Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Uzun Okuma Dizi Yapmak İçin Küllemesi Yüksek Moleküler Ağırlık Genomik DNA saflaştırılması

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

külleme mantar ekonomik açıdan önemli fungal bitki patojenlerinin bir gruptur. Nispeten küçük nedeniyle iyi gelişmiş genetik ve genomik kaynak eksikliğinden kısmen, moleküler biyoloji ve bu patojenlerin genetik az şey bilinmektedir. Bu organizmalar, genom sekanslama ve montaj engelleyici zorlaştırmıştır büyük, tekrarlayan genomlara sahiptir. Burada, tek bir toz halinde küf türleri, Golovinomyces cichoracearum yüksek moleküler ağırlıklı genomik DNA toplanması, ekstraksiyon, saflaştırma ve kalite kontrol değerlendirilmesi için yöntemleri tarif eder. Açıklanan protokol, optimize edilmiş bir fenol / kloroform genomik DNA izolasyonu, ardından sporlar mekanik bozulmasını içerir. Tipik verim 150 mg konidia başına 7 ug DNA kullanılmıştır. Bu prosedür kullanılarak izole edilmektedir genomik DNA, uzun okuma sekanslama (yani> 48.5 kbp) için uygundur. Kalite kontrol önlemleri, genomik DNA'nın boyutu ile, verim ve saflığı sağlamak için de vardırBu metot dahilinde tarif. Burada tarif edilen kalite genomik DNA dizilenmesi düzeneği ve bu da daha iyi bir anlaşılmasına yol, birden çok külleme genomlarının, karşılaştırılması için izin verir ve bu tarımsal patojen kontrolü gelişmiş olur.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Pudra küfleri zorunlu biotrophic mantar bitkinin bir grup birlikte alındığında, bitki hastalık dünya çapında 1 büyük nedenidir, bu patojenler bulunmaktadır. Taksonomik ailesi Erisyphaceae 2 içinde beş kabileler halinde gruplandırılmış olan külleme 900'ün üzerinde açıklanan türler vardır. ekonomik önemleri ve onların ana geliştirmek samimi bir ilişki için her iki dolayı, külleme hastalıkları> 100 yıldır araştırma konusu olmuştur. enfeksiyon üzerine, toz küfler bu patojenin yararlanmak için, hücreli yapının, metabolizma ve ana moleküler biyolojide önemli değişiklikler ortaya çıkarır. Bununla birlikte, toz küfü çalışma nedeniyle bunların zorunlu yaşam tarzı ve saf kültürde mantar büyümesi yapılmamış 5, 4, 3 tarif edilmemiştir için özellikle zor olduğu,"xref"> 6, 7, 8. Geçici transformasyon bazı türler 9, 10, rapor edilmiştir, ancak toz küfü güvenilir ve sabit bir genetik transformasyon ayrıca henüz gerçekleştirilmiş değildir.

külleme genomunun sıralama ve montaj nedeniyle genomun kendisinin bir dizi özellik zor olduğu kanıtlanmıştır. Diğer mantar genomların - (180 Mbp 120) göreli ve 60 oluşur - Toz halinde küf genomları büyüktür% 90 eşit olarak dağıtılmış tekrar eden kısımlar 11. Bu elemanlar, uzun terminal tekrarı, hem de edilmemiş tekrarlayan elementleri içerir. Tek külleme türleri, Blumeria graminis f iki formae SPECIALES. sp. hordei ve f. sp. tritici (BGH sırasıyla BGT) hem de üzüm külleme Erysiphe necator, arın sıralandı ve birkaç diğerleri için taslak genomları 12, 13, 14 tamamlanmıştır. Genomların tekrarlayan doğası düzeneği zorlaştırmıştır ve tamamlanan BGH genom 2 arasında bir L50 Mb 12 ile 6,989 supercontigs içine monte edilmiştir.

Büyük genomesi rağmen, toz küfler sırasıyla BGH'nin ve Bgt tahmin 5.845 ve 6,540 genleri ile, protein kodlama genlerinin az sayıda sahip gibi görünmektedir. Birbirini izleyen toz küfler de hayatta kalma 11, 12, 13, 14 ev sahibi bitki üzerinde mantar bağımlılığı ile tutarlıdır başka mantarlar içerisinde gerekli olan en az 99 çekirdek genlerden yoksun görünmektedir.

telomerlerin, sentromer, ribozomal RN yakın Tekrarlanan dizilerBir gen dizileri ve transpoze edilebilir elemanları zengin bolgelerın zayıf kısa okuma dizileme stratejilerinden monte edilir ve yeterince temsil genom tertibatları 15 genellikle edilir. Bu bölgelerin genom dizileri meydana boşlukların çok sorumlu olduğu düşünülen ve bu tekrar eden kısımlar 16 kendi geniş genişleme ile toz küfü için geçerli olan. Yüksek plastik genom bölümlerinin genellikle tekrar eden bölgeler 3 bulunmaktadır. Bunlar kromozom yeniden düzenlemelerinin bir alanı olarak hizmet ve genellikle bu efektör proteinlerini kodlayan genler ve ikincil metabolizma enzimleri kodlayan genler gibi güçlü selektif basınç altındaki genleri kodlayan. Tek moleküllü uzun okuma sekans teknolojilerini gelişmeler genomları 15 tekrarlamalı bölgelerde dizileme için potansiyel bir çözüm sağlar. Örneğin, Faino ve diğ. (2015) da dahil olmak üzere, uzun-dizi teknolojisi ve optik m okuma bulunduapping gen açıklamaları gen ek açıklama sayısını artırarak (ve kısmen sayısını azaltarak ya da eksik, genom içinde tekrar eden DNA dizilerinin oranını üçe bunları fungal bitki patojen Verticillium Dahlia iki soy için bir boşluk daha az genom dizisi üretmek için izin ) ve ortaya genom 17 yeniden düzenlemelerinin.

en az boyutları> 20 kbp bu uzun okuma dizileme teknolojileri, yüksek kaliteli, genomik DNA, yüksek konsantrasyonlarda kullanılması için, ihtiyaç vardır. Burada conidia gelen konidial toplanması, yüksek molekül ağırlıklı DNA 'nın arıtılması için yöntemleri tarif eder ve külleme türün Golovinomyces cichoracearum kullanarak kalite kontrol değerlendirmeleri salatalık 18 üzerinde büyümüş. Bu protokol B. Keller laboratuvar grubunda (Zürich Üniversitesi, Zürih İsviçre) 13, 19 geliştirilen bir protokol dayanmaktadırve artmış DNA verimlerine yol açan çok sayıda modifikasyonları ve büyüklüğü, DNA> 48.5 kbp daha yüksek bir oranını içermektedir. Protokol ayrıca Enstitüsü 20, 21, 22 Enerji Ortak Genom United States Department of tavsiyelerine göre kalite kontrol adımlarını içerir.

Liziz tamponu içerisinde yer alan her bir reaktif, ve her bir saflaştırma aşaması için mantık fonksiyonu olarak (2008) 23 Henry tarif edilmiştir. Bitki ve mikrobiyal dokularından, yüksek moleküler ağırlıklı genomik DNA'nın izolasyonu için uygun yayınlanmış protokoller bu protokol 24, 25, 26, 27, 28 tasarımında başvurulmuştur.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Mantar Malzemesinin 1. Hazırlanması

  1. Külleme Büyüyen
    1. Aşağıdaki koşullara büyüme odalarına bitkilerin büyümesi: 22 ° C gündüz sıcaklığı, 20 ° C gece sıcaklığı,% 80 nispi nem, 14 saat gün uzunluğu ve 125 uE / m2 / s 'lik bir ışık yoğunluğu (floresan aydınlatma sağladığı ).
    2. 18, 29 tarif edilen şekilde Golovinomyces cichoracearum gerilme UCSC1 salatalık bitkileri (Cucumis sativa çeşitli Bush Champion) Infect.
  2. Hasat Küllemesi Konidyumlar
    1. conidia toplandığı bir in-line filtre (11 um) ile bir küçük vakum kullanılarak aşılamadan sonra 10 gün - 7 enfekte bitkilerden hasat conidia. hafif basınç uygulanması, konıdi toplamak için yaprağın yüzeyi boyunca vakum memesi çalıştırın.
      Not: G. cichoracearum ortalama verimi ağır INFE gelen konidia 20 mg olanbölgede yaklaşık 130 cm2 CTED salatalık yaprağı.
    2. temiz bir kağıt tabakası üzerine filtreden (7-8 enfekte salatalık yapraklarına yaklaşık 375 uL hacmi veya conidia) conidia yaklaşık 150 mg bir fırça. Buradan (sıvı azot içinde) önceden soğutulmuş iki 5/32 inç çapında çelik öğütme topları ile 2 ml cryovials içine konıdi aktarın. Hemen sıvı nitrojen tüpleri döndürür. -80 ° C'de saklayın borular.
  3. Topu Mamüller tarafından Breaking Açık Konidyumlar
    1. Sıvı nitrojen içinde bilyalı değirmen alüminyum plakalar dondurma. Yük bilyeli değirmen rafa cryovials. Şiddetle (oda sıcaklığında) 30 döngü / s'de 30 s için bilyeli değirmende conidia ve çelik topları ile cryovials sallayın. Hemen sıvı azot içinde cryovials dondurursam.
      NOT: Başlangıçta, öğütme sırasında hücre duvarı kopma verimliliği için 100X büyütme mikroskobu ile Konidyumların bir örneğe erişmek. 30 döngü / S, B 30 saniyelik 2 mermi - Gerekirse, ek 1 öğütmekut minimuma mermi sayısını tutmak. Optimal koşullar kurulduktan sonra bu aşamada mikroskopla konidial kırılma Rutin değerlendirme gereksizdir.

2. genomik DNA saflaştırma

  1. Konidyumlar Liziz
    1. hızla çalışarak, çözdürme konidianıri önlemek bir mıknatısla cryovials çelik topları kaldırmak için. Karışım bir bulamaç elde edilinceye kadar 10 s - 700 ul 65 ° C lizis tamponu (Tablo 1) ve bir girdap 5 ekleyin.
    2. 300 uL (65 ° C) önceden ısıtılmış% 5 (h / h) sarkosil ekleyin ve yavaşça karıştırmak için beş kez (3 s başına 1 inversiyon) ters çevirin. 65 ° C'de 30 dakika boyunca inkübe edin; 10, 20 ve 30 dakika yavaşça 3 kez ters çevirin. Geniş çaplı bir pipet kullanarak, yeni 2 mL mikrosantrifüj tüpüne tüm çözüm aktarın. takip eden tüm adımlar da, yumuşak, yavaş ters çevirme ile karıştırmak ve geniş çaplı bir pipet uçları olan bir DNA-içeren çözeltiler aktarın.
  2. DNA Ekstraksiyon I
    1. kloro 1 hacim eklemeformu: izoamil alkol: yavaşça lizis çözeltisine (24 1 hacim / hacim) ve beş kez çevrilerek karıştırılmıştır. yavaşça inkübasyonun sonunda tekrar orta noktada beş kez karıştırmak ve tersini, oda sıcaklığında 10 dakika boyunca inkübe edin. 14,000 x g 'de 15 dakika süre ile oda sıcaklığında santrifüje. Geniş çaplı bir pipet kullanarak dikkatli bir şekilde yeni bir 2 ml mikrosantrifüj tüpüne Sulu tabaka transferi; arayüzünden madde içeren kaçının.
  3. DNA, yağış I
    1. 1 hacim oda sıcaklığında% 100 izopropanol (yaklaşık 750 uL) ilave edilir ve yavaşça, altı kez çevrilerek karıştırılmıştır. 14,000 x g 'de 15 dakika süre ile oda sıcaklığında santrifüje. Süpernatantı dikkatlice çıkarın ve atın.
    2. 450 uL önceden soğutulmuş (-20 ° C)% 70 etanol ekleme. 14.000 x g'de oda sıcaklığında 5 dakika boyunca santrifüje. Süpernatantı dikkatlice çıkarın ve atın. dikkatli bir şekilde ince bir pipet ucu ile süpernatantı ve atın, 3 s 1,000 x g'de santrifüjleyin. 15 dakika a için pelet hava-kurutunt, oda sıcaklığı. daha uzun 15 dakika kurutmayın.
    3. 300 uL TE pelet (10 mM Tris-CI, 1 mM etilen diamin tetra-asetik asit, pH 8.0) içinde yeniden süspanse edin. 4 ° C'de gece boyunca inkübe edilir. Yavaşça çözelti içine gitmedi kalan malzemeyi yeniden süspanse etmek fiske.
  4. RNA kontaminasyonu temizlemek 10 mL RNaz A (10 mg / ml) ekleyin. Yavaşça üç kez karıştırmak için ters. 3 s 1,000 x g'de santrifüjleyin. 2 saat boyunca 37 ° C'de inkübe edilir.
  5. DNA Ekstraksiyon II
    1. 300 ul fenol ekleyin: kloroform: izoamil alkol (25: 24: 1 h / h) ve yavaşça beş kez çevrilerek karıştırılmıştır. nazikçe inkübasyon sonunda yine yarım işaretinde beş kez karıştırın ve için tersini, oda sıcaklığında 10 dakika inkübe edin. 14.000 x g'de oda sıcaklığında 15 dakika santrifüj. Geniş çaplı bir pipet kullanarak, yeni bir 1.5 mL mikrosantrifüj tüpüne süpernatant aktarın.
  6. DNA, yağış II
    1. 0.01 hacim 3 M sodyum asetat pH 5.2 (approximatel eklemey3 uL) yavaşça beş kez çevrilerek karıştırılmıştır. 2.5 hacim önceden soğutulmuş (-20 ° C),% 100 etanol (yaklaşık 750 uL) ilave edilir. Yavaşça beş kez karıştırmak için ters. -20 ° C de bir gece boyunca inkübe
    2. Santrifüj 14,000 x g'de 4 ° C'de 30 dakika. Süpernatantı dikkatlice çıkarın ve atın.
    3. 450 uL önceden soğutulmuş (-20 ° C)% 70 etanol ekleme. 14,000 x g'da 4 ° C'de 5 dakika boyunca santrifüje. Süpernatantı dikkatlice çıkarın ve atın. 3 s 1,000 x g'de santrifüjleyin. Dikkatle ince pipet ucu ve tamamen yok olan süpernatant kaldırmak.
    4. Oda sıcaklığında 30-60 dakika boyunca pelet hava-kurutun. 27.5 uL TE içinde pelletini. 4 ° C'de gece boyunca inkübe edilir. Yavaşça çözelti içine gitmedi kalan malzemeyi yeniden süspanse etmek fiske.
    5. Kısım kalite kontrol testleri için 22.5 uL TE (nihai hacim 25 ul) halinde 2.5 uL (aşağıya bakınız). dizileme için gönderilmeden önce 4 ° C'de saklayın DNA örnekleri. Uzun süreli depolama, mağaza örnekleri içinve -80 ° C 'de yırtılmayı önlemek için donma-erime döngülerinden en aza indirir.
      Not: doğru pipetle zor olabilir, yüksek moleküler ağırlıklı genomik DNA olarak bu aşamada pipetleme dikkat ediniz, ve "QC kısım", genomik DNA örneği doğru bir temsili olduğundan emin olmak için önemlidir.

3. Kalite Kontrol

  1. Numune Saflık
    1. TE boş kullanarak, küçük hacimli spektrofotometrede QC alikot 1 uL yükleme ile DNA numunesi, saflığı analiz. Tutanak A260 / A280 ve A260 / A230 okumaları. Saf DNA, 1.8 ve 2.2 arasında, yaklaşık 1.8 ve A260 / A230 oranı olan bir A260 / A280 oranı olacaktır.
  2. Genomik DNA miktar belirlemesi,
    1. üreticinin talimatlarına göre bir ticari çift sarmallı DNA miktar deney kiti kullanılarak QC kısım ölçümü gerçekleştirmek.
  3. DNA Kalite Değerlendirmesi I
    1. Yük yaklaşık olarak 60 ng genomik DNA ve bir1x TAE (40 mM Tris, 20 mM asetik asit ve 1 mM EDTA, pH 8.0) içinde bir% 0.7 agaroz jeli üzerinde DNA merdiveni. 70 V 40 çalıştırmak jel tertibatına - genomik DNA bantları kadar, 45 dakika, yaklaşık merdiven iyi ve bant ayırma 2 cm belirgindir. Bu koşullar mevcut jel elektroforez aygıtı göre ayarlanması gerekebilir.
  4. DNA Kalite Değerlendirmesi II
    1. Yük, yaklaşık 60, 0.5 x TBE (44.5 mM Tris, 44.5 mM borik asit, 1 mM EDTA, pH 8.3) ve bir% 1 agaroz jeli üzerinde genomik DNA ve (değişken alanlı jel elektroforez için uygun), yüksek moleküler ağırlıklı DNA merdiveni ng 16 saat boyunca 80 kbp'lik dalga palslı-alan jel elektroforezi protokolü - 5 ile 0.5x TBE tamponunda çalıştırın.
  5. Bakteri, mantar, ve Bitki Kirleticilerin Değerlendirilmesi
    1. primerler ve amplifikasyon koşulları listesini kullanarak ribozomal genlerinin uygun iç transkripsiyonlu aralayıcılar (ITS) bölgelerin yükseltilmesi için polimeraz zincir reaksiyonu (PCR) gerçekleştirmekTablo 2'de ed. Bir jel üzerinde elde edilen reaksiyon yük 10 uL.
      Not: ITS bölgesi ITS primerler mantar ile amplifiye edilmelidir külleme temsil eden bir grup. bu amplikonun ve bakteriyel veya bitki primerleri ile üretilen herhangi bir amplikon DNA kirlenme kaynağı belirlemek üzere dizilenmiştir edilmelidir. Sadece külleme ITS dizileri mantar amplikonuna bulunmalıdır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

G. saflaştırılan genomik DNA 60 ng temsili bir örneği, jel elektroforezi kullanılarak bir agaroz jel üzerinde yürütülmüştür cichoracearum ve palslı-alan jel elektroforez kullanılarak sırasıyla Şekil 1 ve 2 de gösterilmiştir. Marjinal geçmek ve kalite kontrolü başarısız geçiren Genomik DNA preparasyonu temsil edilmektedir. tamamen kalite kontrolü yapılan genomik DNA preparatları uzun okuma genom dizileme yaklaşımlar kullanılarak, dizileme için idealdir. marjinal kalite kontrolü yapılan preparatlar olarak kabul edilebilir olan, ancak tam olarak geçmesi preparasyonlar tercih edilmektedir. Kalite kontrolü başarısız preparatlar, uzun okuma genom dizileme yaklaşımları için kabul edilebilir değildir.

Şekil 1
Şekil 1: Saflaştırılmış genomik DNA agaroz jel elektroforezi. Şerit 1: Şerit 2: kalite kontrol geçti genomik DNA; Şerit 3: marjinal olarak genomik DNA,; ve Şerit 4: Genomik DNA, kalite kontrol başarısız. Kabul edilebilir ve marjinal genomik DNA örnekleri tek bir bant <20 kbp en az dağılması 20 kbp üzerinde çalışan sahiptir. Kalite kontrolü başarısız Genomik DNA örnekleri 20 kbp altında leke olan ve yaklaşık 100 bp (*), düşük molekül ağırlıklı fragmanlarını içerebilir. Atımlı alan jel elektroforezi olarak kabul edilebilir ve marjinal DNA örnekleri arasında ayrım yapmak için gereklidir. Etidyum bromür genomik DNA görselleştirmek için, elektroforezden önce jele ilave edilmiştir. Numuneler 50 dakika süre ile 60 V elektroforezlendi. Jel, bir jel dokümantasyon sistemi kullanılarak UV ışığı altında görüntülendi.

şekil 2
şekil2: darbeli alan jel elektroforezi Saflaştırılmış Külleme genomik DNA (PFGE). Şerit 1: moleküler ağırlık standartları, 48.5 kbp en yüksek bant ve 8.1 kbp en düşük olan. Şerit 2 ve 5: (jel görüntüsünün alt kısmında), 20, 10, 7, 5, 4, 3, 2 ve 1.5 kbp'lik bantları gösteren moleküler ağırlık standartları. Şerit 3: marjinal DNA numunesi, büyüklüğü 20 ve 48.5 kbp'lik arasındaki DNA çoğunluğu ile. Şerit 4: kabul edilebilir bir DNA örneği, bir DNA> 48.5 kbp (*) çoğunluğu ile. Numuneler, 5-80 kbp PFGE dalga programı kullanılarak 15 saat süre ile 75 V çalıştırılmıştır. DNA boyama boyasının elektroforezden sonra jel ilave edildi ve jel, bir jel dokümantasyon sistemi kullanılarak UV ışığı altında görüntülendi.

reaktif Nihai Konsantrasyon
Potasyum Metabisulfite (K 2S 2 O 5) 0.25 M
Tris tampon pH 7.5 0.2 M
Etilendiamintetraasetik asit (EDTA) 50 mM
Sodyum klorür (NaCI) 2M
Setiltrimetil amonyum bromür (CTAB) % 2 h / h

Tablo 1: Liziz Tamponu hazırlanması. DH 2 O ile 5 ml'lik bir hacme getirmek

Hedef Astar İsim Astar Dizi Tm (° C) Beklenen Ürün Boyutu (bp)
Mantar ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61,3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52.1
Bakteriyel 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63,8-66,5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46,9-53,8
Bakteriyel 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60,8-66,5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43,9-53,8
Mantar 18S V4 FW CCAGCASCYGCGGTAATTCC 58,7-61,5 431
RV ACTTTCGTTCTTGATYRA 43,2-48,3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63.8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66.6

Tablo 2: Kirlilik Değerlendirme astarlar.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Zorunlu biotrophic külleme mantar saf, yüksek moleküler ağırlıklı genomik DNA elde etmek için, daha önce tarif edilen yöntemlerin değiştirilmiş bir versiyonu 30 geliştirilmiştir. Bu optimize edilmiş bir protokol kullanılarak ortalama verim 150 mg conidia başına 7 mg DNA, bir önceki protokol ile elde edilenin iki katıdır. Ayrıca, ortalama boyutu 48.5 kbp boyunca yaklaşık 20 kbp yükselmiştir. Bu protokol cucumber- G. cichoacearum sisteminde optimize edildi. biotrophic mantarların, diğer külleme en kaliteli ve yüksek saflıkta DNA elde etmek ya da zorunlu amacıyla, bu protokolün ek değişiklik gerekli olabilir. Daha ileri bir modifikasyon gerekli olsa Gelecekte, bu protokol, diğer zorunlu biotrophic mantarlardan uzun okuma DNA sekanslaması için, yüksek moleküler ağırlıklı DNA, uygun elde edilmesi için kullanılabilmektedir.

bir sorun, yüksek DNA verimi ve ekstre edilen DNA'nın yüksek molekül ağırlığı olan DengelemeBu protokolün optimizasyonu sırasında. Vorteks dahil basamak DNA kesme en aza indirmek için elimine edilmiştir ve ederek yavaşça karıştırılarak değiştirildi. Bu değişiklik, verimi önemli ölçüde azaltmadan ekstre DNA kalitesi arttı. parçalama adımının sonuna kadar çözelti içinde topları bırakarak karşılaştırıldığında Ayrıca, başlangıçta çelik topları çıkarma hücre parçalama aşaması önemli DNA verimi artırmıştır.

Hiçbir G. cichoacearum Konidyumların adımda 1.3 top freze prosedüründen sonra bozulmadan kalmıştır. Yüksek moleküler ağırlıklı genomik DNA iyi verim elde etmek için, fungal hücre duvarı bu aşama sırasında bozulur çok önemlidir. Konidyal bütünlük mikroskopik olarak değerlendirilir ve ilave top freze veya bozulma alternatif yöntemler diğer mantar türleri için gerekli olabilir.

Bazı mantar conidia, özellikle Blumeria sp., Devam edebilir pigmentleri içerirleraminat DNA ekstraksiyonu ve saflaştırma denemeleri. Bu durumlarda, Bourras ve arkadaşları de belirtildiği gibi, DNA bir filtre etme adımında dahil önerilir. (2015) protokol 19 ve filtrasyon basamağından sonra, TE ile ek bir yıkama aşaması. süzme aşamasında eklenmesi DNA bozulması küçük ama önemli bir artış ile sonuçlanmıştır, ve aşırı pigmentasyon ikinci DNA çökeltme işleminden sonra kalırsa, dahil edilmelidir. çözelti içinde kalmasına izin verilen ise bu pigmentler, DNA nitelik ve nicelik sonra analiz müdahale edebilir ve potansiyel olarak dizileme reaksiyonu engelleyebilir.

Bu protokol, geleneksel bir agaroz jel elektroforez aşamasını ve bir palslı-alan jel elektroforez aşamasını içerir. İlk> 20 kbp'lik ve <20 kbp bir yayma olarak çalışır fraksiyondur DNA fraksiyonunun bir başlangıç ​​değerlendirmesidir. toz mil için gerekli alt dizileme reaksiyonlarının amacıylaerime genomları, DNA fraksiyon <20 kbp'lik (Şekil 1, şerit 4 karşı şerit 2 ye bakınız), minimal olmalıdır. değişken alanlı jel elektroforezi değerlendirme boyutu ile ayrılabilir, DNA> 20 kbp olarak boyutunun daha iyi bir tahmin sağlar. > 48.5 kbp'lik DNA daha sonra dizileme reaksiyonları (şerit 4 bakınız Şekil 2) kullanım için tercih edilir.

Bu deneylerde kullanılan mantar malzemesi büyüme odalarına çoğaltıldı ve kirlenme katı izolasyon protokolleri ve personel kontrolleri kullanarak sınırlıydı. Bu nedenle, diğer olmayan külleme patojenler ile kirlenme az, ve bölgenin dizilim mantar özgü primerler, sadece G. cichoracearum geri kazanılan diziler kullanılarak amplifiye edilmiştir. Bu durum, bu cas alan siteler veya aynı yalıtım kontrolleri eksik seralardan alınan pudra küfü için geçerlidir ve kirlenme değerlendirme olmayabilires edilen DNA yüksek kaliteli genomlarının montajı için kritik öneme sahip olacaktır.

Çeşitli mantar DNA izolasyon protokolleri ile ilgili herhangi bir modifikasyonu tek olarak önemli olmuştur. Aksine, birçok adımlarda hafif modifikasyonlar Burada bildirilen moleküler ağırlığı yüksek külleme DNA nispeten yüksek verim oranlan ile sonuçlandı.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
Uzun Okuma Dizi Yapmak İçin Küllemesi Yüksek Moleküler Ağırlık Genomik DNA saflaştırılması
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter