Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Purificación de ADN de alto peso molecular genómico de oídio para Long-Read Sequencing

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

Los hongos oídio son un grupo de económicamente importantes patógenos fúngicos de plantas. Se sabe relativamente poco acerca de la biología molecular y la genética de estos patógenos, en parte debido a la falta de recursos genéticos y genómicos bien desarrolladas. Estos organismos tienen, genomas repetitivas grandes, que han hecho la secuenciación del genoma y montaje prohibitivamente difícil. A continuación, describimos métodos para la recogida, extracción, purificación y control de calidad de la evaluación de ADN genómico de alto peso molecular a partir de especies de moho uno pulverulentos, Golovinomyces cichoracearum. El protocolo descrito incluye la rotura mecánica de las esporas, seguido de una extracción de ADN genómico optimizado fenol / cloroformo. Un rendimiento típico fue de 7 g de ADN por cada 150 conidios mg. El ADN genómico que se aísla usando este procedimiento es adecuado para la secuenciación de larga leer (es decir,> 48,5 kpb). medidas de control de calidad para asegurar el tamaño, el rendimiento y pureza del ADN genómico son tambiéndescrito en este método. La secuenciación del ADN genómico de la calidad descrita aquí permitirá que para el montaje y la comparación de varios genomas oídio, que a su vez dará lugar a una mejor comprensión y un mejor control de este patógeno agrícola.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cenicillas son un grupo de obligado planta de hongos patógenos que biotrófica, tomados en conjunto, son la principal causa de enfermedades de las plantas en todo el mundo 1. Hay más de 900 especies descritas de oídio, que se han agrupado en cinco tribus taxonómicamente dentro de la familia Erisyphaceae 2. Debido tanto a su importancia económica y la relación íntima que desarrollan con sus anfitriones, las enfermedades de moho han sido objeto de investigación para> 100 años. Tras la infección, oídios provocan cambios drásticos en la estructura celular, el metabolismo y la biología molecular de sus anfitriones, en beneficio de este patógeno. Sin embargo, el estudio de oídios es particularmente difícil debido a su estilo de vida obligado, y el crecimiento del hongo en cultivo puro todavía no se ha descrito 3, 4, 5,"xref"> 6, 7, 8. Fiable transformación, estable genética de cenicillas aún no ha logrado también ha sido, a pesar de la transformación transitoria se ha reportado en algunas especies 9, 10.

La secuenciación y ensamblaje de genomas de moho en polvo ha demostrado ser difícil debido a una serie de características de la propia genoma. Genomas de moho en polvo son grandes (120 a 180 Mbp) en relación con otros genomas de hongos, y se componen de 60 - 90% de elementos repetitivos distribuidas uniformemente 11. Estos elementos incluyen repeticiones terminales no largos, así como elementos repetitivos no categorizados. Dos formas especiales de una sola especie oídio, Blumeria graminis f. sp. hordei y f. sp. tritici (Bgh y Bgt, respectivamente), así como el polvo de uva moho Erysiphe necator, tienen abejan secuenciaron, y los proyectos de genomas de varios otros se han completado 12, 13, 14. La naturaleza repetitiva de los genomas ha hecho ensamblaje difícil, y el genoma Bgh terminado fue ensamblado en 6.989 supercontigs con un L50 de 2 Mb 12.

A pesar del gran genoma, los oídios parecen tener un pequeño número de genes de proteínas de codificación, con 5.845 y 6.540 genes predichos en Bgh y Bgt, respectivamente. Los mildius pulverulentos secuenciados también parecen carecer de al menos 99 genes esenciales que son esenciales en otros hongos, que es consistente con la dependencia de los hongos en su planta huésped para la supervivencia 11, 12, 13, 14.

Las secuencias repetitivas cerca de telómeros, centrómeros, RN ribosomalA arrays y regiones enriquecidas en elementos de transposición de genes están mal ensambladas a partir de estrategias de secuenciación-leer cortas y son a menudo insuficientemente representadas en asambleas del genoma 15. Se cree que estas regiones para ser responsable de muchos de los huecos que se producen en secuencias del genoma, y esto se aplica a los oídios con su amplia expansión de elementos repetitivos 16. Altamente regiones del genoma de plástico se encuentran a menudo en tales regiones repetitivas 3. Ellos sirven como un sitio de reordenamientos cromosómicos y, a menudo codifican genes bajo fuerte presión selectiva, tales como los genes que codifican las proteínas efectoras y los genes que codifican enzimas del metabolismo secundario. Los avances en una sola molécula de tecnologías de secuenciación de lectura larga proporcionan una solución potencial para la secuenciación a través de las regiones repetitivas de genomas 15. Por ejemplo, FAINO et al. (2015) encontraron que la inclusión de la secuencia larga leer tecnologías y m ópticoapping les permitió producir una secuencia de genoma GAP-menos por dos cepas de la planta de hongos patógenos dalia Verticillium, triplicando la proporción de secuencias repetitivas de ADN en el genoma, aumentando el número de anotaciones de genes (y reducir el número de parcial o falta anotaciones de genes ) y el genoma revelador reordenamientos 17.

Para emplear estas tecnologías de secuenciación de larga leer, altas concentraciones de ADN genómico de alta calidad, con un mínimo de tamaños> 20 kpb, son necesarios. Aquí describimos nuestros métodos para la recolección de conidial, la purificación de ADN de alto peso molecular a partir de conidios y nuestras evaluaciones de control de calidad utilizando las especies de moho en polvo Golovinomyces cichoracearum cultivadas en pepino 18. Este protocolo se basa en un protocolo desarrollado en el grupo de laboratorio B. Keller (Universidad de Zürich, Zürich Suiza) 13, 19e incluye varias modificaciones que condujeron a un aumento de los rendimientos de ADN y una mayor proporción de ADN> 48,5 kpb de tamaño. El protocolo también incluye medidas de control de calidad basado en las recomendaciones del Departamento de Energía de los Estados Unidos Joint Genome Institute 20, 21, 22.

La función de cada reactivo incluido en el tampón de lisis, y la justificación de cada etapa de purificación, son como se describe en Henry (2008) 23. Disponibles protocolos publicados para el aislamiento de ADN genómico de alto peso molecular a partir de tejidos vegetales y microbianas también fueron consultados durante el diseño de este protocolo 24, 25, 26, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Preparación de Fungal materiales

  1. La creciente Oidio
    1. Cultivar plantas en cámaras de crecimiento con las siguientes condiciones: 22 ° C día la temperatura, 20 ° C Temperatura de la noche, 80% de humedad relativa, 14-h día de longitud y una intensidad de luz de 125 E · / m 2 / s (proporcionado por la iluminación fluorescente ).
    2. Infectar plantas de pepino (variedad sativa Cucumis Bush Champion) con Golovinomyces cichoracearum UCSC1 cepa como se ha descrito 18, 29.
  2. La recolección Oidio conidios
    1. conidios Harvest de las plantas infectadas a los 7 - 10 días después de la inoculación usando un pequeño vacío con un filtro en línea (11 m) en el que los conidios se acumulan. La aplicación de presión suave, ejecute la boquilla de vacío a lo largo de la superficie de la hoja para recoger los conidios.
      NOTA: El rendimiento medio de G. cichoracearum es de 20 mg de conidios de un fuertemente infected hoja de pepino de aproximadamente 130 cm 2 en la zona.
    2. Cepillo alrededor de 150 mg de los conidios (aproximadamente 375 l de volumen, o conidios de 7-8 hojas de pepino infectadas) desde el filtro en una hoja de papel limpia. Desde aquí, la transferencia de conidios en crioviales de 2 ml con un diámetro de dos 5/32 pulgadas pre-enfriado (en nitrógeno líquido) bolas de molienda de acero. Inmediatamente volver tubos para nitrógeno líquido. tubos almacenar a -80 ° C.
  3. Abriendo conidios por molienda de bolas
    1. Flash congelar placas de aluminio de molino de bolas en nitrógeno líquido. Cargar crioviales en rack de molino de bolas. Agitar vigorosamente los crioviales con conidios y bolas de acero en el molino de bolas durante 30 s a 30 ciclos / s (a temperatura ambiente). Inmediatamente vuelva a congelar crioviales en nitrógeno líquido.
      NOTA: En un principio, acceder a una muestra de conidios por microscopía con un aumento de 100X para la eficiencia de la ruptura de la pared celular durante la molienda. Si es necesario, moler para un adicional de 1 - 2 rondas de 30 s durante 30 ciclos / s, but mantener el número de rondas a un mínimo. La evaluación rutinaria de rotura de conidias por microscopía en esta etapa no es necesaria una vez que se han establecido las condiciones óptimas.

2. Purificación de ADN genómico

  1. conidios de lisis
    1. Trabajar con rapidez para evitar conidios descongelación, eliminar las bolas de acero de crioviales con un imán. Añadir 700! L 65 ° C tampón de lisis (Tabla 1) y agitar 5 - 10 s hasta que se forma una suspensión.
    2. Añadir 300! L precalentado (65 ° C) 5% (v / v) sarcosil y invertir suavemente para mezclar (1 inversión por cada 3 s) cinco veces. Incubar los tubos durante 30 minutos a 65 ° C; invierta suavemente 3 veces en 10, 20 y 30 min. Utilizando una punta de pipeta de gran calibre, Trasvasar toda la solución a un nuevo tubo de microcentrífuga de 2 ml. En todas las etapas posteriores, se mezcla por inversión suave, lento y transferir las soluciones que contienen ADN con puntas de pipeta de gran calibre.
  2. Extracción de ADN I
    1. Añadir 1 volumen de cloroformulario: alcohol isoamílico (24: 1 v / v) a la solución de lisis y se invierta suavemente para mezclar cinco veces. Incubar durante 10 min a temperatura ambiente, suavemente invirtiendo para mezclar cinco veces en el punto a mitad de camino y de nuevo al final de la incubación. Centrifugar a temperatura ambiente durante 15 min a 14.000 x g. Utilizando puntas de pipeta de gran calibre, transferir cuidadosamente la capa acuosa a un nuevo tubo de microcentrífuga de 2 ml; evitar la inclusión de material de la interfaz.
  3. ADN precipitación I
    1. Añadir 1 volumen de temperatura ambiente 100% de isopropanol (aproximadamente 750 l) y invertir suavemente para mezclar seis veces. Centrifugar a temperatura ambiente durante 15 min a 14.000 x g. Retirar con cuidado el sobrenadante y desechar.
    2. Añadir 450! L pre-refrigerada% de etanol (-20 ° C) 70. Centrifugar durante 5 min a temperatura ambiente a 14000 x g. Retirar con cuidado el sobrenadante y desechar. Centrifugar a 1000 xg durante 3 s, retirar cuidadosamente el sobrenadante con punta de pipeta fina y desechar. Aire seco en el sedimento durante 15 min unatemperatura ambiente t. No seque durante más de 15 minutos.
    3. Resuspender el precipitado en 300! L de TE (10 mM Tris-Cl, ácido tetra-acético de etileno diamina 1 mM, pH 8,0). Incubar durante la noche a 4 ° C. golpee suavemente para volver a suspender cualquier material residual que no entró en solución.
  4. Para eliminar la contaminación de RNA, añadir 10 l de RNasa A (10 mg / ml). Invertir suavemente para mezclar tres veces. Centrifugar a 1000 xg durante 3 s. Incubar a 37 ° C durante 2 h.
  5. Extracción de ADN II
    1. Añadir 300! L de fenol: cloroformo: alcohol isoamílico (25: 24: 1 v / v) y invertir suavemente para mezclar cinco veces. Incubar 10 minutos a temperatura ambiente, suavemente invirtiendo para mezclar cinco veces a mitad de camino y de nuevo al final de la incubación. Centrifugar 15 min a temperatura ambiente a 14000 x g. Utilizando una punta de pipeta de gran calibre, transferir el sobrenadante a un nuevo tubo de microcentrífuga de 1,5 ml.
  6. ADN precipitación II
    1. Añadir 0,01 volumen de 3 M de acetato de sodio pH 5,2 (approximately 3 l), invertir suavemente para mezclar cinco veces. Añadir 2,5 volúmenes pre-enfriada (-20 ° C) 100% de etanol (aproximadamente 750 l). Invertir suavemente para mezclar cinco veces. Incubar durante la noche a -20 ° C.
    2. Centrifugar 30 minutos a 4 ° C a 14.000 x g. Retirar con cuidado el sobrenadante y desechar.
    3. Añadir 450! L pre-refrigerada% de etanol (-20 ° C) 70. Centrifugar durante 5 min a 4 ° C a 14.000 x g. Retirar con cuidado el sobrenadante y desechar. Centrifugar a 1000 xg durante 3 s. Retirar con cuidado el sobrenadante con pipeta de punta fina y descarte.
    4. Aire seco en el sedimento durante 30-60 minutos a temperatura ambiente. Resuspender el precipitado en 27,5 l de TE. Incubar durante la noche a 4 ° C. golpee suavemente para volver a suspender cualquier material residual que no entró en solución.
    5. Alícuota de 2,5 l en 22,5 l de TE (volumen final 25 l) para las pruebas de control de calidad (ver abajo). Tiendas muestras de ADN a 4 ° C hasta la presentación para la secuenciación. Para el almacenamiento, almacenar muestras a largo plazoa -80 ° C y minimizar los ciclos de congelación-descongelación para evitar cizallamiento.
      NOTA: Tenga cuidado al pipetear en este paso como el ADN genómico de alto peso molecular puede ser difícil de pipetear correctamente, y es importante para asegurarse de que "QC Alícuota" es una representación exacta de la muestra de ADN genómico.

3. Control de Calidad

  1. pureza de la muestra
    1. El uso de un TE en blanco, evaluar la pureza de la muestra del ADN mediante la carga de 1 l de la QC alícuota en un espectrofotómetro de pequeño volumen. Registro A260 / A280 y A260 / A230 lecturas. ADN puro tendrá una relación A260 / A280 de la relación de aproximadamente 1,8 y A260 / A230 entre 1,8 y 2,2.
  2. Cuantificación de ADN genómico
    1. Realizar cuantificación de QC alícuota utilizando un kit de ensayo de cuantificación de ADN de doble cadena comercial de acuerdo con las instrucciones del fabricante.
  3. ADN I Evaluación de la Calidad
    1. Cargar aproximadamente 60 ng de ADN genómico y unaescalera de ADN en un gel de agarosa al 0,7% en 1X TAE (Tris 40 mM, ácido acético 20 mM, y EDTA 1 mM, pH 8,0). aparato de gel correr a 70 V durante 40 - 45 min hasta que las bandas de ADN genómico son aproximadamente 2 cm desde el pozo y cinta de separación en la escalera es aparente. Estas condiciones pueden necesitar ser ajustado basado en aparato de electroforesis de gel disponibles.
  4. ADN II Evaluación de la Calidad
    1. Cargar aproximadamente 60 ng de ADN genómico y una escalera de ADN de alto peso molecular (adecuado para la electroforesis en gel de campo pulsado) en un gel de agarosa al 1% en TBE 0,5x (Tris 44,5 mM, 44,5 mM de ácido bórico, EDTA 1 mM, pH 8,3) y correr en tampón de ejecución 0,5x TBE usando un 5 - de campo pulsado protocolo de electroforesis en gel de forma de onda de 80 kpb durante 16 h.
  5. Evaluación de origen bacteriano, fúngico, y contaminantes de plantas
    1. Realizar la reacción en cadena de la polimerasa (PCR) para amplificar los espaciadores transcritos internos apropiados (ITS) regiones de los genes ribosómicos utilizando cebadores y condiciones de amplificación de la listaed en la Tabla 2. Cargar 10 l de la reacción resultante en un gel.
      NOTA: una banda que representa el oidio región ITS debe ser amplificado con el hongos SU cebadores. ADN de este amplicón y cualquier amplicón generado con los cebadores, o bacterianas de las plantas debe ser secuenciado para determinar el origen de la contaminación. Sólo oidio secuencias de ITS se debe encontrar en el amplicón hongos.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Un ejemplo representativo de 60 ng de ADN genómico purificado de G. cichoracearum ejecuta en un gel de agarosa usando electroforesis en gel y usando electroforesis en gel de campo pulsado se muestra en las Figuras 1 y 2, respectivamente. preparaciones de ADN genómico que pasan, marginalmente aprobación y rechazo del control de calidad se representan. preparaciones de ADN genómico que pasan completamente el control de calidad son ideales para la secuenciación utilizando enfoques de secuenciación del genoma de lectura largo. Preparaciones que pasan marginalmente control de calidad son aceptables, pero se prefieren las preparaciones que pasan completamente. Preparaciones que fallan el control de calidad no son aceptables para leídos largo enfoques de secuenciación del genoma.

Figura 1
Figura 1: Gel de Agarosa Electroforesis de ADN genómico purificado. Carril 1: Carril 2: ADN genómico que pasó el control de calidad; Carril 3: ADN genómico que se consideró marginal; y Carril 4: ADN genómico que falló control de calidad. muestras de ADN genómico aceptables y marginales tienen una sola banda que corre por encima de 20 kpb con manchas mínimo a <20 kpb. muestras de ADN genómico que fallan el control de calidad han corra por debajo de 20 kpb, y pueden incluir fragmentos de bajo peso molecular a aproximadamente 100 pb (*). se requiere electroforesis en gel de campo pulsado para distinguir entre muestras de ADN aceptables y marginales. El bromuro de etidio se añadió al gel antes de la electroforesis para la visualización del ADN genómico. Las muestras se sometieron a electroforesis a 60 V durante 50 min. El gel fue fotografiado bajo luz UV utilizando un sistema de documentación de gel.

Figura 2
Figura2: Pulsada-Field Gel Electroforesis (PFGE) de ADN genómico oidio purificada. Carril 1: patrones de peso molecular, con la banda más alta a 48,5 kpb y el más bajo en 8,1 kpb. Los carriles 2 y 5: patrones de peso molecular que muestran bandas de 20, 10, 7, 5, 4, 3, 2 y 1,5 kpb (en la parte inferior de la imagen del gel). Carril 3: una muestra de ADN marginal, con la mayoría del ADN entre 20 y 48,5 kpb de tamaño. Carril 4: una muestra de ADN aceptable, con la mayoría del ADN> 48,5 kpb (*). Las muestras se realizaron a 75 V durante 15 h utilizando un programa de forma de onda de PFGE 5-80 kpb. tinte de ADN-tinción se añadió al gel después de la electroforesis y el gel se visualizó bajo luz UV utilizando un sistema de documentación de gel.

Reactivo Concentración final
Metab de potasioisulfite (K 2 S 2 O 5) 0,25 M
Tampón Tris pH 7,5 0,2 M
ácido etilendiaminotetraacético (EDTA) 50 mM
El cloruro de sodio (NaCl) 2 M
bromuro de cetiltrimetilamonio (CTAB) 2% v / v

Tabla 1: Preparación de tampón de lisis. Llevar a un volumen de 5 ml con dH 2 O.

Objetivo Nombre imprimación Secuencia del cebador Tm (° C) Tamaño esperado del Producto (pb)
ITS2 fúngica FW (ITS9) GAACGCAGCRAAIIGYGA 56-61,3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52.1
Bacteriana 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63,8-66,5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46,9-53,8
Bacterianas 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60,8-66,5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43,9-53,8
Hongos 18S V4 FW CCAGCASCYGCGGTAATTCC 58,7-61,5 431
RV ACTTTCGTTCTTGATYRA 43,2-48,3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63.8 750
R CsPDS GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66.6

Tabla 2: Cebadores para la Evaluación de la contaminación.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Con el fin de obtener ADN puro, de alto peso molecular genómico de la obligado hongos oidio biotrófico, una versión modificada de los métodos descritos anteriormente se desarrolló 30. El rendimiento promedio utilizando este protocolo optimizado es 7 g de ADN por 150 conidios mg, una duplicación de los rendimientos obtenidos con un protocolo anterior. Además, el tamaño promedio se incrementó de aproximadamente 20 kpb a más de 48,5 kpb. Este protocolo se ha optimizado en el sistema cichoracearum G. cucumber-. Con el fin de obtener la mejor calidad y la más alta de ADN pureza en otra oidio o obligar a los hongos biotróficos, puede ser necesaria una modificación adicional de este protocolo. En el futuro, este protocolo puede utilizarse para obtener ADN de alto peso molecular adecuado para la secuenciación de ADN de lectura larga a partir de otros hongos biotróficos obligados, aunque puede ser necesaria la modificación adicional.

Equilibrar la alta producción de ADN y de alto peso molecular de ADN extraído se una preocupacióndurante la optimización de este protocolo. Pasos incluyendo agitación en vórtex fueron eliminados con el fin de minimizar el cizallamiento del ADN, y fueron reemplazados por mezcla suavemente por inversión. Este cambio aumenta la calidad del ADN extraído sin reducir significativamente el rendimiento. Además, la eliminación de las bolas de acero en el comienzo de la etapa de lisis celular aumentó significativamente el rendimiento de ADN en comparación con dejar las bolas en la solución hasta el final de la etapa de lisis.

No G. cichoracearum conidios permaneció intacta después del procedimiento de molienda con bolas en el paso 1.3. Para obtener buenos rendimientos de ADN genómico de alto peso molecular, es crucial que la pared celular de los hongos se interrumpe durante este paso. integridad de los conidios se puede evaluar microscópicamente, y molienda de bolas adicional o métodos alternativos de interrupción puede ser necesario para otras especies de hongos.

Algunos conidios de hongos, en particular el Blumeria sp., Contienen pigmentos que pueden CONTaminar de extracción y purificación de ADN intentos. En estos casos, se recomienda incluir la etapa de filtración de ADN como se indica en la Bourras et al. (2015) de protocolo 19 y una etapa de lavado adicional con TE después de la etapa de filtración. La adición de la etapa de filtración dio lugar a un aumento pequeño pero significativo en la degradación del ADN, y sólo debe ser incluido si la pigmentación excesiva permanece después de la segunda etapa de precipitación de ADN. Estos pigmentos, si se les permite permanecer en solución, pueden interferir con el análisis posterior de la calidad y cantidad de ADN y potencialmente podrían interferir con las reacciones de secuenciación.

Este protocolo incluye tanto una etapa de electroforesis en gel de agarosa tradicional y una etapa de electroforesis en gel de campo pulsado. La primera es una evaluación inicial de la fracción de ADN que es> 20 kpb y la fracción que se ejecuta como un frotis a <20 kpb. A los efectos de las reacciones de secuenciación aguas abajo requerida para mil pulverulentogenomas de rocío, la fracción de ADN <20 kpb deben ser mínimos (véase la Figura 1, carril 2 frente a carril 4). La evaluación de la electroforesis en gel de campo pulsado proporciona una mejor estimación del tamaño como ADN> 20 kpb se pueden separar por tamaño. ADN de> 48,5 kpb es deseable para su uso en reacciones de secuenciación posteriores (véase la figura 2, carril 4).

El material fúngico usado en estos experimentos se propagó en cámaras de crecimiento y la contaminación se limitó utilizando estrictos protocolos de aislamiento y controles de personal. Debido a esto, la contaminación con patógenos de moho otra, no en polvo fue mínimo, y la secuenciación de la región ITS amplificado utilizando cebadores hongos específica recuperaron sólo secuencias cichoracearum G.. Esto puede no ser el caso de la mildiú recogidos de los sitios de campo o invernaderos que carecen de los mismos controles de aislamiento y evaluación de la contaminación en estas casES serán críticos para el ensamblaje de los genomas de alta calidad a partir del ADN extraído.

No una modificación de los diversos protocolos de aislamiento de ADN fúngico era únicamente importante. Más bien ligeras modificaciones en muchos pasos resultaron en los rendimientos relativamente altos de ADN moho peso molecular en polvo de alta informado aquí.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
Purificación de ADN de alto peso molecular genómico de oídio para Long-Read Sequencing
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter