Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Summary

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

Abstract

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.

The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

Introduction

Cell identity is determined by the expression of specific sets of genes. The role of cis-regulatory elements, such as promoters and enhancers, is crucial for the activation of cell-type specific transcriptional programs. These regulatory regions are characterized by specific chromatin features, such as peculiar histone modifications, transcription factors and co-factors binding, and chromatin accessibility, which have been widely used for their genome-wide identification in several cell types^1,2,3. In particular, the genome-wide profile of acetylation of histone H3 lysine 27 ....

Protocol

1. MLV Transduction of Human Cells

1. Isolate target cells and transduce them with an mLV-derived retroviral vector harboring the eGFP reporter gene and pseudotyped with Vesicular Stomatitis Virus G (VSV-G) or the amphotropic envelope glycoprotein¹⁶.
   1. Keep mock-transduced cells as a negative control for the following analyses. Since mLV-based retroviral vectors can transduce efficiently dividing cells, culture the target cell population in conditions that stimulate cell division. Transduction conditions need to be specifically optimized for each cell type under study. Cell growth and transduction conditions ....

Results

Workflow of the retroviral scanning procedure

The workflow of retroviral scanning procedure is schematized in Figure 1. The target cell population is purified and transduced with a mLV-derived retroviral vector expressing an eGFP reporter gene. The transgene is flanked by the two identical long terminal repeats (5' and 3' LTR), ensuring synthesis, reverse transcription and integration of the viral geno.......

Discussion

Here, we described a protocol for genome-wide mapping of the integration sites of mLV, a retrovirus that targets chromatin regions, epigenetically marked as active promoters and enhancers. Critical steps and/or limitations of the protocol include: (i) mLV transduction of the target cell population; (ii) amplification of virus-host junctions by LM-PCR; (iii) retrieval of a high fraction of integration sites. mLV-based retroviral vectors efficiently transduce dividing cells. The low efficiency of transduction of non-dividi.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
PBS, pH 7.4	ThermoScientific	10010031	or equivalent
Fetal Bovine Serum	ThermoScientific	16000044	or equivalent
0.2 ml tubes	general lab supplier
1.5 ml tubes	general lab supplier
QIAGEN QIAmp DNA mini Kit	QIAGEN	51306	or equivalent
T4 DNA ligase	New England BioLabs	M0202T
T4 DNA Ligase Reaction buffer	New England BioLabs	M0202T
Linker Plus Strand oligonucleotide	general lab supplier		5’-PO4-TAGTCCCTTAAGCGGAG-3’  (Purification grade: SDS-PAGE)
Linker Minus Strand oligonucleotide	general lab supplier		5’-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3’ (Purification grade: SDS-PAGE)
Tru9I	Roche-Sigma-Aldrich	11464825001
SuRE/Cut Buffer M	Roche-Sigma-Aldrich	11417983001
PstI	Roche-Sigma-Aldrich	10798991001
SuRE/Cut Buffer H	Roche-Sigma-Aldrich	11417991001
Platinum Taq DNA Polimerase High Fidelity	Invitrogen	11304011
10 mM dNTP Mix	Invitrogen	18427013	or equivalent
PCR grade water	general lab supplier
96-well thermal cycler (with heated lid)	general lab supplier
linker primer	general lab supplier		5’-GTAATACGACTCACTATAGGGC-3’ (Purification grade: PCR grade)
MLV-3’ LTR primer	general lab supplier		5’-GACTTGTGGTCTCGCTGTTCCTTGG-3’ (Purification grade: PCR grade)
linker nested primer 454	general lab supplier		5’-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer 454	general lab supplier		5’-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
linker nested primer Illumina	general lab supplier		5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer Illumina	general lab supplier		5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
Sodium Acetate Solution (3M) pH 5.2	general lab supplier
Ethanol (absolute) for molecular biology	Sigma-Aldrich	E7023	or equivalent
Topo TA Cloning kit (with pCR2.1-TOPO vector)	Invitrogen	K4500-01
QIAquick Gel Extraction kit	QIAGEN	28704
Agarose	Sigma-Aldrich	A9539	or equivalent
Ethidium bromide	Sigma-Aldrich	E1510	or equivalent
100 bp DNA ladder	Invitrogen	15628019	or equivalent
6x Loading Buffer	ThermoScientific	R0611	or equivalent
NanoDrop 2000 UV-Vis Spectrophotometer	ThermoScientific	ND-2000
Nextera XT Index kit	Illumina	FC-131-1001 or FC-131-1002
2x KAPA HiFi Hot Start Ready Mix	KAPA Biosystems	KK2601
Dynal magnetic stand for 2 ml tubes	Invitrogen	12321D	or equivalent
Agencourt AMPure XP 60 ml kit	Beckman Coulter Genomics	A63881
Tris-HCl 10 mM, pH 8.5	general lab supplier
Agilent 2200 TapeStation system	Agilent Technologies	G2964AA	or equivalent
D1000 ScreenTape	Agilent Technologies	5067-5582	or equivalent
D1000 Reagents	Agilent Technologies	5067-5583	or equivalent
KAPA Library Quantification Kit for Illumina platforms (ABI Prism)	KAPA Biosystems	KK4835
ABI Prism 7900HT Fast Real-Time PCR System	Applied Biosystems	4329003
NaOH 1.0 N, molecular biology-grade	general lab supplier
HT1 (Hybridization Buffer)	Illumina	Provided in the MiSeq Reagent Kit
MiSeq Reagent Kit v3 (150 cycles)	Illumina	MS-102-3001
MiSeq System	Illumina	SY-410-1003
PhiX Control v3	Illumina	FC-110-3001