A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

7.8K views

DOI:

10.3791/55919

May 28th, 2017

In This Article

Summary

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

Abstract

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.

The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

Introduction

Cell identity is determined by the expression of specific sets of genes. The role of cis-regulatory elements, such as promoters and enhancers, is crucial for the activation of cell-type specific transcriptional programs. These regulatory regions are characterized by specific chromatin features, such as peculiar histone modifications, transcription factors and co-factors binding, and chromatin accessibility, which have been widely used for their genome-wide identification in several cell types1,2,3. In particular, the genome-wide profile of acetylation of histone H3 lysine 27 (H3K27ac) is commonly used to define active promoters, enhancers and super-enhancers4,5,6.

Moloney murine leukemia virus (MLV) is a gamma-retrovirus that is widely used for gene transfer in mammalian cells. After infecting a target cell, the retroviral RNA genome is retro-transcribed in a double-stranded DNA molecule that binds viral and cellular proteins to assemble the pre-integration complex (PIC). The PIC enters the nucleus and binds the host cell chromatin. Here, the viral integrase, a key PIC component, mediates the integration of the proviral DNA into the host cell genome. mLV integration in the genomic DNA is not random, but occurs in active cis-regulatory elements, such as promoters and enhancers, in a cell-specific fashion7,8,9,10. This peculiar integration profile is mediated by a direct interaction between the mLV integrase and the cellular bromodomain and extraterminal domain (BET) proteins11,12,13. BET proteins (BRD2, BRD3, and BRD4) act as a bridge between host chromatin and mLV PIC: through their bromodomains they recognize highly acetylated cis-regulatory regions, while the extraterminal domain interacts with the mLV integrase11,12,13.

Here, we describe the retroviral scanning, a novel tool to map active cis-regulatory regions based on the integration properties of mLV. Briefly, cells are transduced with mLV-derived retroviral vector expressing the enhanced green fluorescent protein (eGFP) reporter gene. After genomic DNA extraction, the junctions between the 3' long terminal repeat (LTR) of the mLV vector and the genomic DNA are amplified by linker-mediated PCR (LM-PCR) and massively sequenced. mLV integration sites are mapped to the human genome and genomic regions highly targeted by mLV are defined as clusters of mLV integration sites.

Retroviral scanning was used to define cell-specific active regulatory elements in several human primary cells14,15. mLV clusters co-mapped with epigenetically defined promoters and enhancers, most of which harbored active histone marks, such as H3K27ac, and were cell-specific. Retroviral scanning allows the genome-wide identification of DNA regulatory elements in prospectively purified cell populations7,14, as well as in retrospectively defined cell populations, such as keratinocyte stem cells, that lack effective markers for prospective isolation15.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. MLV Transduction of Human Cells

  1. Isolate target cells and transduce them with an mLV-derived retroviral vector harboring the eGFP reporter gene and pseudotyped with Vesicular Stomatitis Virus G (VSV-G) or the amphotropic envelope glycoprotein16.
    1. Keep mock-transduced cells as a negative control for the following analyses. Since mLV-based retroviral vectors can transduce efficiently dividing cells, culture the target cell population in conditions that stimulate cell division. Transduction conditions need to be specifically optimized for each cell type under study. Cell growth and transduction conditions for human hematopoietic progenitors, T cells and epidermal cells are described in References 7, 14, 15, and 17.
  2. 48 h after transduction, resuspend 100,000 cells in 300 μL of phosphate-buffered saline (PBS) containing 2% fetal bovine serum and measure eGFP expression by flow cytometric analysis (488-nm excitation laser). Use mock-transduced cells as negative control. For optimal integration site retrieval, purify GFP+ cells by Fluorescence Activated Cell Sorting (FACS).
  3. Collect 0.5 to 5 million cells for genomic DNA preparation. A longer culture period (>7 days) is preferred to dilute the unintegrated provirus and necessary when analyzing the long-term progeny of bona fide stem cells (see Discussion Section and reference15). The cell pellets can be snap-frozen and stored at -80 °C until use.

2. Amplification of mLV integration sites by linker-mediated-PCR (LM-PCR)

  1. Preparation of genomic DNA (gDNA)
    1. Extract gDNA using a column-based DNA extraction kit and follow the protocol for cultured cells, according to the manufacturer's instructions.
  2. Restriction enzyme digestion
    1. Set up 4 restriction enzyme digestions per sample in 1.5 mL tubes. Digest 0.1 to 1 μg gDNA in each tube by adding 1 µL of Tru9I (10U) and 1 µL of Buffer M in a final volume of 10 µL. Incubate the reactions at 65 °C for 6 h or overnight.
    2. Add to each reaction 1 µL of PstI (10U), 1 µL of Buffer H and 8 µL of water. Incubate the reactions at 37 °C for 6 h or overnight. Samples can be stored at -20 °C until use.
  3. Linker ligation
    1. Prepare a 100 μM Tru9I linker stock solution in a 1.5 mL tube by mixing the linker plus strand and linker minus strand oligonucleotides at a 100 μM concentration. Put the tube in a water set at 100 °C and let it cool down at room temperature. Tru9I linker stock solution can be stored at -20 °C until use.
    2. Set up 8 linker ligation reactions in 1.5 mL tubes. For each reaction, add the following components to 10 µL of restriction enzyme digestion: 1.4 µL of 10X T4 DNA Ligase Reaction buffer, 1 µL of 10 μM linker Tru9I, 1 µL (2,000U) of T4 DNA ligase and 0.6 µL of water. Incubate at 16 °C for 3 to 6 h. Samples can be stored at -20 °C until use.
  4. First PCR
    1. Set up 48 PCR reactions (6 reactions from each ligation tube) in 0.2 mL tubes. For each PCR, add the following reagents to 2 µL of ligation reaction: 5 µL of 10X PCR buffer, 2 µL of 50 mM Magnesium Sulfate, 1 µL of 10 mM deoxynucleotide (dNTP) Mix, 1 µL of 10 μM linker primer, 1 µL of 10 μM mLV-3' LTR primer, 0.3 µL (1.5U) of Taq DNA Polymerase and 37.7 µL of water. Primer sequences are provided in Table 1.
    2. Perform PCR reaction in a thermal cycler with heated lid, as follows: 95 °C for 2 min; 25 cycles of 95 °C for 15 s, 55 °C for 30 s, 72 °C for 1 min; 72 °C for 5 min; hold at 4 °C. Samples can be stored at -20 °C until use.
  5. Second PCR
    1. Set up 48 PCR reactions (1 from each "first PCR" tube) in 0.2 mL tubes. For each PCR, add the following components to 2 µL of the first PCR reaction: 5 µL of 10X PCR buffer, 2 µL of 50 mM Magnesium Sulfate, 1 µL of 10 mM dNTP Mix, 1 µL of 10 μM linker nested primer, 1 µL of 10 μM mLV-3' LTR nested primer, 0.3 µL of Taq DNA Polymerase (1.5 U) and 37.7 µL of water. Use nested primers designed for the specific massive sequencing strategy chosen: (i) linker nested primer and mLV-3' LTR nested primer compatible with Illumina platform; (ii) linker nested primer and mLV-3' LTR nested primer compatible with Roche platform. Primer sequences are listed in Table 1.
    2. Perform PCR reaction in a thermal cycler with heated lid, as follows: 95 °C for 2 min; 25 cycles of 95 °C for 15 s, 58 °C for 30 s, 72 °C for 1 min; 72 °C for 5 min; hold at 4 °C. Samples can be stored at -20 °C until use.
    3. Pool the 48 nested PCR reactions in a 15 mL tube (final volume of ~2.4 mL). Samples can be stored at -20 °C until use.
  6. Determine the presence and the size of the LM-PCR products by agarose gel electrophoresis.
    1. Add 4 µL of Loading Buffer to 20 µL of LM-PCR products and load the sample onto a 1% agarose gel, together with a 100 bp DNA ladder. Run the gel at 5 V/cm for 30 to 60 min and visualize the PCR products by ethidium bromide staining.
    2. Run an LM-PCR reaction from the mock-transduced sample as negative control.
  7. Precipitate the amplicons by adding 0.1 volumes of sodium acetate solution (3 M; pH 5.2) and 2.5 volumes of 100% ethanol. Mix and freeze at -80 °C for 20 min.
    1. Spin at full speed in a standard microcentrifuge at 4 °C for 20 min. Discard the supernatant and wash the pellet with 70% ethanol. Spin at full speed in a standard microcentrifuge at 4 °C for 5 min.
    2. Discard the supernatant and air dry the pellet. Add 200 µL of PCR-grade water and resuspend the DNA. Samples can be stored at -20 °C until use.
  8. Add 20 μL of Loading Buffer to 100 µL of the LM-PCR products and load the sample onto a 1% agarose gel, together with a 100 bp DNA ladder.
    1. Run the gel at 5 V/cm for 30 to 60 min and cut the portion of the gel containing 150 to 500 bp-long amplicons.
    2. Purify the LM-PCR products with a column-based gel extraction kit and measure the concentration using an UV spectrophotometer.
  9. Use 1 µL of library to evaluate the length of the LM-PCR products using a bioanalyzer instrument, according to manufacturer's instructions.
  10. Shotgun cloning of amplicons
    1. Use 20 ng of the purified LM-PCR products and clone them in the pCR2.1-TOPO vector, according to the manufacturer's instructions.
    2. Perform sequencing reactions using the M13 Universal primer, followed by genomic mapping of the resulting sequences, to reveal the presence of the viral-genome junctions (including the mLV-3' LTR nested primer) in >50% of the clones to identify samples suitable for massive sequencing. Example of a viral-genome junction:
      DNA sequence analysis with color-coded genetic sequences, text representation.
      MLV-3' LTR nested primer 454 and linker nested primer 454 (Table 1) are indicated in bold and the 3' end of the viral LTR in italic. The human genomic sequence is highlighted in red text (chr10:6439408-6439509, hg19).

3. Massive Sequencing of mLV Integration Sites

NOTE: LM-PCR products can be sequenced using commercial platforms (choosing the proper nested primer pair in the second PCR reaction, see subsection 2.5.1). For sequencing by Roche GS-FLX pyrosequencing platform, refer to previous papers7,14,15. In this section, a newly-optimized protocol for Illumina sequencing platform is described.

  1. Library preparation
    1. Set up 1 indexing PCR reaction per sample in 0.2 mL tubes. For each PCR, add the following reagents to 5 µL (150-170 ng) of purified LM-PCR product: 5 µL of Index Primer 1, 5 µL of Index Primer 2, 25 µL of 2X Master Mix and 10 µL of PCR-grade water. Use a different index combination for each sample.
    2. Perform PCR reactions in a thermal cycler with heated lid, as follows: 95 °C for 3 min; 8 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s; 72 °C for 5 min; hold at 4 °C.
    3. Purify the PCR products using a solid-phase reversible immobilization (SPRI) bead isolation protocol: in new 1.5 mL tubes, add 56 µL of beads to each sample and proceed following manufacturer's instructions. Elute in 25 µL of Tris-HCl 10 mM. Libraries can be stored at -20 °C until use.
  2. Library check
    1. Use 1 µL of sample to assess library size using a bioanalyzer instrument.
    2. Use 1 µL of sample to quantify library molarity using a fluorescence-based Real time PCR assay, according to manufacturer's instructions.
  3. Library dilution and sequencing
    1. Dilute libraries to 10 nM using Tris-HCl 10 mM. For pooling libraries, transfer 5 µL of each diluted library to a new 1.5 mL tube and then dilute the pool to 4 nM in Tris-HCl 10 mM.
    2. Mix 5 µL of diluted pool with 5 µL of 0.2 N NaOH in a new 1.5 mL tube, vortex briefly, spin-down and incubate for 5 min at room temperature to denature the libraries.
    3. Put tubes on ice and add 990 µL of pre-chilled hybridization buffer (HT1). Aliquot 300 µL of denatured pool in a new 1.5 mL tube and add 300 µL of pre-chilled HT1 to obtain a 10 pM final library pool.
    4. In parallel, mix 2 µL of PhiX control library (10 nM) with 3 µL of Tris-HCl 10 mM in a 1.5 mL tube. Add 5 µL of NaOH 0.2 N, vortex briefly, spin-down and incubate for 5 min at room temperature to denature the diluted PhiX. Put tube on ice and add 990 µL of pre-chilled HT1.
    5. Aliquot 300 µL of denatured PhiX in a new 1.5 mL tube and add 300 µL of pre-chilled HT1 to obtain a 10 pM final PhiX.
    6. In a new 1.5 mL tube, mix 510 µL of denatured library pool with 90 µL of denatured PhiX library, thus obtaining a final 10 pM pool with 15% of PhiX control.
    7. Pipette these 600 µL of sample volume into the Load Sample reservoir of the thawed sequencing reagent cartridge and proceed immediately to perform a single-read 150-cycle run.
      NOTE: The critical reagents and primer sequences required for this protocol are listed in Table 1.

Access restricted. Please log in or start a trial to view this content.

Results

Workflow of the retroviral scanning procedure

The workflow of retroviral scanning procedure is schematized in Figure 1. The target cell population is purified and transduced with a mLV-derived retroviral vector expressing an eGFP reporter gene. The transgene is flanked by the two identical long terminal repeats (5' and 3' LTR), ensuring synthesis, reverse transcription and integration of the viral geno...

Access restricted. Please log in or start a trial to view this content.

Discussion

Here, we described a protocol for genome-wide mapping of the integration sites of mLV, a retrovirus that targets chromatin regions, epigenetically marked as active promoters and enhancers. Critical steps and/or limitations of the protocol include: (i) mLV transduction of the target cell population; (ii) amplification of virus-host junctions by LM-PCR; (iii) retrieval of a high fraction of integration sites. mLV-based retroviral vectors efficiently transduce dividing cells. The low efficiency of transduction of non-dividi...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by grants from the European Research Council (ERC-2010-AdG, GT-SKIN), the Italian Ministry of Education, Universities and Research (FIRB-Futuro in Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003, EPIGEN Epigenomics Flagship Project), the Italian Ministry of Health (Young researchers Call 2011 GR-2011-02352026) and the Imagine Institute Foundation (Paris, France).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
PBS, pH 7.4ThermoScientific10010031or equivalent
Fetal Bovine SerumThermoScientific16000044or equivalent
0.2 ml tubesgeneral lab supplier
1.5 ml tubesgeneral lab supplier
QIAGEN QIAmp DNA mini Kit QIAGEN51306or equivalent
T4 DNA ligase New England BioLabsM0202T
T4 DNA Ligase Reaction bufferNew England BioLabsM0202T
Linker Plus Strand oligonucleotidegeneral lab supplier5’-PO4-TAGTCCCTTAAGCGGAG-3’  (Purification grade: SDS-PAGE)
Linker Minus Strand oligonucleotidegeneral lab supplier5’-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3’ (Purification grade: SDS-PAGE)
Tru9IRoche-Sigma-Aldrich11464825001
SuRE/Cut Buffer MRoche-Sigma-Aldrich11417983001
PstI Roche-Sigma-Aldrich10798991001
SuRE/Cut Buffer HRoche-Sigma-Aldrich11417991001
Platinum Taq DNA Polimerase High Fidelity Invitrogen11304011
10 mM dNTP MixInvitrogen18427013or equivalent
PCR grade watergeneral lab supplier
96-well thermal cycler (with heated lid)general lab supplier
linker primergeneral lab supplier5’-GTAATACGACTCACTATAGGGC-3’ (Purification grade: PCR grade)
MLV-3’ LTR primergeneral lab supplier5’-GACTTGTGGTCTCGCTGTTCCTTGG-3’ (Purification grade: PCR grade)
linker nested primer 454general lab supplier5’-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer 454general lab supplier5’-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
linker nested primer Illuminageneral lab supplier5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer Illuminageneral lab supplier5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
Sodium Acetate Solution (3M) pH 5.2general lab supplier
Ethanol (absolute) for molecular biologySigma-AldrichE7023or equivalent
Topo TA Cloning kit (with pCR2.1-TOPO vector)InvitrogenK4500-01
QIAquick Gel Extraction kitQIAGEN28704
AgaroseSigma-AldrichA9539or equivalent
Ethidium bromide Sigma-AldrichE1510or equivalent
100 bp DNA ladderInvitrogen15628019or equivalent
6x Loading BufferThermoScientificR0611or equivalent
NanoDrop 2000 UV-Vis SpectrophotometerThermoScientificND-2000
Nextera XT Index kitIlluminaFC-131-1001 or FC-131-1002
2x KAPA HiFi Hot Start Ready Mix KAPA BiosystemsKK2601
Dynal magnetic stand for 2 ml tubesInvitrogen12321Dor equivalent
Agencourt AMPure XP 60 ml kitBeckman Coulter GenomicsA63881
Tris-HCl 10 mM, pH 8.5general lab supplier
Agilent 2200 TapeStation systemAgilent TechnologiesG2964AAor equivalent
D1000 ScreenTapeAgilent Technologies5067-5582or equivalent
D1000 ReagentsAgilent Technologies5067-5583or equivalent
KAPA Library Quantification Kit for Illumina platforms (ABI Prism)KAPA BiosystemsKK4835
ABI Prism 7900HT Fast Real-Time PCR SystemApplied Biosystems4329003
NaOH 1.0 N, molecular biology-gradegeneral lab supplier
HT1 (Hybridization Buffer)Illumina Provided in the MiSeq Reagent Kit
MiSeq Reagent Kit v3 (150 cycles)IlluminaMS-102-3001
MiSeq SystemIlluminaSY-410-1003
PhiX Control v3IlluminaFC-110-3001

References

  1. Ernst, J., et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature. 473 (7345), 43-49 (2011).
  2. Shlyueva, D., Stampfel, G., Stark, A. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet. 15 (4), 272-286 (2014).
  3. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518 (7539), 317-330 (2015).
  4. Heintzman, N. D., et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature. 459 (7243), 108-112 (2009).
  5. Creyghton, M. P., et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).
  6. Hnisz, D., et al. Super-enhancers in the control of cell identity and disease. Cell. 155 (4), 934-947 (2013).
  7. Cattoglio, C., et al. High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors. Blood. 116 (25), 5507-5517 (2010).
  8. Biasco, L., et al. Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. EMBO Mol Med. 3 (2), 89-101 (2011).
  9. De Ravin, S. S., et al. Enhancers are major targets for murine leukemia virus vector integration. J Virol. 88 (8), 4504-4513 (2014).
  10. LaFave, M. C., et al. mLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Res. 42 (7), 4257-4269 (2014).
  11. Gupta, S. S., et al. Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration. J Virol. 87 (23), 12721-12736 (2013).
  12. Sharma, A., et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).
  13. De Rijck, J., et al. The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites. Cell reports. 5 (4), 886-894 (2013).
  14. Romano, O., et al. Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment. Sci Rep. 6, 24724(2016).
  15. Cavazza, A., et al. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation. Stem Cell Reports. 6 (4), 618-632 (2016).
  16. Miller, A. D., Law, M. F., Verma, I. M. Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene. Mol Cell Biol. 5 (3), 431-437 (1985).
  17. Cattoglio, C., et al. High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion. PLoS One. 5 (12), e15688(2010).
  18. Aiuti, A., et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science. 341 (6148), 1233151(2013).
  19. Biffi, A., et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science. 341 (6148), 1233158(2013).
  20. Gabriel, R., et al. Comprehensive genomic access to vector integration in clinical gene therapy. Nat Med. 15 (12), 1431-1436 (2009).
  21. Gillet, N. A., et al. The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones. Blood. 117 (11), 3113-3122 (2011).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Linker-mediated PCRGenomic DNA DigestionRestriction Enzyme DigestionFlow Cytometry AnalysisAgarose Gel ElectrophoresisLibrary PreparationDeep Sequencing