Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.
Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.
The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.
Cell identity is determined by the expression of specific sets of genes. The role of cis-regulatory elements, such as promoters and enhancers, is crucial for the activation of cell-type specific transcriptional programs. These regulatory regions are characterized by specific chromatin features, such as peculiar histone modifications, transcription factors and co-factors binding, and chromatin accessibility, which have been widely used for their genome-wide identification in several cell types1,2,3. In particular, the genome-wide profile of acetylation of histone H3 lysine 27 (H3K27ac) is commonly used to define active promoters, enhancers and super-enhancers4,5,6.
Moloney murine leukemia virus (MLV) is a gamma-retrovirus that is widely used for gene transfer in mammalian cells. After infecting a target cell, the retroviral RNA genome is retro-transcribed in a double-stranded DNA molecule that binds viral and cellular proteins to assemble the pre-integration complex (PIC). The PIC enters the nucleus and binds the host cell chromatin. Here, the viral integrase, a key PIC component, mediates the integration of the proviral DNA into the host cell genome. mLV integration in the genomic DNA is not random, but occurs in active cis-regulatory elements, such as promoters and enhancers, in a cell-specific fashion7,8,9,10. This peculiar integration profile is mediated by a direct interaction between the mLV integrase and the cellular bromodomain and extraterminal domain (BET) proteins11,12,13. BET proteins (BRD2, BRD3, and BRD4) act as a bridge between host chromatin and mLV PIC: through their bromodomains they recognize highly acetylated cis-regulatory regions, while the extraterminal domain interacts with the mLV integrase11,12,13.
Here, we describe the retroviral scanning, a novel tool to map active cis-regulatory regions based on the integration properties of mLV. Briefly, cells are transduced with mLV-derived retroviral vector expressing the enhanced green fluorescent protein (eGFP) reporter gene. After genomic DNA extraction, the junctions between the 3' long terminal repeat (LTR) of the mLV vector and the genomic DNA are amplified by linker-mediated PCR (LM-PCR) and massively sequenced. mLV integration sites are mapped to the human genome and genomic regions highly targeted by mLV are defined as clusters of mLV integration sites.
Retroviral scanning was used to define cell-specific active regulatory elements in several human primary cells14,15. mLV clusters co-mapped with epigenetically defined promoters and enhancers, most of which harbored active histone marks, such as H3K27ac, and were cell-specific. Retroviral scanning allows the genome-wide identification of DNA regulatory elements in prospectively purified cell populations7,14, as well as in retrospectively defined cell populations, such as keratinocyte stem cells, that lack effective markers for prospective isolation15.
Access restricted. Please log in or start a trial to view this content.
1. MLV Transduction of Human Cells
2. Amplification of mLV integration sites by linker-mediated-PCR (LM-PCR)

3. Massive Sequencing of mLV Integration Sites
NOTE: LM-PCR products can be sequenced using commercial platforms (choosing the proper nested primer pair in the second PCR reaction, see subsection 2.5.1). For sequencing by Roche GS-FLX pyrosequencing platform, refer to previous papers7,14,15. In this section, a newly-optimized protocol for Illumina sequencing platform is described.
Access restricted. Please log in or start a trial to view this content.
Workflow of the retroviral scanning procedure
The workflow of retroviral scanning procedure is schematized in Figure 1. The target cell population is purified and transduced with a mLV-derived retroviral vector expressing an eGFP reporter gene. The transgene is flanked by the two identical long terminal repeats (5' and 3' LTR), ensuring synthesis, reverse transcription and integration of the viral geno...
Access restricted. Please log in or start a trial to view this content.
Here, we described a protocol for genome-wide mapping of the integration sites of mLV, a retrovirus that targets chromatin regions, epigenetically marked as active promoters and enhancers. Critical steps and/or limitations of the protocol include: (i) mLV transduction of the target cell population; (ii) amplification of virus-host junctions by LM-PCR; (iii) retrieval of a high fraction of integration sites. mLV-based retroviral vectors efficiently transduce dividing cells. The low efficiency of transduction of non-dividi...
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
This work was supported by grants from the European Research Council (ERC-2010-AdG, GT-SKIN), the Italian Ministry of Education, Universities and Research (FIRB-Futuro in Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003, EPIGEN Epigenomics Flagship Project), the Italian Ministry of Health (Young researchers Call 2011 GR-2011-02352026) and the Imagine Institute Foundation (Paris, France).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| PBS, pH 7.4 | ThermoScientific | 10010031 | or equivalent |
| Fetal Bovine Serum | ThermoScientific | 16000044 | or equivalent |
| 0.2 ml tubes | general lab supplier | ||
| 1.5 ml tubes | general lab supplier | ||
| QIAGEN QIAmp DNA mini Kit | QIAGEN | 51306 | or equivalent |
| T4 DNA ligase | New England BioLabs | M0202T | |
| T4 DNA Ligase Reaction buffer | New England BioLabs | M0202T | |
| Linker Plus Strand oligonucleotide | general lab supplier | 5’-PO4-TAGTCCCTTAAGCGGAG-3’ (Purification grade: SDS-PAGE) | |
| Linker Minus Strand oligonucleotide | general lab supplier | 5’-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3’ (Purification grade: SDS-PAGE) | |
| Tru9I | Roche-Sigma-Aldrich | 11464825001 | |
| SuRE/Cut Buffer M | Roche-Sigma-Aldrich | 11417983001 | |
| PstI | Roche-Sigma-Aldrich | 10798991001 | |
| SuRE/Cut Buffer H | Roche-Sigma-Aldrich | 11417991001 | |
| Platinum Taq DNA Polimerase High Fidelity | Invitrogen | 11304011 | |
| 10 mM dNTP Mix | Invitrogen | 18427013 | or equivalent |
| PCR grade water | general lab supplier | ||
| 96-well thermal cycler (with heated lid) | general lab supplier | ||
| linker primer | general lab supplier | 5’-GTAATACGACTCACTATAGGGC-3’ (Purification grade: PCR grade) | |
| MLV-3’ LTR primer | general lab supplier | 5’-GACTTGTGGTCTCGCTGTTCCTTGG-3’ (Purification grade: PCR grade) | |
| linker nested primer 454 | general lab supplier | 5’-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE) | |
| MLV-3’ LTR nested primer 454 | general lab supplier | 5’-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE) | |
| linker nested primer Illumina | general lab supplier | 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE) | |
| MLV-3’ LTR nested primer Illumina | general lab supplier | 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE) | |
| Sodium Acetate Solution (3M) pH 5.2 | general lab supplier | ||
| Ethanol (absolute) for molecular biology | Sigma-Aldrich | E7023 | or equivalent |
| Topo TA Cloning kit (with pCR2.1-TOPO vector) | Invitrogen | K4500-01 | |
| QIAquick Gel Extraction kit | QIAGEN | 28704 | |
| Agarose | Sigma-Aldrich | A9539 | or equivalent |
| Ethidium bromide | Sigma-Aldrich | E1510 | or equivalent |
| 100 bp DNA ladder | Invitrogen | 15628019 | or equivalent |
| 6x Loading Buffer | ThermoScientific | R0611 | or equivalent |
| NanoDrop 2000 UV-Vis Spectrophotometer | ThermoScientific | ND-2000 | |
| Nextera XT Index kit | Illumina | FC-131-1001 or FC-131-1002 | |
| 2x KAPA HiFi Hot Start Ready Mix | KAPA Biosystems | KK2601 | |
| Dynal magnetic stand for 2 ml tubes | Invitrogen | 12321D | or equivalent |
| Agencourt AMPure XP 60 ml kit | Beckman Coulter Genomics | A63881 | |
| Tris-HCl 10 mM, pH 8.5 | general lab supplier | ||
| Agilent 2200 TapeStation system | Agilent Technologies | G2964AA | or equivalent |
| D1000 ScreenTape | Agilent Technologies | 5067-5582 | or equivalent |
| D1000 Reagents | Agilent Technologies | 5067-5583 | or equivalent |
| KAPA Library Quantification Kit for Illumina platforms (ABI Prism) | KAPA Biosystems | KK4835 | |
| ABI Prism 7900HT Fast Real-Time PCR System | Applied Biosystems | 4329003 | |
| NaOH 1.0 N, molecular biology-grade | general lab supplier | ||
| HT1 (Hybridization Buffer) | Illumina | Provided in the MiSeq Reagent Kit | |
| MiSeq Reagent Kit v3 (150 cycles) | Illumina | MS-102-3001 | |
| MiSeq System | Illumina | SY-410-1003 | |
| PhiX Control v3 | Illumina | FC-110-3001 |
Access restricted. Please log in or start a trial to view this content.