तरह के जीन प्रेरक प्रोटीन एन्कोडिंग और जीन माध्यमिक चयापचय के एंजाइम एन्कोडिंग के रूप में मजबूत चयनात्मक दबाव में जीन, सांकेतिक शब्दों में बदलना। एकल अणु लंबे समय से पढ़ अनुक्रमण प्रौद्योगिकियों के क्षेत्र में अग्रिम जीनोम 15 का दोहराव क्षेत्रों में अनुक्रमण के लिए एक संभावित समाधान प्रदान करते हैं। उदाहरण के लिए, Faino एट अल। (2015) में पाया गया कि सहित लंबी अनुक्रम प्रौद्योगिकियों और ऑप्टिकल मीटर पढ़ाapping उन्हें कवक संयंत्र रोगज़नक़ Verticillium डाहलिया के दो उपभेदों के लिए एक अंतर-कम जीनोम अनुक्रम का उत्पादन करने की अनुमति दी, जीनोम में दोहराव डीएनए अनुक्रम का अनुपात तीन गुना, जीन एनोटेशन की संख्या में वृद्धि (और आंशिक की संख्या कम करने या जीन एनोटेशन लापता ) और खुलासा जीनोम 17 rearrangements।

कम से कम आकार> 20 KBP के साथ इन लंबे समय से पढ़ अनुक्रमण प्रौद्योगिकी, उच्च गुणवत्ता जीनोमिक डीएनए के उच्च सांद्रता, रोजगार के लिए, की जरूरत है। यहाँ हम conidia से conidial संग्रह, उच्च आणविक भार डीएनए की शुद्धि के लिए हमारे तरीकों की व्याख्या और हमारे गुणवत्ता नियंत्रण पाउडर फफूंदी प्रजातियों Golovinomyces cichoracearum का उपयोग कर आकलन ककड़ी 18 पर उगाया जाता है। यह प्रोटोकॉल B केलर प्रयोगशाला समूह (ज़्यूरिख़ विश्वविद्यालय, ज़्यूरिख़ स्विट्जरलैंड) 13, 19 में विकसित एक प्रोटोकॉल पर आधारित हैऔर कई संशोधनों है कि वृद्धि की डीएनए पैदावार के लिए नेतृत्व किया है और आकार में डीएनए> 48.5 KBP के एक उच्च अनुपात भी शामिल है। प्रोटोकॉल भी गुणवत्ता नियंत्रण ऊर्जा संयुक्त जीनोम संयुक्त राज्य अमेरिका विभाग संस्थान 20, 21, 22 से सिफारिशों के आधार पर चरण शामिल हैं।

प्रत्येक अभिकर्मक lysis बफर में शामिल हैं, और प्रत्येक शुद्धि कदम के लिए तर्क के समारोह, के रूप में हेनरी (2008) 23 में वर्णित हैं। संयंत्र और माइक्रोबियल ऊतकों से उच्च आणविक भार जीनोमिक डीएनए के अलगाव के लिए उपलब्ध प्रकाशित प्रोटोकॉल को भी इस प्रोटोकॉल 24, 25, 26, 27, 28 के डिजाइन दौरान परामर्श किया गया।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. फफूंद सामग्री की तैयारी

  1. बढ़ते ख़स्ता फफूंदी
    1. निम्नलिखित शर्तों के साथ विकास कक्षों में पौधों को विकसित: 22 डिग्री सेल्सियस दिन के तापमान, 20 डिग्री सेल्सियस रात के तापमान, 80% सापेक्ष आर्द्रता, 14-घंटे दिन-लंबाई और 125 μE / मी 2 / s एक प्रकाश की तीव्रता (फ्लोरोसेंट प्रकाश द्वारा प्रदान की )।
    2. के रूप में वर्णित 18, 29 Golovinomyces cichoracearum तनाव UCSC1 साथ ककड़ी पौधों (मुझे एक ई sativa किस्म बुश चैंपियन) संक्रमित।
  2. फसल काटने वाले ख़स्ता फफूंदी Conidia
    1. 7 में संक्रमित पौधों से फसल conidia - टीका के बाद 10 दिनों एक इन-लाइन फिल्टर (11 सुक्ष्ममापी) जिस पर conidia जमा के साथ एक छोटे निर्वात का उपयोग कर। कोमल दबाव लागू करने, conidia इकट्ठा करने के लिए पत्ती की सतह के साथ निर्वात नोक चलाते हैं।
      नोट: जी cichoracearum की औसत उपज एक भारी infe से conidia की 20 मिलीग्राम हैक्षेत्र में 2 लगभग 130 सेमी की cted ककड़ी पत्ती।
    2. conidia (लगभग 375 μL मात्रा, या 7-8 संक्रमित ककड़ी पत्तियों से conidia) फिल्टर से के बारे में 150 मिलीग्राम ब्रश साफ कागज के एक पत्रक पर। यहाँ से, दो 5/32-इंच व्यास पूर्व ठंडा (तरल नाइट्रोजन में) इस्पात मिलिंग गेंदों के साथ 2 एमएल cryovials में conidia हस्तांतरण। इसके तत्काल बाद तरल नाइट्रोजन के लिए ट्यूबों लौट आते हैं। -80 डिग्री सेल्सियस पर स्टोर ट्यूबों।
  3. ब्रेकिंग ओपन Conidia गेंद मिलिंग द्वारा
    1. फ़्लैश तरल नाइट्रोजन में गेंद मिल के एल्यूमीनियम प्लेट फ्रीज। लोड गेंद चक्की रैक में cryovials। सख्ती से कम 30 चक्र / (कमरे के तापमान पर) 30 s के लिए गेंद मिल में conidia और इस्पात गेंदों के साथ cryovials हिला। इसके तत्काल बाद तरल नाइट्रोजन में cryovials refreeze।
      नोट: प्रारंभ में, conidia का एक नमूना माइक्रोस्कोपी द्वारा 100X आवर्धन पर सेल की दीवार टूटना की दक्षता के लिए पीस दौरान एक्सेस करते हैं। के लिए 30 चक्र / एस, बी 2 30 के दौर - यदि आवश्यक हो, एक अतिरिक्त 1 के लिए पीसनेकेन्द्र शासित प्रदेशों के लिए एक न्यूनतम करने के लिए राउंड की संख्या रखने के लिए। इस स्तर पर माइक्रोस्कोपी द्वारा conidial टूटना का नियमित मूल्यांकन अनावश्यक एक बार इष्टतम स्थितियों स्थापित किया गया है है।

2. जीनोमिक डीएनए शुद्धीकरण

  1. conidia Lysis
    1. जल्दी से कार्य करना विगलन conidia से बचने के लिए, एक चुंबक के साथ cryovials से इस्पात गेंदों को हटा दें। 10 एस जब तक एक घोल बनाई है - 700 μL 65 डिग्री सेल्सियस lysis बफर (तालिका 1) और भंवर 5 जोड़ें।
    2. 300 μL पूर्व गर्म (65 डिग्री सेल्सियस) 5% (v / v) sarcosyl जोड़ें और धीरे मिश्रण करने को उलटने के (प्रति 3 रों 1 उलट) पांच बार। 65 डिग्री सेल्सियस पर 30 मिनट के लिए ट्यूब सेते हैं; 10, 20 और 30 मिनट में धीरे को उलटने के लिए 3 बार। एक विस्तृत बोर विंदुक टिप का उपयोग करना, नई 2 एमएल microcentrifuge ट्यूब पूरे समाधान के लिए स्थानांतरण। बाद के सभी चरणों में, कोमल, धीमी गति से उलट द्वारा मिश्रण और विस्तृत बोर विंदुक युक्तियों के साथ डीएनए युक्त समाधान के लिए स्थानांतरण।
  2. डीएनए निष्कर्षण मैं
    1. क्लोरो का 1 मात्रा जोड़ेंप्रपत्र: isoamyl शराब (24: 1 वी / वी) lysis समाधान के लिए और धीरे से पांच बार मिश्रण करने को उलटने के। कमरे के तापमान पर 10 मिनट के लिए सेते हैं, धीरे ऊष्मायन के अंत में आधे रास्ते बिंदु पर पांच बार मिश्रण और फिर करने के लिए inverting। पर 14,000 एक्स जी 15 मिनट के लिए कमरे के तापमान पर अपकेंद्रित्र। विस्तृत बोर विंदुक टिप का उपयोग करना, ध्यान से नई 2 एमएल microcentrifuge ट्यूब जलीय परत हस्तांतरण; इंटरफ़ेस से सामग्री शामिल करने से बचें।
  3. डीएनए से वर्षा मैं
    1. 1 मात्रा कमरे के तापमान 100% isopropanol (लगभग 750 μL) जोड़ें और धीरे से छह बार मिश्रण करने को उलटने के। पर 14,000 एक्स जी 15 मिनट के लिए कमरे के तापमान पर अपकेंद्रित्र। ध्यान से सतह पर तैरनेवाला हटाने और त्यागें।
    2. 450 μL पूर्व ठंडा (-20 डिग्री सेल्सियस) 70% इथेनॉल जोड़ें। पर 14,000 एक्स जी कमरे के तापमान पर 5 मिनट के लिए अपकेंद्रित्र। ध्यान से सतह पर तैरनेवाला हटाने और त्यागें। 3 रों के लिए 1000 XG पर अपकेंद्रित्र, ध्यान से ठीक विंदुक टिप के साथ सतह पर तैरनेवाला हटाने और त्यागें। के लिए 15 मिनट के एक गोली एयर सूखेटी कमरे के तापमान। लंबे समय तक की तुलना में 15 मिनट के लिए सूखी है।
    3. 300 μL TE में गोली (10 मिमी Tris-क्लोरीन, 1 मिमी इथाइलीन diamine टेट्रा-एसिटिक एसिड, पीएच 8.0) Resuspend। 4 डिग्री सेल्सियस पर रातोंरात सेते हैं। धीरे किसी भी अवशिष्ट सामग्री है कि समाधान में जाना नहीं था फिर से निलंबित करने के लिए झटका।
  4. शाही सेना संदूषण को निकालने के लिए 10 μL RNase ए (10 मिलीग्राम / एमएल) जोड़ें। धीरे तीन बार मिश्रण करने को उलटने के। 3 रों के लिए 1000 XG पर अपकेंद्रित्र। 2 घंटे के लिए 37 डिग्री सेल्सियस पर सेते हैं।
  5. डीएनए निष्कर्षण द्वितीय
    1. 300 μL जोड़ें फिनोल: क्लोरोफॉर्म: isoamyl शराब (25: 24: 1 वी / वी) और धीरे पांच बार मिश्रण करने को उलटने के। कमरे के तापमान पर 10 मिनट सेते हैं, धीरे ऊष्मायन के अंत में आधे रास्ते के निशान पर पांच बार मिश्रण और फिर करने के लिए inverting। पर 14,000 एक्स जी कमरे के तापमान पर अपकेंद्रित्र 15 मिनट। एक विस्तृत बोर विंदुक टिप का उपयोग करना, नया 1.5 एमएल microcentrifuge ट्यूब स्थानांतरण सतह पर तैरनेवाला।
  6. डीएनए से वर्षा द्वितीय
    1. जोड़े 0.01 मात्रा 3 एम सोडियम एसीटेट पीएच 5.2 (approximately 3 μL), धीरे पांच बार मिश्रण करने को उलटने के। 2.5 संस्करणों पूर्व ठंडा (-20 डिग्री सेल्सियस) 100% इथेनॉल (लगभग 750 μL) जोड़ें। धीरे पांच बार मिश्रण करने को उलटने के। -20 डिग्री सेल्सियस पर रातोंरात सेते
    2. अपकेंद्रित्र में 14,000 एक्स जी 4 डिग्री सेल्सियस पर 30 मिनट। ध्यान से सतह पर तैरनेवाला हटाने और त्यागें।
    3. 450 μL पूर्व ठंडा (-20 डिग्री सेल्सियस) 70% इथेनॉल जोड़ें। पर 14,000 एक्स जी 4 डिग्री सेल्सियस पर 5 मिनट के लिए अपकेंद्रित्र। ध्यान से सतह पर तैरनेवाला हटाने और त्यागें। 3 रों के लिए 1000 XG पर अपकेंद्रित्र। ध्यान से ठीक विंदुक टिप और छोड़ें साथ सतह पर तैरनेवाला हटाने।
    4. कमरे के तापमान पर 30-60 मिनट के लिए गोली एयर सूखी। 27.5 μL TE में गोली Resuspend। 4 डिग्री सेल्सियस पर रातोंरात सेते हैं। धीरे किसी भी अवशिष्ट सामग्री है कि समाधान में जाना नहीं था फिर से निलंबित करने के लिए झटका।
    5. विभाज्य गुणवत्ता नियंत्रण परीक्षणों के लिए 22.5 μL TE (अंतिम मात्रा 25 μL) में 2.5 μL (नीचे देखें)। 4 डिग्री सेल्सियस अनुक्रमण के लिए प्रस्तुत करने तक पर स्टोर डीएनए नमूनों। लंबी अवधि के भंडारण, स्टोर नमूने लिए-80 डिग्री सेल्सियस पर और बाल काटना को रोकने के लिए फ्रीज पिघलना चक्र को कम।
      नोट: जब उच्च आणविक भार जीनोमिक डीएनए के रूप में इस कदम पर pipetting ठीक से पिपेट मुश्किल हो सकता है ध्यान रखना है, और यह सुनिश्चित करना है कि "क्यूसी विभाज्य" जीनोमिक डीएनए नमूना का सही प्रतिनिधित्व है महत्वपूर्ण है।

3. गुणवत्ता नियंत्रण

  1. नमूना पवित्रता
    1. एक TE खाली का उपयोग करना, एक छोटी सी मात्रा स्पेक्ट्रोफोटोमीटर पर क्यूसी विभाज्य का 1 μL लोड करके डीएनए के नमूने शुद्धता का आकलन। रिकार्ड A260 / A280 और A260 / A230 रीडिंग। शुद्ध डीएनए 1.8 और 2.2 के बीच लगभग 1.8 और A260 / A230 अनुपात का एक A260 / A280 अनुपात होगा।
  2. जीनोमिक डीएनए के मात्रा
    1. निर्माता के निर्देशों के अनुसार एक वाणिज्यिक दोहरे धागे डीएनए मात्रा परख किट का उपयोग QC विभाज्य की मात्रा को पूरा करें।
  3. डीएनए क्वालिटी असेसमेंट मैं
    1. लोड लगभग 60 एनजी जीनोमिक डीएनए और एक1x TAE (40 मिमी Tris, 20 मिमी एसिटिक एसिड, और 1 मिमी EDTA, पीएच 8.0) में एक 0.7% agarose जेल पर डीएनए सीढ़ी। 70 वी के लिए 40 पर चलाएँ जेल तंत्र - जीनोमिक डीएनए बैंड जब तक 45 मिनट के लगभग सीढ़ी में अच्छी तरह से और बैंड जुदाई से 2 सेमी हैं स्पष्ट है। इन शर्तों उपलब्ध जेल वैद्युतकणसंचलन तंत्र के आधार पर समायोजित करने की आवश्यकता हो सकती है।
  4. डीएनए क्वालिटी असेसमेंट द्वितीय
    1. लोड लगभग 60 0.5x TBE (44.5 मिमी Tris, 44.5 मिमी बोरिक एसिड, 1 मिमी EDTA, पीएच 8.3) और में एक 1% agarose जेल पर जीनोमिक डीएनए और एक उच्च आणविक भार डीएनए सीढ़ी (स्पंदित फील्ड जेल वैद्युतकणसंचलन के लिए उपयुक्त) एनजी 16 घंटे के लिए 80 KBP तरंग स्पंदित फील्ड जेल वैद्युतकणसंचलन प्रोटोकॉल - एक 5 का उपयोग कर 0.5x TBE चल बफर में चलाते हैं।
  5. बैक्टीरियल, फफूंद, और संयंत्र प्रदूषक के आकलन
    1. पोलीमरेज़ चेन प्रतिक्रिया (पीसीआर) प्रदर्शन करना उचित आंतरिक लिखित स्पेसर (आईटीएस) प्राइमरों और प्रवर्धन की स्थिति सूची का उपयोग कर राइबोसोमल जीनों के क्षेत्रों बढ़ाना2 तालिका में एड। लोड 10 एक जेल पर परिणामी प्रतिक्रिया की μL।
      नोट: पाउडर फफूंदी अपने क्षेत्र फंगल इसके प्राइमरों के साथ प्रवर्धित किया जाना चाहिए का प्रतिनिधित्व एक बैंड। इस amplicon और बैक्टीरियल, या पौधे प्राइमरों के साथ उत्पन्न किसी भी amplicon से डीएनए संदूषण का मूल निर्धारित करने के लिए अनुक्रम किया जाना चाहिए। केवल पाउडर फफूंदी इसके दृश्यों फंगल amplicon में पाया जाना चाहिए।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

जी से शुद्ध जीनोमिक डीएनए 60ng का एक प्रतिनिधि उदाहरण जेल वैद्युतकणसंचलन का उपयोग कर एक agarose जेल पर चलाने cichoracearum और स्पंदित फील्ड जेल वैद्युतकणसंचलन का उपयोग कर आंकड़े 1 और 2, क्रमशः में दिखाए जाते हैं। जीनोमिक डीएनए की तैयारी है कि पास, मामूली पारित और गुणवत्ता नियंत्रण असफल प्रतिनिधित्व कर रहे हैं। जीनोमिक डीएनए की तैयारी कि पूरी तरह से गुणवत्ता नियंत्रण पारित लंबे समय से पढ़ जीनोम अनुक्रमण तरीकों का उपयोग अनुक्रमण के लिए आदर्श हैं। तैयारी है कि मामूली गुणवत्ता नियंत्रण पारित स्वीकार्य हैं, लेकिन तैयारी कि पूरी तरह से पारित प्राथमिकता दी जाती है। तैयारी है कि गुणवत्ता नियंत्रण असफल लंबे-पढ़ने के लिए जीनोम अनुक्रमण तरीकों के लिए स्वीकार्य नहीं हैं।

आकृति 1
चित्र 1: शुद्ध जीनोमिक डीएनए के agarose जेल वैद्युतकणसंचलन। लेन 1: लेन 2: जीनोमिक डीएनए कि गुणवत्ता नियंत्रण पारित; लेन 3: जीनोमिक डीएनए कि सीमांत माना जाता था; और लेन 4: जीनोमिक डीएनए गुणवत्ता नियंत्रण में विफल रहा है कि। स्वीकार्य और सीमांत जीनोमिक डीएनए नमूने एक एकल बैंड <20 KBP पर कम से कम smearing के साथ 20 KBP ऊपर चल रहा है। जीनोमिक डीएनए के नमूने है कि गुणवत्ता नियंत्रण असफल 20 KBP नीचे को धब्बे है, और निम्न आणविक भार टुकड़े लगभग 100 बीपी (*) शामिल हो सकते हैं। स्पंदित फील्ड जेल वैद्युतकणसंचलन स्वीकार्य और सीमांत डीएनए नमूनों के बीच अंतर करने की आवश्यकता है। Ethidium ब्रोमाइड वैद्युतकणसंचलन से पहले जेल में जोड़ा गया था जीनोमिक डीएनए कल्पना करने के लिए। नमूने 50 मिनट के लिए 60 वी में electrophoresed रहे थे। जेल एक जेल प्रलेखन प्रणाली का उपयोग यूवी के प्रकाश में उतारी थी।

चित्र 2
आकृति2: स्पंदित क्षेत्र जेल वैद्युतकणसंचलन शुद्ध ख़स्ता फफूंदी जीनोमिक डीएनए के (PFGE)। लेन 1: आणविक भार मानकों, 48.5 KBP पर उच्चतम बैंड और 8.1 KBP में सबसे कम है। लेन 2 और 5: आणविक भार (जेल छवि के निचले भाग में) 20, 10, 7, 5, 4, 3, 2 और 1.5 KBP के बैंड दिखा मानकों। लेन 3: एक सीमांत डीएनए नमूना, आकार में 20 और 48.5 KBP के बीच डीएनए के बहुमत के साथ। लेन 4: एक स्वीकार्य डीएनए नमूना, डीएनए> 48.5 KBP (*) के बहुमत के साथ। नमूने एक 5-80 KBP PFGE तरंग कार्यक्रम का उपयोग कर 15 घंटे के लिए 75 वी में चला गया था। डीएनए धुंधला डाई वैद्युतकणसंचलन के बाद जेल में जोड़ा गया था और जेल एक जेल प्रलेखन प्रणाली का उपयोग यूवी के प्रकाश में उतारी थी।

अभिकर्मक अंतिम एकाग्रता
पोटेशियम Metabisulfite (K 2 एस 2 हे 5) 0.25 एम
Tris बफर पीएच 7.5 0.2 एम
Ethylenediaminetetraacetic एसिड (EDTA) 50 मिमी
सोडियम क्लोराइड (NaCl) 2 एम
Cetyltrimethyl अमोनियम ब्रोमाइड (CTAB) 2% v / v

तालिका 1: Lysis बफर तैयार करना। DH 2 ओ के साथ 5 एमएल की मात्रा को ले आओ

लक्ष्य प्राइमर का नाम प्राइमर अनुक्रम Tm (डिग्री सेल्सियस) अपेक्षित उत्पाद का आकार (बीपी)
फफूंद ITS2 परिवार कल्याण (ITS9) GAACGCAGCRAAIIGYGA 56-61.3 336
आर वी (ITS4) TCCTCCGCTTATTGATATGC 52.1
बैक्टीरियल 16S V4 परिवार कल्याण (515F) GTGCCAGCMGCCGCGGTAA 63.8-66.5 331
आर वी (805R) GGACTACHVGGGTWTCTAAT 46.9-53.8
बैक्टीरियल 16S V4-वी 5 परिवार कल्याण (515F-Y) GTGYCAGCMGCCGCGGTAA 60.8-66.5 450
आर वी (926R) CCGYCAATTYMTTTRAGTTT 43.9-53.8
फफूंद 18S V4 परिवार कल्याण CCAGCASCYGCGGTAATTCC 58.7-61.5 431
आर.वी. ACTTTCGTTCTTGATYRA 43.2-48.3
मुझे एक ई सैटाईवस सार्वजनिक वितरण प्रणाली (LOC101204524) CsPDS एफ GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63.8 750
CsPDS आर GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66.6

तालिका 2: संदूषण मूल्यांकन के लिए प्राइमर।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

आदेश लाचार biotrophic पाउडर फफूंदी कवक से शुद्ध, उच्च आणविक भार जीनोमिक डीएनए प्राप्त करने के लिए, पहले से वर्णित विधियों का एक संशोधित संस्करण 30 विकसित किया गया था। इस अनुकूलित प्रोटोकॉल का उपयोग औसत उपज प्रति 150 मिलीग्राम conidia 7 माइक्रोग्राम डीएनए, उपज एक पूर्व प्रोटोकॉल के साथ प्राप्त का दोहरीकरण है। इसके अलावा, औसत आकार 48.5 KBP से अधिक करने के लिए लगभग 20 KBP से वृद्धि हुई है। यह प्रोटोकॉल cucumber- जी cichoracearum प्रणाली में अनुकूलित किया गया था। आदेश अच्छी गुणवत्ता और अन्य पाउडर फफूंदी में सबसे अधिक शुद्धता डीएनए प्राप्त या biotrophic कवक लाचार, इस प्रोटोकॉल के अतिरिक्त संशोधन की आवश्यकता हो सकती है। भविष्य में, इस प्रोटोकॉल, अन्य लाचार biotrophic कवक से लंबे समय से पढ़ा डीएनए अनुक्रमण के लिए उच्च आणविक भार डीएनए उपयुक्त प्राप्त करने के लिए इस्तेमाल किया जा सकता है, हालांकि आगे संशोधन की आवश्यकता हो सकती है।

संतुलन उच्च डीएनए उपज और निकाले डीएनए के उच्च आणविक भार वाले था एक चिंता का विषयइस प्रोटोकॉल के अनुकूलन के दौरान। vortexing सहित कदम आदेश डीएनए के बाल काटना कम करने के लिए बाहर हो गया, और धीरे से उलट द्वारा मिश्रण से प्रतिस्थापित किया गया। यह परिवर्तन काफी उपज कम करने के बिना निकाले डीएनए की गुणवत्ता में वृद्धि हुई। साथ ही, शुरुआत में इस्पात गेंदों को हटाने सेल कदम काफी डीएनए उपज में वृद्धि हुई है जब lysis कदम के अंत तक समाधान में गेंदों को छोड़ने की तुलना में।

कोई जी cichoracearum conidia कदम 1.3 में गेंद मिलिंग प्रक्रिया के बाद अक्षुण्ण बनी रही। उच्च आणविक भार जीनोमिक डीएनए के अच्छे पैदावार प्राप्त करने के लिए यह महत्वपूर्ण है कि कवक सेल दीवार इस चरण के दौरान बाधित कर रहा है। Conidial अखंडता माइक्रोस्कोप से मूल्यांकन किया जा सकता है, और अतिरिक्त गेंद मिलिंग या विघटन के वैकल्पिक तरीकों अन्य कवक प्रजातियों के लिए आवश्यक हो सकता है।

कुछ कवक conidia, विशेष रूप से Blumeria sp।, पिगमेंट कि cont सकते हैंaminate डीएनए निष्कर्षण और शुद्धि के प्रयास। इन मामलों में, हम डीएनए निस्पंदन कदम Bourras एट अल में बताया गया है सहित सलाह देते हैं। (2015) प्रोटोकॉल 19 और निस्पंदन कदम के बाद TE के साथ एक अतिरिक्त धोने कदम। निस्पंदन कदम के अलावा डीएनए गिरावट में एक छोटा लेकिन महत्वपूर्ण वृद्धि हुई है, और अगर जरूरत से ज्यादा रंजकता दूसरा डीएनए वर्षा कदम के बाद बनी हुई है केवल शामिल किया जाना चाहिए। इन पिगमेंट, अगर समाधान में रहने की अनुमति, गुणवत्ता और डीएनए की मात्रा के बाद के विश्लेषण के साथ हस्तक्षेप कर सकते है और संभावित अनुक्रमण प्रतिक्रियाओं के साथ हस्तक्षेप कर सकता है।

यह प्रोटोकॉल दोनों एक पारंपरिक agarose जेल वैद्युतकणसंचलन कदम है और एक स्पंदित फील्ड जेल वैद्युतकणसंचलन कदम भी शामिल है। पहले डीएनए के अंश यह है कि> 20 KBP और अंश है कि <20 KBP पर एक धब्बा के रूप में चलाता है की एक प्रारंभिक आकलन है। पाउडर मिल के लिए आवश्यक नीचे की ओर अनुक्रमण प्रतिक्रियाओं के प्रयोजन के लिएओस जीनोम, डीएनए के अंश <20 KBP कम होना चाहिए (चित्रा 1, लेन 2 लेन 4 बनाम देखें)। स्पंदित फील्ड जेल वैद्युतकणसंचलन मूल्यांकन डीएनए> 20 KBP के रूप में आकार का एक बेहतर अनुमान आकार के द्वारा अलग किया जा सकता प्रदान करता है। > 48.5 KBP के डीएनए अनुक्रमण बाद प्रतिक्रियाओं (, चित्रा 2 देखें लेन 4) में उपयोग के लिए वांछनीय है।

फंगल इन प्रयोगों में प्रयुक्त सामग्री विकास कक्षों में प्रचारित किया गया था और प्रदूषण सख्त अलगाव प्रोटोकॉल और कर्मियों नियंत्रण का उपयोग सीमित था। इस वजह से, अन्य, गैर पाउडर फफूंदी रोगाणुओं के साथ संदूषण कम से कम था, और इसके क्षेत्र के अनुक्रमण का उपयोग कर कवक-विशिष्ट प्राइमरों केवल जी cichoracearum दृश्यों बरामद परिलक्षित। यह इन cas में क्षेत्र साइटों या एक ही अलगाव नियंत्रण की कमी ग्रीनहाउस से एकत्र पाउडर mildews के लिए मामला है, और प्रदूषण आकलन नहीं किया जा सकतातों निकाले डीएनए से उच्च गुणवत्ता वाले जीनोम की विधानसभा के लिए महत्वपूर्ण हो जाएगा।

विभिन्न फंगल डीएनए अलगाव प्रोटोकॉल का कोई भी संशोधन विशिष्ट महत्वपूर्ण था। बल्कि कई कदम पर मामूली संशोधनों उच्च आणविक भार पाउडर फफूंदी डीएनए यहाँ सूचना के अपेक्षाकृत उच्च पैदावार में हुई।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
लंबे समय से पढ़ें अनुक्रमण के लिए ख़स्ता फफूंदी से उच्च आण्विक वजन जीनोमिक डीएनए की शुद्धि
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter