Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

रेट्रोवायरल स्कैनिंग: सेल-विशिष्ट विनियामक क्षेत्रों को परिभाषित करने के लिए मानचित्रण एमएलवी एकीकरण साइटें

doi: 10.3791/55919 Published: May 28, 2017

Summary

यहां, हम मानव कोशिकाओं में मोलनी मूरेन ल्युकेमिया वायरस-आधारित रेट्रोवायरल वैक्टर के एकीकरण साइटों के जीनोम-विस्तृत मैपिंग के लिए प्रोटोकॉल का वर्णन करते हैं।

Abstract

मोलिनी मूरीन ल्यूकेमिया (एमएलवी) वायरस-आधारित रेट्रोवायरल वैक्टर एसिटिलेटेड बढ़ाने और प्रमोटरों में मुख्य रूप से एकीकृत होते हैं। इस कारण से, एमएलवी एकीकरण साइटों को सक्रिय नियामक तत्वों के कार्यात्मक मार्कर के रूप में इस्तेमाल किया जा सकता है। यहां, हम एक रेट्रोवायरल स्कैनिंग टूल पेश करते हैं, जो सेल-विशिष्ट बढ़ाने और प्रमोटरों की जीनोम-व्यापी पहचान की अनुमति देता है। संक्षेप में, लक्ष्य सेल आबादी एक एमएलवी-व्युत्पन्न वैक्टर के साथ transduced है और जीनोमिक डीएनए अक्सर काटने प्रतिबंध एंजाइम के साथ पच जाता है एक संगत डीएनए लिंकर के साथ जीनोमिक टुकड़े के बंधन के बाद, लिंकर-मध्यस्थता पोलीमरेज़ चेन रिएक्शन (एलएम-पीसीआर) वायरस-होस्ट जीनोम जंक्शनों के प्रवर्धन की अनुमति देता है। Amplicons के बड़े पैमाने पर अनुक्रमण एमएलवी एकीकरण प्रोफ़ाइल जीनोम चौड़ा परिभाषित करने के लिए प्रयोग किया जाता है। अंत में, आवर्ती एकीकरण के समूहों को सेल-विशिष्ट नियामक क्षेत्रों की पहचान करने के लिए परिभाषित किया जाता है, जो कोशिका-प्रकार विशिष्ट ट्रांसेरल कार्यक्रमों के सक्रियण के लिए जिम्मेदार होते हैं।

जैसे, स्नायविक स्टेम सेल) की पूर्वव्यापी पहचान के लिए एक महत्वपूर्ण तकनीक का प्रतिनिधित्व करती है जो संभावित भावी अलगाव के लिए मजबूत मार्करों की कमी करता है।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सेल की पहचान के विशिष्ट सेटों की अभिव्यक्ति द्वारा निर्धारित किया जाता है। प्रमोटर्स और बढ़ाने वाले सीआईएस-नियामक तत्वों की भूमिका सेल-प्रकार के विशिष्ट ट्रांसक्रिप्शनल कार्यक्रमों के सक्रियण के लिए महत्वपूर्ण है। ये नियामक क्षेत्रों विशिष्ट क्रोमैटाइन विशेषताओं, जैसे अजीब हिस्टोन संशोधनों, प्रतिलेखन कारकों और सह-कारक बाध्यकारी और क्रोमेटिन पहुंच के रूप में विशेषता है, जो कि कई सेल प्रकार 1 , 2 , 3 में उनके जीनोम-व्यापी पहचान के लिए व्यापक रूप से उपयोग किया गया है। विशेष रूप से, हिस्टोन एच 3 लीसेन 27 (एच 3 के 27 एसी) के एसिटिलेशन के जीनोम-व्यापी प्रोफाइल का उपयोग आमतौर पर सक्रिय प्रमोटरों, बढ़ाने वाले और सुपर बढ़ाने वाले 4 , 5 , 6 को परिभाषित करने के लिए किया जाता है।

मोलनी मूरेन ल्युकेमिया वायरस (एमएलवी) एक गामा-रेट्रोवायरस है जो व्यापक रूप से जीन के लिए उपयोग किया जाता हैस्तनधारी कोशिकाओं में स्थानांतरण लक्ष्य कोशिका को संक्रमित करने के बाद, रेट्रोवाइरल आरएनए जीनोम दोहरे असहाय डीएनए अणु में रेट्रो-ट्रांसक्रिप्टेड होता है जो वायरल और सेलुलर प्रोटीन को प्री-इंटिग्रेशन कॉम्प्लेक्स (पीआईसी) इकट्ठा करने के लिए बांधता है। पीआईसी नाभिक में प्रवेश करती है और मेजबान सेल क्रोमैटिन को बांधता है। यहां, वायरल इंग्रीज़ेज़, एक प्रमुख पीआईसी घटक, मेजबान सेल जीनोम में प्रांतीय डीएनए के एकीकरण की मध्यस्थता करता है। जीनोमिक डीएनए में एमएलवी एकीकरण यादृच्छिक नहीं है, लेकिन सेल-विशिष्ट फैशन 7 , 8 , 9 , 10 में , सक्रिय सीआईएस-नियामक तत्वों जैसे प्रमोटरों और बढ़ाने के रूप में होता है। यह अजीब एकीकरण प्रोफ़ाइल एमएलवी इंटेग्रज और सेलुलर ब्रोमोडामेन और एक्स्ट्राटार्मिनल डोमेन (बीईटी) प्रोटीन 11 , 12 , 13 के बीच प्रत्यक्ष बातचीत से मध्यस्थता है। बीईटी प्रोटीन (बीआरडी 2, बीआरडी 3, औरबीआरडी 4) मेजबान क्रोमेटिन और एमएलवी पीआईसी के बीच एक पुल के रूप में कार्य करें: अपने ब्रोमोडामों के माध्यम से वे अति एसिटिलेटेड सीआईएस-नियामक क्षेत्रों को पहचानते हैं, जबकि एक्स्ट्राटर्मिननल डोमेन एमएलवी इंटेग्रज 11 , 12 , 13 के साथ संपर्क करता है

यहां, हम रेट्रोवायरल स्कैनिंग, एमएलवी के एकीकरण गुणों के आधार पर सक्रिय सीआईएस-नियामक क्षेत्रों को मैप करने के लिए एक उपन्यास उपकरण का वर्णन करते हैं। संक्षेप में, कोशिकाओं को बढ़ाया हरे फ्लोरोसेंट प्रोटीन (ईजीएफपी) रिपोर्टर जीन को व्यक्त करने वाले एमएलवी-व्युत्पन्न रेट्रोवायरल वेक्टर से ट्रांसड्यूस किया जाता है। जीनोमिक डीएनए निष्कर्षण के बाद, एमएलवी वेक्टर और जीनोमिक डीएनए के 3 'टर्मिनल दोहराव (एलटीआर) के बीच जंक्शनों को लिंकर-मध्यस्थता पीसीआर (एलएम-पीसीआर) और व्यापक रूप से अनुक्रमित किया जाता है। एमएलवी एकीकरण साइटों को मानव जीनोम और जीनोमिक क्षेत्रों के लिए मैप किए जाते हैं जो एमएलवी द्वारा लक्षित हैं जो एमएलवी एकीकरण साइटों के समूह के रूप में परिभाषित होते हैं।

रेट्रोवायरल स्कैनएनिंग का इस्तेमाल कई मानव प्राथमिक कोशिकाओं 14 , 15 में सेल-विशिष्ट सक्रिय नियामक तत्वों को परिभाषित करने के लिए किया गया था। एपीआईजीनेटिक रूप से परिभाषित प्रमोटरों और बढ़ाने वाले एमएलवी क्लस्टरों को सह-मैप किया गया था, जिनमें से अधिकांश सक्रिय हिस्टोन अंक जैसे एच 3 के 27 एके, और सेल-विशिष्ट थे। रेट्रोवायरल स्कैनिंग, डीएनए नियामक तत्वों की जीनोम-व्यापी पहचान की संभावनाओं को शुद्ध रूप से शुद्ध कोशिका आबादी 7 , 14 में , साथ ही साथ कैरेटिनोसाइट स्टेम कोशिकाओं जैसे पूर्व आबादी परिभाषित सेल आबादी में, जिससे संभावित भावी अलगाव 15 के लिए प्रभावी मार्करों की कमी है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. मानव कोशिकाओं के एमएलवी ट्रांसडक्शन

  1. लक्ष्य कोशिकाओं को अलग करें और उन्हें एमजीएल-व्युत्पन्न रेट्रोवायरल वेक्टर के साथ ईजीएफपी रिपोर्टर जीन को बहाल करने और वैक्सीकुलर स्टेमाटाइटीस वायरस जी (वीएसवी-जी) या एम्फोट्रोपिक लिफाफा ग्लाइकोप्रोटीन 16 के साथ छद्म रूप से छेड़छाड़ की गई।
    1. निम्न विश्लेषण के लिए नकली-ट्रांसडुस्ड कोशिकाओं को नकारात्मक नियंत्रण के रूप में रखें। चूंकि एमएलवी-आधारित रेट्रोवायरल वैक्टर कोशिकाओं को कुशलता से विभाजित कर सकते हैं, संस्कृति को सेल डिवीजन को प्रोत्साहित करने वाली स्थितियों में लक्षित सेल आबादी। अध्ययन के तहत प्रत्येक सेल प्रकार के लिए पारगमन की स्थिति को विशेष रूप से अनुकूलित किया जाना चाहिए। मानव हेमेटोपोएटिक प्रजनन, टी कोशिकाओं और एपिडर्मल कोशिकाओं के लिए कोशिका वृद्धि और पारगमन की स्थिति संदर्भ 7, 14, 15 और 17 में वर्णित हैं।
  2. ट्रांसडक्शन के बाद 48 घंटे, 300 μL फॉस्फेट-बफ़ेड खारा (पीबीएस) में 2,000 भ्रूण गोजातीय सीरम युक्त एफआईपी और ईजीएफपी अभिव्यक्ति से 100,000 कोशिकाओं को पुन: resuspend।कम साइटेमेट्रिक विश्लेषण (488-एनएम उत्तेजना लेजर) नकली-ट्रांसडुस्ड कोशिकाओं को नकारात्मक नियंत्रण के रूप में उपयोग करें इष्टतम एकीकरण साइट पुनर्प्राप्ति के लिए, प्रतिदीप्ति सक्रिय सेल छंटनी (एफएसीएस) द्वारा जीएफपी + कोशिकाओं को शुद्ध करें।
  3. जीनोमिक डीएनए तैयारी के लिए 0.5 से 5 मिलियन कोशिकाओं को ले लीजिए एक लंबी संस्कृति अवधि (> 7 दिन) को अप्रतिबंधित प्राइरस पतला करना और आवश्यक है जब सदाशयी स्टेम कोशिकाओं की दीर्घकालिक संतानों का विश्लेषण करना ( चर्चा अनुभाग और संदर्भ 15 देखें )। सेल छर्रों को स्नैप-जमे हुए और उपयोग में -80 डिग्री सेल्सियस तक संग्रहीत किया जा सकता है।

2. लिंकर-मध्यस्थता-पीसीआर (एलएम-पीसीआर) द्वारा एमएलवी एकीकरण साइटों का प्रवर्धन

  1. जीनोमिक डीएनए (जीडीएनए) की तैयारी
    1. निर्माता के निर्देशों के अनुसार जीडीएनए एक स्तंभ-आधारित डीएनए निष्कर्षण किट का उपयोग करके निकालें और सुसंस्कृत कोशिकाओं के लिए प्रोटोकॉल का पालन करें।
  2. प्रतिबंध एंजाइम पाचनपर
    1. 1.5 एमएल ट्यूब में नमूना प्रति 4 प्रतिबंध एंजाइम पाचन सेट करें। 10 μL की अंतिम मात्रा में Tru9I (10U) और 1 μL बफर एम के जोड़कर प्रत्येक ट्यूब में 0.1 से 1 माइक्रोग्राम जीडीएनए डाइजेस्ट करें। 6 घंटे या रात भर 65 डिग्री सेल्सियस पर प्रतिक्रियाओं सेते।
    2. प्रत्येक प्रतिक्रिया में पीएसटीआई (10 यू) के 1 μL, बफर एच के 1 μL और 8 μL पानी में जोड़ें। प्रतिक्रियाओं को 6 घंटे या रात भर 37 डिग्री सेल्सियस पर सेते हैं। उपयोग होने तक नमूने -20 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है।
  3. लिंकर लगीज
    1. एक 100 सुक्ष्ममापी एकाग्रता पर लिंकर प्लस किनारा और लिंकर शून्य से किनारा oligonucleotides मिश्रण द्वारा 1.5 एमएल ट्यूब में एक 100 सुक्ष्ममापी Tru9I लिंकर स्टॉक समाधान तैयार करें। ट्यूब को 100 डिग्री सेल्सियस पर सेट करें और इसे कमरे के तापमान पर शांत कर दें। Tru9I लिंकर स्टॉक समाधान -20 डिग्री सेल्सियस तक उपयोग किया जा सकता है।
    2. 1.5 एमएल ट्यूब में 8 लिंकर लगी प्रतिक्रियाएं सेट करें। प्रत्येक प्रतिक्रिया के लिए, निम्नलिखित घटक जोड़ेंप्रतिबन्ध एंजाइम पाचन के 10 μL तक: 10 एक्स टी 4 डीएनए लीगेज रिएक्शन बफर के 1.4 μL, 10 माइक्रोन लिंकर ट्र्यूएलआई के 1 μL, टी 4 डीएनए लेगेज की 1 μL (2,000 यू) और 0.6 μL पानी। 3 से 6 घंटे के लिए 16 डिग्री सेल्सियस पर सेते हैं। उपयोग होने तक नमूने -20 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है।
  4. पहला पीसीआर
    1. 0.2 एमएल ट्यूब में 48 पीसीआर प्रतिक्रियाओं (प्रत्येक लैजिंग ट्यूब से 6 प्रतिक्रियाएं) सेट करें। प्रत्येक पीसीआर के लिए, निम्न अभिकर्मकों को 2 μL लघुकोड प्रतिक्रिया में जोड़ें: 5 μL 10 एक्स पीसीआर बफर, 2 μ एल 50 एमएम मैग्नीशियम सल्फेट, 1 एमएल 10 मिमी डीओक्सिनक्लियोक्लियोटाइड (डीएनटीपी) मिक्स, 1 माइक्रोन 10 माइक्रोन लिंकर प्राइमर, 1 10 माइक्रोन एमएलवी-3 'एलटीआर प्राइमर के μL, Taq डीएनए पोलीमरेज़ के 0.3 μL (1.5 यू) और 37.7 μL पानी। प्राइमर अनुक्रम तालिका 1 में प्रदान किए जाते हैं
    2. गर्म ढक्कन के साथ एक थर्मल cycler में पीसीआर प्रतिक्रिया प्रदर्शन, निम्नानुसार है: 2 मिनट के लिए 95 डिग्री सेल्सियस; 15 एस के लिए 95 डिग्री सेल्सियस के 25 चक्र, 30 डिग्री सेल्सियस के लिए 55 डिग्री सेल्सियस, 1 मिनट के लिए 72 डिग्री सेल्सियस; 72 डिग्री; सी 5 मिनट के लिए; 4 डिग्री सेल्सियस पर पकड़ो उपयोग होने तक नमूने -20 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है।
  5. दूसरा पीसीआर
    1. 0.2 एमएल ट्यूब में 48 पीसीआर प्रतिक्रियाओं (प्रत्येक "पहले पीसीआर" ट्यूब से 1) सेट करें। प्रत्येक पीसीआर के लिए, पहली पीसीआर प्रतिक्रिया के 2 μL के लिए निम्नलिखित घटकों को जोड़ें: 5 μL 10 एक्स पीसीआर बफर, 2 एमएल 50 एमएम मैगनीशियम सल्फेट, 10 एमएम डीएनटीपी मिक्स के 1 μL, 10 माइक्रोन लिंकर नेस्टेड प्राइमर के 1 μL, 1 10 माइक्रोन एमएलवी -3 एलएलआर नेस्टेड प्राइमर के μL, ताक डीएनए पोलीमरेज़ (1.5 यू) के 0.3 μL और 37.7 μL पानी। नेस्टेड प्राइमरों का इस्तेमाल किया गया है जिसे विशिष्ट विशाल अनुक्रमण रणनीति के लिए तैयार किया गया है: (i) लिंकर नेस्टेड प्राइमर और एमएलवी -3 'एलटीआर नेस्टेड प्राइमर इलुमिना प्लेटफॉर्म के साथ संगत; (Ii) लिंकर नेस्टेड प्राइमर और एमएलवी -3 'एलटीआर नेस्टेड प्राइमर रोश मंच के साथ संगत है। प्राइमर अनुक्रम तालिका 1 में सूचीबद्ध हैं
    2. गर्म ढक्कन के साथ एक थर्मल cycler में पीसीआर प्रतिक्रिया प्रदर्शन, निम्नानुसार है: 2 मिनट के लिए 95 डिग्री सेल्सियस; 2515 डिग्री सेल्सियस के लिए 95 डिग्री सेल्सियस, 30 डिग्री सेल्सियस के लिए 58 डिग्री सेल्सियस, 1 मिनट के लिए 72 डिग्री सेल्सियस के चक्र; 5 मिनट के लिए 72 डिग्री सेल्सियस; 4 डिग्री सेल्सियस पर पकड़ो उपयोग होने तक नमूने -20 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है।
    3. 15 एमएल ट्यूब (2.4 एमएल की अंतिम मात्रा) में 48 नेस्टेड पीसीआर प्रतिक्रियाओं को पूल करें। उपयोग होने तक नमूने -20 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है।
  6. एमारोस जेल वैद्युतकणसंचलन द्वारा एलएम-पीसीआर उत्पादों की उपस्थिति और आकार का निर्धारण करें।
    1. 20 μL एलएम-पीसीआर उत्पादों के बफर को लोड करने के 4 μL को जोड़ें और 1% agarose जेल पर नमूना लोड करें, साथ में 100 बीपी डीएनए सीढ़ी के साथ। 30 से 60 मिनट के लिए 5 वी / सेमी पर जेल भागो और एसिडियम ब्रोमाइड धुंधला द्वारा पीसीआर उत्पादों की कल्पना करें।
    2. नकली-ट्रांसडुस्ड नमूने से नकारात्मक नियंत्रण के रूप में एक एलएम-पीसीआर प्रतिक्रिया चलाएं।
  7. सोडियम एसीटेट समाधान (3 एम, पीएच 5.2) के 0.1 खंड और 100% इथेनॉल के 2.5 वॉल्यूम जोड़कर एम्प्लिकेशंस को रोकें। मिक्स और फ्रीज -80 डिग्री सेल्सियस 20 मिनट के लिए
    1. फू पर स्पिन20 मिनट के लिए 4 डिग्री सेल्सियस पर एक मानक माइक्रोसेंट्रिफ्यूज में गति लेंगे सतह पर तैरनेवाला त्याग दें और 70% इथेनॉल के साथ गोली धो लें। 5 मिनट के लिए 4 डिग्री सेल्सियस पर एक मानक माइक्रोसेंट्रिफ्यूज में पूर्ण गति से स्पिन करें
    2. सतह पर तैरनेवाला त्यागें और गोली हवा में सूखा। 200 μL का पीसीआर-ग्रेड पानी जोड़ें और डीएनए को फिर से खोलें। उपयोग होने तक नमूने -20 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है।
  8. एलएम-पीसीआर उत्पादों के 20 μL लोडर बफर को 100 μL तक जोड़ें और 1% agarose जेल पर नमूना लोड करें, साथ में 100 बीपी डीएनए सीढ़ी के साथ।
    1. 30 से 60 मिनट के लिए 5 वी / सेमी पर जेल भागो और 150 से 500 बीपी-लंबी एम्प्लिकॉन वाली जेल का काटा।
    2. एलएम-पीसीआर उत्पादों को स्तंभ-आधारित जेल निष्कर्षण किट के साथ शुद्ध करें और यूवी स्पेक्ट्रोफोटोमीटर का उपयोग करके एकाग्रता को मापें।
  9. निर्माता के निर्देशों के अनुसार, बायोएलाइलेज़र उपकरण का उपयोग करके एलएम-पीसीआर उत्पादों की लंबाई का मूल्यांकन करने के लिए पुस्तकालय के 1 μL का उपयोग करें।
  10. शुद्ध एलएम-पीसीआर उत्पादों के 20 एनजी का प्रयोग करें और उन्हें पीसीआर -2.1-टॉप ओ वेक्टर में क्लोन करें, निर्माता के निर्देशों के अनुसार।
  11. एम 13 यूनिवर्सल प्राइमर का उपयोग करते हुए प्रतिक्रियाओं का पालन करें, परिणामस्वरूप अनुक्रमों के जीनोमिक मैपिंग के बाद, वायरल-जीनोम जंक्शनों (एमएलवी -3 'एलटीआर नेस्टेड प्राइमर सहित) की उपस्थिति प्रकट करने के लिए> क्लोनों के 50% में नमूनों की पहचान करने के लिए उपयुक्त बड़े पैमाने पर अनुक्रमण के लिए वायरल-जीनोम जंक्शन का उदाहरण:
    संगम
    एमएलवी -3 'एलटीआर नेस्टेड प्राइमर 454 और लिंकर नेस्टेड प्राइमर 454 ( टेबल 1 ) को बोल्ड में इंगित किया गया है और तिरुलिक में वायरल एलटीआर के 3' अंत मानव जीनोमिक अनुक्रम लाल पाठ में हाइलाइट किया गया है (chr10: 6439408- 643950 9, एचजी 1 9)।

3. एमएलवी एकीकरण साइटों की विशाल संख्या

नोट: एलएम-पीसीआर ठेसयूएसी को वाणिज्यिक प्लेटफॉर्म का उपयोग करके अनुक्रमित किया जा सकता है (दूसरी पीसीआर प्रतिक्रिया में उचित नेस्टेड प्राइमर जोड़ी का चयन करना, उपधारा 2.5.1 देखें)। रोश जीएस-एफएलएक्स पाइरोसेक्वेन्सिंग प्लेटफॉर्म द्वारा अनुक्रमण के लिए, पिछला कागजात 7 , 14 , 15 का संदर्भ लें। इस खंड में, Illumina sequencing प्लेटफॉर्म के लिए एक नव-अनुकूलित प्रोटोकॉल का वर्णन किया गया है।

  1. पुस्तकालय की तैयारी
    1. 0.2 एमएल ट्यूब में प्रति नमूना प्रति 1 अनुक्रमित पीसीआर प्रतिक्रिया सेट करें। प्रत्येक पीसीआर के लिए, 5 μL (150-170 एनजी) शुद्ध एलएम-पीसीआर उत्पाद में निम्न अभिकर्मकों को जोड़ें: इंडेक्स प्राइमर 1 के 5 μL, इंडेक्स प्राइमर 2 के 5 μL, 2 एक्स मास्टर मिक्स के 25 μL और पीसीआर- ग्रेड पानी प्रत्येक नमूने के लिए एक अलग इंडेक्स संयोजन का उपयोग करें।
    2. गर्म ढक्कन के साथ एक थर्मल cycler में पीसीआर प्रतिक्रियाएं करें, निम्नानुसार: 3 मिनट के लिए 95 डिग्री सेल्सियस; 30 एस के लिए 95 डिग्री सेल्सियस के 8 चक्र, 30 एस के लिए 55 डिग्री सेल्सियस, 30 एस के लिए 72 डिग्री सेल्सियस; 5 मीटर के लिए 72 डिग्री सेल्सियसमें; 4 डिग्री सेल्सियस पर पकड़ो
    3. ठोस-चरण प्रतिवर्ती स्थिरीकरण (एसपीआरआई) बीड अलगाव प्रोटोकॉल का प्रयोग करके पीसीआर उत्पादों को शुद्ध करें: 1.5 एमएल ट्यूबों में नई, प्रत्येक नमूने के लिए 56 μL मोतियों को जोड़ें और निर्माता के निर्देशों का पालन करें। Tris-HCl के 10 एमएम के 25 μL में एल्यूट उपयोग होने तक पुस्तकालयों को -20 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है।
  2. पुस्तकालय की जांच
    1. बायोएलाइलेज़र इंस्ट्रूमेंट का उपयोग करके लाइब्रेरी आकार का आकलन करने के लिए नमूने के 1 μL का उपयोग करें।
    2. निर्माता के निर्देशों के मुताबिक प्रतिदीप्ति आधारित वास्तविक समय पीसीआर परख का उपयोग करके पुस्तकालय मृदुता को मापने के लिए नमूने के 1 μL का उपयोग करें।
  3. पुस्तकालय कमजोर पड़ने और अनुक्रमण
    1. ट्रिस-एचसीएल 10 एमएम का उपयोग करके पुस्तकालयों को 10 एनएम तक पतला करें पूलिंग पुस्तकालयों के लिए, प्रत्येक पतला पुस्तकालय के 5 μL को एक नया 1.5 एमएल ट्यूब में स्थानांतरित करें और फिर ट्रिस-एचसीएल 10 एमएम में 4 एनएम के पूल को कम करें।
    2. 5 μL के 0.2 एनएओएचएच के साथ 1.5 μL के साथ 5 μL मिलाएंएल ट्यूब, भंवर संक्षेप में, स्पिन डाउन और कमरे के तापमान पर 5 मिनट के लिए सेवन करने के लिए पुस्तकालयों का खंडन।
    3. बर्फ पर नलिका डालें और 9 0 μL पूर्व-ठंडा संकरण बफर (एचटी 1) जोड़ें। एक नई 1.5 एमएल ट्यूब में 300 μL विकृत पूल की विभाज्यता और एक 10 पीएम अंतिम पुस्तकालय पूल प्राप्त करने के लिए पूर्व ठंडा HT1 के 300 μL जोड़ें।
    4. समानांतर में, 1.5 एमएल ट्यूब में 3 μL ट्रिस-एचसीएल 10 एमएम के साथ 2 μL फ़िक्स नियंत्रण लाइब्रेरी (10 एनएम) मिलाएं। NaOH 0.2 एन के 5 μL जोड़ें, भंवर संक्षेप में, स्पिन-डाउन और कमरे के तापमान पर 5 मिनट के लिए पतला फििक्स को वंचित करना। बर्फ पर ट्यूब रखो और 9 0 μL प्री-शीत HT1 जोड़ें।
    5. एक नई 1.5 एमएल ट्यूब में विघटनकारी फीक्स के 300 μL की विभाज्यता और एक 10 पीएम फाइनल फाईक्स प्राप्त करने के लिए पूर्व-ठंडा HT1 के 300 μL जोड़ें।
    6. 1.5 एमएल ट्यूब के एक नए नए संस्करण में, 90 μL विकृत फीक्स पुस्तकालय के साथ 5 9 0 μL का विकृत पुस्तकालय पूल मिला, इस प्रकार 15% फीिक्स नियंत्रण के साथ अंतिम 10 पीएम पूल प्राप्त करना।
    7. नमूना के इन 600 μL पिपेटलोड किए गए अनुक्रमण अनुक्रमण अभिकर्मक कारतूस के लोड नमूना जलाशय में मात्रा और 150-चक्र चलाने के एकल-पढ़ने के लिए तत्काल आगे बढ़ें।
      नोट: इस प्रोटोकॉल के लिए जरूरी महत्वपूर्ण अभिकर्मकों और प्राइमर अनुक्रम तालिका 1 में सूचीबद्ध हैं।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

रेट्रोवायरल स्कैनिंग प्रक्रिया का कार्यप्रवाह

रेट्रोवायरल स्कैनिंग प्रक्रिया का कार्यप्रवाह चित्रा 1 में स्कीमाइज्ड किया गया है। लक्ष्य सेल आबादी शुद्ध और एक एमएलवी-व्युत्पन्न रेट्रोवायरल वेक्टर के साथ ट्रांसडुक्स्ड है जो ईजीएफपी रिपोर्टर जीन को व्यक्त करता है। ट्रांसीजीन दो समान लंबे टर्मिनल दोहराता (5 'और 3' एलटीआर) के द्वारा flanked है, संश्लेषण सुनिश्चित करने, रिवर्स ट्रांसक्रिप्शन और वायरल जीनोम का एकीकरण मेजबान डीएनए में। पारगमन दक्षता ईजीएफपी अभिव्यक्ति के एफएसीएस विश्लेषण द्वारा मूल्यांकन की जाती है। सेल आबादी में एमएलवी-ट्रांसडुस्ड कोशिकाओं का एक उच्च अनुपात (> 30%) युक्त होता है और बाद में एकीकृत एमएलवी वायरल कैसेट युक्त जीनोमिक डीएनए निकालने के लिए lysed किया जाता है। जीनोमिक डीएनए पचा और एक संगत लिंकर के साथ ligated और वायरल 3 'एलटीआर और मेजबान जीनोम के बीच जंक्शन LM-PCR द्वारा बढ़ाया जाता है। वीरहम-होस्ट जीनोम जंक्शनों को तब बड़े पैमाने पर रोशे या इलुमिना प्लेटफार्मों के माध्यम से अनुक्रमित किया गया है। अंत में, एमएलवी एकीकरण साइटों को मानव जीनोम के लिए मैप किया जाता है ताकि आवर्ती प्रविष्टि साइटों के जीनोमिक समूहों को परिभाषित किया जा सके।

एलएम-पीसीआर द्वारा एमएलवी एकीकरण साइटों का प्रवर्धन

एलएम-पीसीआर को चित्रा 2 में स्कीमाइज्ड किया गया है। जीनोमिक डीएनए एमएलवी-ट्रांसडुस्ड कोशिकाओं से निकाला जाता है और ट्रूएलआई प्रतिबंध एंजाइम से पचा जाता है, जो कि मानव जीनोम को अक्सर कट जाता है, 70 बीपी की औसत लंबाई वाले टुकड़े उत्पन्न करता है। एक दूसरे प्रतिबंध एंजाइम (पीएसटीआई) का उपयोग एकीकृत और गैर-एकीकृत आंतरिक 5 'एलटीआर टुकड़ों के प्रवर्धन को रोकने के लिए किया जाता है। एक ट्रेल 9आई डबल फंसे हुए लिंकर तब जीनोमिक टुकड़े के लिए बांटा जाता है और एलएम-पीसीआर को लिंकर के लिए विशिष्ट प्राइमरों के साथ किया जाता है और 3 'एलटीआर वायरस-होस्ट जीनोम जंक्शनों को बढ़ाना नेस्टेड पीसीआर पीआरआई का उपयोग करके किया जा सकता हैरॉश या इलुमिना अनुक्रमण प्लॅटफॉर्म के साथ संगत मैटर्स

वायरस-होस्ट जीनोम जंक्शन एम्प्लिकॉन का विश्लेषण

चित्रा 3 में प्रयोग के प्रयोग में, हमने सीडी34 - सीडी 13 + मैलॉइड पूर्वपुस्र्ष / पूर्ववर्ती (एमपीपी) को शुद्ध किया और ईजीएफपी रिपोर्टर जीन को व्यक्त करते हुए एमएलवी-व्युत्पन्न रेट्रोवाइरल के साथ उन्हें ट्रांसड्यूस किया। 60% से अधिक एमपीपी कोशिकाओं ने ट्रांसफर करने के बाद eGFP 48 घंटे को व्यक्त किया (डेटा नहीं दिखाया गया)। पारगमन के 15 दिनों बाद, हमने कोशिकाओं को एकत्र किया, जीडीएनए निकाला और वायरस-होस्ट जीनोम जंक्शनों को बढ़ाया, जैसा कि ऊपर वर्णित है। संग्रहित एलएम-पीसीआर उत्पादों की एक विभाज्य उपस्थिति और amplicons के आकार की पुष्टि करने के लिए 1% agarose जेल पर लोड किया गया था। हमने 150 से 500 बीपी ( चित्रा 3 ए ) तक के विभिन्न आकारों के एलएम-पीसीआर उत्पादों के लिए डीएनए धब्बा को सफलतापूर्वक देखा। तब एम्प्लीकन्स थेडीएनए वर्षा द्वारा केंद्रित और 1% agarose जेल पर लोड। एलएम-पीसीआर उत्पादों जेल-शुद्ध होते हैं और एक बायोएनिलाइज़र सिस्टम पर चलते हैं, अपेक्षित एम्प्लिकॉन आकार (150 और 500 बीपी के बीच, चित्रा 3 बी ) की पुष्टि करते हैं।

सक्रिय और सेल-विशिष्ट विनियामक क्षेत्रों में एमएलवी एकीकरण का मैपिंग

चित्रा 4 में रिपोर्ट किए गए प्रयोग में, हेमटोपोएटिक स्टेम / पूर्वज कोशिकाएं (एचएसपीसी), एरिथ्रोर्ड पूर्वज / पूर्ववर्ती (ईपीपी) और मायलोइड पूर्वज / पूर्ववर्ती (एमपीपी) एक एमएलवी-व्युत्पन्न रेट्रोवायरल वेक्टर से ट्रांसडुस्ड थे। इन परिणामों को संभावित संदूषण / टकराव 18 , 1 9 से बचने के लिए अलग-अलग सेल प्रकार से प्राप्त प्रसंस्करण और अनुक्रमिक नमूने प्राप्त किए गए थे। भारी अनुक्रम द्वारा उत्पन्न कच्चे अनुक्रम को एक स्वचालित जैव सूचना विज्ञान द्वारा संसाधित किया गया थावायरल और लिंकर दृश्यों को खत्म करने के लिए पाइप लाइन फिर, Blat 17 का उपयोग करते हुए मानव जीनोम पर कम से कम 20 बीपी के अद्वितीय दृश्य मैप किए गए। कच्चे संरेखण को पहले 3 न्यूक्लियोटाइड्स, यूनिवोलल मैचों और न्यूनतम 95% पहचान के भीतर शुरू करने के लिए मिलान की आवश्यकता होती है। आवर्ती एमएलवी एकीकरण के क्लस्टर्स को यादृच्छिक जीनोमिक अनुक्रमों के डेटासेट के साथ एक सांख्यिकीय तुलना द्वारा परिभाषित किया गया, जो क्रमिक मंच के साथ संगत दूरी पर एक Tru91 प्रतिबंध आकृति के साथ मानव जीनोम से जीनोमिक पदों को बेतरतीब ढंग से निकाला गया। तब अद्वितीय दृश्यों का एक यादृच्छिक सेट उत्पन्न करने के लिए, नियंत्रण दृश्यों को उसी मानचित्रण और एकीकरण अनुक्रमों के लिए उपयोग की जा रही पाइपलाइन के माध्यम से संसाधित किया गया। एमएलवी समूहों को परिभाषित करने के लिए, हमने डीबीएससीएएन क्लस्टरिंग एल्गोरिदम 1 9 को लागू किया है, जो अत्यधिक क्लस्टर वाले एकीकरण के क्षेत्रों की पहचान करने के लिए लगातार समान एमएलवी एकीकरण के साथ तुलना में समान यादृच्छिक स्थलों के वितरण की तुलना करता है, जो डीईएफटीसेल विशिष्ट विनियामक तत्वों 7 , 14 , 15 में झूठे क्लस्टर की पीढ़ी से बचने के लिए, यादृच्छिक नियंत्रण डेटासेट से कई निष्कर्षों को प्रदर्शन किया गया। हम एचएमपीसी, ईपीपी और एमपीपी में क्रमशः एलएम-पीसीआर और पाइरो सिक्सिंगिंग 32,574, 27,546 और 36,358 एमएलवी एकीकरण साइटों द्वारा मैप किए गए हैं। आवर्तक एमएलवी एकीकरण के क्लस्टर्स एसिटिलाटेड एन्हेंचर और प्रमोटरों ( चित्रा 4 ए ) के साथ सह-मैप किए गए हैं। एमएलवी-लक्षित नियामक क्षेत्रों में से अधिकांश सेल-विशिष्ट थे, जैसे: (i) एचएसपीसी -विशिष्ट SPINK2 जीन ( चित्रा 4 बी ) के प्रमोटर; (Ii) लोकस कंट्रोल क्षेत्र जिसमें एरिथ्रोइड-विशिष्ट β- जैसे ग्लोबिन जीन ( चित्रा 4 सी ) के शक्तिशाली बढ़ाने वाले होते हैं; (Iii) एमपीपी-विशिष्ट एलएजेजेड जीन ( चित्रा 4 डी ) के ऊपर की ओर बढ़ रहे विस्तारकर्ता । अंत में, हम सत्यापित करने के लिए luciferase assays इस्तेमाल कियाईपीपी और एमपीपी में चित्रात्मक सेल-विशिष्ट एमएलवी-लक्षित बढ़ाने के एक उप-भाग ( चित्रा 4 ई )।

आकृति 1
चित्रा 1: रेट्रोवायरल एकीकरण साइट मैपिंग प्रक्रिया की एक सामान्य योजना। लक्ष्य कोशिकाओं को एक एमएलवी-आधारित रेट्रोवायरल वेक्टर जिसमें एक ईजीएफपी कैसेट युक्त ट्रांसडुल्ड किया जाता है। ट्रांसडुस्ड कोशिकाओं से प्राप्त जीनोमिक डीएनए ट्रूएलआई के साथ पच चुका है और एक संगत ट्रूएलआई डबल-स्ट्रैंड लिंकर के साथ लगी है। एमएलवी एकीकरण साइटों को नेस्टेड एलएम-पीसीआर द्वारा बढ़ाया गया था और वायरस-होस्ट जीनोम जंक्शनों की लाइब्रेरी को व्यापक रूप से इल्यूमिना या रॉश प्लेटफॉर्म के माध्यम से अनुक्रमित किया जा सकता है। परिणामस्वरूप पढ़े जाने वाले एमएलवी एकीकरण के समूहों को परिभाषित करने के लिए मानव जीनोम के लिए मैप किए गए थे। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें </ P>

चित्र 2
चित्रा 2: एलएम-पीसीआर द्वारा वायरस-होस्ट जीनोम जंक्शनों का प्रवर्धन एकीकृत एमएलवी प्रोरस युक्त जीनोमिक डीएनए (जीडीएनए) को ट्रूएलआई और पीएसआई प्रतिबंध एंजाइम के साथ पच जाता है, और एक संगत ट्रूएलआई लिंकर के साथ ligated। नेस्टेड पीसीआर को एलटीआर और लिंकर के लिए विशिष्ट प्राइमरों का प्रयोग किया जाता है। वायरल और मानव जीनोम में ट्रू 9आई और पीएसटीआई प्रतिबंध साइटों को संकेत दिया गया है। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्र तीन
चित्रा 3: एलएम-पीसीआर एम्प्लिकंस का विश्लेषण। ( ) एलएम-पीसीआर उत्पादों (लेन +) 1% agarose जेल पर चलाए गए थे और विज़ुअलाइज़ किए गए थेनैदानिक ​​ब्रोमाइड धुंधला हो जाना कोई टेम्पलेट नमूना नकारात्मक नियंत्रण नमूना नहीं था, जहां केवल पीसीआर प्राइमरों को विज़ुअलाइज़ किया गया था (लेन -) ( बी ) जेल शुद्धि के बाद, एलएम-पीसीआर उत्पाद का आकार माइक्रोकोपिलरी वैद्युतकणसंचलन द्वारा जांच किया गया था। नमूना आकार (बीपी) और प्रतिदीप्ति तीव्रता (एफयू) क्रमशः इलेक्ट्रोफेरोग्राम के एक्स और वाई अक्ष पर दिखाए जाते हैं। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्रा 4
चित्रा 4: एपिगनेटिकली-परिभाषित नियामक क्षेत्रों में एमएलवी एकीकरण का मानचित्रण। ( ) हमने क्रमशः एचएसपीसी, ईपीपी और एमपीपी में आवर्ती एमएलवी एकीकरण साइटों के 3,498, 2,98 9 और 4,103 समूहों को परिभाषित किया है। प्रत्येक सेल की आबादी में,> 95% एमएलवी क्लस्टर एमपीवीनेटिक रूप से परिभाषित वृद्धि के साथ ओवरलैप किए गएऔर प्रमोटर ( बी , सी , और डी ) सेल-विशिष्ट एमएलवी-लक्ष्यित क्षेत्र बेहद एसिटिलेटेड थे और लक्षित जीन ( एसपीआईएनके 2 , एचबीबी और एलएजेड) की कोशिका-विशिष्ट अभिव्यक्ति के साथ जुड़े थे , जो लगभग एचएसपीसी, ईपीपी और एमपीपी में क्रमशः व्यक्त किए गए थे जीन अभिव्यक्ति के कैप विश्लेषण द्वारा) एमएलवी एकल एकीकरण छोटे सलाखों के साथ चित्रित किया गया है टीपीएम प्रति मिलियन टैग दर्शाता है ( ) पोटेटिव सेल-विशिष्ट एमएलवी-लक्षित ईएनपीपी और एनपीपी में एन्हांसमेंट्स चित्रा 4 संदर्भ 14 से अनुकूलित है। हमें क्रिएटिव कॉमन्स लाइसेंस के तहत इस आंकड़े का पुन: उपयोग करने की अनुमति प्राप्त हुई है। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

यहां, हमने एमएलवी के एकीकरण साइटों के जीनोम-विस्तृत मैपिंग के लिए एक प्रोटोकॉल का वर्णन किया है, जो एक रेट्रोवायरस है जो क्रोमेटिन क्षेत्रों को लक्षित करता है, एपिगनेटिक रूप से सक्रिय प्रमोटरों और बढ़ाने के रूप में चिह्नित है महत्वपूर्ण कदम और / या प्रोटोकॉल की सीमाओं में शामिल हैं: (i) लक्ष्य सेल की आबादी के एमएलवी पारगमन; (Ii) एलएम-पीसीआर द्वारा वायरस-होस्ट जंक्शनों का प्रवर्धन; (Iii) एकीकरण साइटों के एक उच्च अंश की पुनर्प्राप्ति। एमएलवी आधारित रेट्रोवायरल वैक्टर कोशिकाओं को विभाजित करने के लिए कुशलता से ट्रांसडस कर रहे हैं। गैर-विभाजित कोशिकाओं (जैसे पोस्ट-म्यूटोटिक न्यूरॉनल कोशिका) की पारगमन की कम क्षमता इस तकनीक की एक संभावित सीमा है। हालांकि, रिपोर्टर जीन ( जैसे ईजीएफपी) की अभिव्यक्ति के आधार पर ट्रांसडुस्ड आबादी के सेल वर्गीकरण के माध्यम से इसे दूर किया जा सकता है। एलएम-पीसीआर (150 से 500 बीपी) की तुलना में अपेक्षाकृत कम एम्पीलीकंस की पीढ़ी अनिवार्य है जिसमें वर्तमान में इस्तेमाल किए जाने वाले बड़े पैमाने पर अनुक्रमण रणनीति के साथ संगत एम्प्लिकंस की लाइब्रेरी तैयार की जा सकती है और एक व्यापक जनएमएलवी एकीकरण साइटों का व्यापक विश्लेषण। उदाहरण के तौर पर> 500 बीपी लंबे एलएम-पीसीआर उत्पादों का प्रवर्धन या तो आंशिक जीनोमिक डीएनए पाचन या ट्रू 9आई-पाचन वाले जीनोमिक टुकड़ों के अंतराल के कारण हो सकता है, जैसा कि एलएम-पीसीआर एम्प्लिकेशन्स (डेटा नहीं दिखाया गया) के शॉटगन क्लोनिंग द्वारा मूल्यांकन किया गया है। पहले मामले में, इस मुद्दे को जीनोमिक डीएनए पाचन शर्तों को और अधिक अनुकूलन करके हल किया जा सकता है, जबकि, बाद के मामले में, एमएलवी एकीकरण साइटों के सफल बड़े पैमाने पर अनुक्रमण 150 से 500 बीपी के बीच एम्पलिक्सन के जेल शुद्धि के जरिए पूरा किया जा सकता है। अंत में, जीनोमिक डीएनए में कटौती करने के लिए प्रतिबंध एंजाइमों का उपयोग तरजीही प्रवर्धन और एकीकरण साइटों की पहचान का कारण बन सकता है जो प्रतिबंध साइट के करीब हैं। एकीकरण साइटों का प्रतिशत जो Tru9I प्रतिबंध एंजाइम को पुनः प्राप्त कर सकते हैं अनुमान है ~ 50% इस प्रकार, इस तकनीक को कई प्रतिबंध एंजाइमों का उपयोग करके या यादृच्छिक डीएनए शीरी का उपयोग करके एकीकरण साइट पुनर्प्राप्ति में सुधार करने के लिए और अनुकूलित किया जा सकता हैएनओजी द्वारा एनआईजी 20 , 21

हाल ही में, हमने व्यापक रूप से प्रयुक्त इलुमिना प्लेटफॉर्म का इस्तेमाल करते हुए वायरल एकीकरण साइटों की अनुक्रमण को अनुकूलित किया है, जैसा कि इस पत्र में बताया गया है। यह अनुक्रमण दृष्टिकोण, रॉश प्लेटफार्म की तुलना में, प्रति रन की उच्च संख्या की पीढ़ी की अनुमति देता है, एक प्रयोग से प्राप्त एकीकरण साइटों की संख्या में काफी वृद्धि, इस प्रकार विश्व स्तर पर समय और लागत में कमी आती है।

सेल-विशिष्ट विनियामक क्षेत्रों की जीनोम-व्यापी पहचान के लिए चिप-सीक 6 (मोनो- और त्रि-मेथिलिकेशन के हिस्टोन एच 3 लीसिन 4) के एक से तीन हिस्टोइन संशोधनों की मैपिंग की आवश्यकता होती है ताकि सक्रिय और निष्क्रिय के बीच अंतर करने के लिए बढ़ाने और प्रमोटरों की पहचान की जा सके, और एच 3 के 27ac विनियामक तत्व) 4 , 5 , 6 और परिभाषित करने के लिए विभिन्न सेल प्रकारों की एक व्यवस्थित तुलनासीआईएस-अभिनय तत्व एक विशिष्ट सेल आबादी में विशेष रूप से सक्रिय हैं। हम बहुसंख्यक हेमटोपोएटिक प्रजनकों और उनकी प्रतिबद्ध इरिथॉइड और माईलोइड संतान 14 , भ्रूण स्टेम कोशिकाओं, न्यूरोएपिटेलियल जैसे स्टेम सेल और विभेदित केरैटिनोसाइट्स 15 के रूप में संभावित अलग पृथक लक्ष्य सेल आबादी में एमएलवी एकीकरण साइटों को मैप कर चुके हैं। रेट्रोवायरल स्कैनिंग ने प्रत्येक सेल आबादी में सेल-विशिष्ट विनियामक तत्वों की जीनोम-व्यापी परिभाषा की अनुमति दी, तुलनात्मक जीनोम-विस्तृत अध्ययनों को सख्ती से जरूरी नहीं बताया। महत्वपूर्ण बात यह है कि इस उपकरण का इस्तेमाल दुर्लभ सेल आबादी ( जैसे स्नायविक स्टेम सेल) में सक्रिय नियामक तत्वों की पहचान के लिए किया जा सकता है, जो भावी अलगाव के लिए मजबूत मार्करों की कमी है और हिस्टोन संशोधनों के चिप-सेक्-आधारित विश्लेषण द्वारा विश्लेषण नहीं किया जा सकता। इन सेल आबादी में एमएलवी एकीकरण सक्रिय नियामक क्षेत्रों का स्थायी आनुवंशिक मार्कर है, जो कि वें अनुमति देता हैइन विट्रो और विवो में अधिक प्रचलित सेल संतानों में पूर्वव्यापी पहचान एक उदाहरण के रूप में, हमने एमएलवी एकीकरण समूहों का उपयोग प्रत्याशियों और बढ़ाने के सरोगेट मार्करों के रूप में एक रेट्रोस्पेक्टिविटी की पहचान केरातिनोसाइट स्टेम सेल (केएससी) आबादी में किया था। हमने एमएसएल वेक्टर के साथ केएससीएस युक्त एक प्रारंभिक-पारितोषिक, ट्रांसकोर-व्युत्पन्न केराटिनोसाइट संस्कृति को पारित कर दिया, फिर हमने केएससी की संतान में समृद्ध बनाने के लिए 35 कोशिकाओं के लिए इन कोशिकाओं को पारित किया, इस प्रकार इस संख्या के लिए संस्कृति को बनाए रखने की उनकी क्षमता से परिभाषित किया गया। मार्ग। इस मामले में, एमएलवी एकीकरण ने स्थायी रूप से मूल ट्रांसडुल्ड केएससी आबादी 15 में नियामक क्षेत्रों को सक्रिय रूप से चिह्नित किया। भविष्य के अध्ययन का उद्देश्य जीनोम-व्यापी तरीके से सेल-विशिष्ट विनियामक तत्वों की पहचान करना है ताकि बड़ी संख्या में दुर्लभ मानव स्टेम सेल आबादी हो।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgments

यह काम यूरोपीय रिसर्च काउंसिल (ईआरसी-2010-एडजी, जीटी-स्किन), इतालवी शिक्षा मंत्रालय, विश्वविद्यालयों और अनुसंधान (एफआईआरबी-फ्युटर्स इन रिकारिका 2010-आरबीएफआर 10 ओएस 4 जी, एफआईआरबी-फ़्युटोरो इन रिकारका 2012-आरबीएफआर 126 बी 8-I_003 , एपीआईजीएन एपिगेनोमिक्स फ्लैगशिप प्रोजेक्ट), इटली के स्वास्थ्य मंत्रालय (युवा शोधकर्ताओं को 2011/2011 -2012 -2012352026 को कॉल करें) और इमेजिइन इंस्टीट्यूट फाउंडेशन (पेरिस, फ़्रांस)।

Materials

Name Company Catalog Number Comments
PBS, pH 7.4 ThermoScientific 10010031 or equivalent
Fetal Bovine Serum ThermoScientific 16000044 or equivalent
0.2 ml tubes general lab supplier
1.5 ml tubes general lab supplier
QIAGEN QIAmp DNA mini Kit  QIAGEN 51306 or equivalent
T4 DNA ligase  New England BioLabs M0202T
T4 DNA Ligase Reaction buffer New England BioLabs M0202T
Linker Plus Strand oligonucleotide general lab supplier 5’-PO4-TAGTCCCTTAAGCGGAG-3’  (Purification grade: SDS-PAGE)
Linker Minus Strand oligonucleotide general lab supplier 5’-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3’ (Purification grade: SDS-PAGE)
Tru9I Roche-Sigma-Aldrich 11464825001
SuRE/Cut Buffer M Roche-Sigma-Aldrich 11417983001
PstI  Roche-Sigma-Aldrich 10798991001
SuRE/Cut Buffer H Roche-Sigma-Aldrich 11417991001
Platinum Taq DNA Polimerase High Fidelity  Invitrogen 11304011
10 mM dNTP Mix Invitrogen 18427013 or equivalent
PCR grade water general lab supplier
96-well thermal cycler (with heated lid) general lab supplier
linker primer general lab supplier 5’-GTAATACGACTCACTATAGGGC-3’ (Purification grade: PCR grade)
MLV-3’ LTR primer general lab supplier 5’-GACTTGTGGTCTCGCTGTTCCTTGG-3’ (Purification grade: PCR grade)
linker nested primer 454 general lab supplier 5’-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer 454 general lab supplier 5’-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
linker nested primer Illumina general lab supplier 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer Illumina general lab supplier 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
Sodium Acetate Solution (3M) pH 5.2 general lab supplier
Ethanol (absolute) for molecular biology Sigma-Aldrich E7023 or equivalent
Topo TA Cloning kit (with pCR2.1-TOPO vector) Invitrogen K4500-01
QIAquick Gel Extraction kit QIAGEN 28704
Agarose Sigma-Aldrich A9539 or equivalent
Ethidium bromide  Sigma-Aldrich E1510 or equivalent
100 bp DNA ladder Invitrogen 15628019 or equivalent
6x Loading Buffer ThermoScientific R0611 or equivalent
NanoDrop 2000 UV-Vis Spectrophotometer ThermoScientific ND-2000
Nextera XT Index kit Illumina FC-131-1001 or FC-131-1002
2x KAPA HiFi Hot Start Ready Mix  KAPA Biosystems KK2601
Dynal magnetic stand for 2 ml tubes Invitrogen 12321D or equivalent
Agencourt AMPure XP 60 ml kit Beckman Coulter Genomics A63881
Tris-HCl 10 mM, pH 8.5 general lab supplier
Agilent 2200 TapeStation system Agilent Technologies G2964AA or equivalent
D1000 ScreenTape Agilent Technologies 5067-5582 or equivalent
D1000 Reagents Agilent Technologies 5067-5583 or equivalent
KAPA Library Quantification Kit for Illumina platforms (ABI Prism) KAPA Biosystems KK4835
ABI Prism 7900HT Fast Real-Time PCR System Applied Biosystems 4329003
NaOH 1.0 N, molecular biology-grade general lab supplier
HT1 (Hybridization Buffer) Illumina  Provided in the MiSeq Reagent Kit
MiSeq Reagent Kit v3 (150 cycles) Illumina MS-102-3001
MiSeq System Illumina SY-410-1003
PhiX Control v3 Illumina FC-110-3001

DOWNLOAD MATERIALS LIST

References

  1. Ernst, J., et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature. 473, (7345), 43-49 (2011).
  2. Shlyueva, D., Stampfel, G., Stark, A. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet. 15, (4), 272-286 (2014).
  3. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  4. Heintzman, N. D., et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature. 459, (7243), 108-112 (2009).
  5. Creyghton, M. P., et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A. 107, (50), 21931-21936 (2010).
  6. Hnisz, D., et al. Super-enhancers in the control of cell identity and disease. Cell. 155, (4), 934-947 (2013).
  7. Cattoglio, C., et al. High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors. Blood. 116, (25), 5507-5517 (2010).
  8. Biasco, L., et al. Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. EMBO Mol Med. 3, (2), 89-101 (2011).
  9. De Ravin, S. S., et al. Enhancers are major targets for murine leukemia virus vector integration. J Virol. 88, (8), 4504-4513 (2014).
  10. LaFave, M. C., et al. mLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Res. 42, (7), 4257-4269 (2014).
  11. Gupta, S. S., et al. Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration. J Virol. 87, (23), 12721-12736 (2013).
  12. Sharma, A., et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proc Natl Acad Sci U S A. 110, (29), 12036-12041 (2013).
  13. De Rijck, J., et al. The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites. Cell reports. 5, (4), 886-894 (2013).
  14. Romano, O., et al. Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment. Sci Rep. 6, 24724 (2016).
  15. Cavazza, A., et al. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation. Stem Cell Reports. 6, (4), 618-632 (2016).
  16. Miller, A. D., Law, M. F., Verma, I. M. Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene. Mol Cell Biol. 5, (3), 431-437 (1985).
  17. Cattoglio, C., et al. High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion. PLoS One. 5, (12), e15688 (2010).
  18. Aiuti, A., et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science. 341, (6148), 1233151 (2013).
  19. Biffi, A., et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science. 341, (6148), 1233158 (2013).
  20. Gabriel, R., et al. Comprehensive genomic access to vector integration in clinical gene therapy. Nat Med. 15, (12), 1431-1436 (2009).
  21. Gillet, N. A., et al. The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones. Blood. 117, (11), 3113-3122 (2011).
रेट्रोवायरल स्कैनिंग: सेल-विशिष्ट विनियामक क्षेत्रों को परिभाषित करने के लिए मानचित्रण एमएलवी एकीकरण साइटें
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).More

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter