Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Escaneo Retroviral: Mapeo de sitios de integración MLV para definir regiones reguladoras específicas de células

doi: 10.3791/55919 Published: May 28, 2017

Summary

Aquí, describimos un protocolo para el genoma de la cartografía de los sitios de integración Moloney murino leucemia virus basados ​​en retrovirus vectores en células humanas.

Abstract

Los vectores retrovirales basados ​​en virus de la leucemia murina de Moloney (MLV) se integran predominantemente en potenciadores y promotores acetilados. Por esta razón, los sitios de integración mLV pueden usarse como marcadores funcionales de elementos reguladores activos. Aquí, presentamos una herramienta de exploración retroviral, que permite la identificación a nivel genoma de potenciadores y promotores específicos de células. En resumen, la población de células diana se transduce con un vector derivado de mLV y el ADN genómico se digiere con una enzima de restricción de corte frecuente. Después de la ligación de fragmentos genómicos con un enlazador de ADN compatible, la reacción en cadena de polimerasa mediada por enlazador (LM-PCR) permite la amplificación de las uniones genómicas virus-huésped. La secuenciación masiva de los amplicones se utiliza para definir el perfil de integración de mLV en todo el genoma. Finalmente, se definen grupos de integraciones recurrentes para identificar regiones reguladoras específicas de células, responsables de la activación de programas transcripcionales específicos de tipo celular.

por ejemplo, células madre somáticas) que carecen de marcadores robustos para el aislamiento prospectivo.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La identidad celular se determina mediante la expresión de conjuntos específicos de genes. El papel de los elementos reguladores cis, tales como promotores y potenciadores, es crucial para la activación de programas de transcripción específicos de tipo celular. Estas regiones reguladoras se caracterizan por características específicas de la cromatina, tales como modificaciones peculiares de las histonas, factores de transcripción y unión de co-factores, y accesibilidad a la cromatina, que han sido ampliamente utilizados para su identificación genómica en varios tipos de células 1 , 2 , 3 . En particular, el perfil genómico de la acetilación de histona H3 lisina 27 (H3K27ac) se utiliza comúnmente para definir promotores activos, potenciadores y super-potenciadores 4 , 5 , 6 .

El virus de la leucemia murina de Moloney (MLV) es un gamma-retrovirus que es ampliamente utilizado para el genTransferencia en células de mamíferos. Después de infectar una célula diana, el genoma del ARN retroviral se retrotranscribe en una molécula de ADN de doble cadena que se une a las proteínas víricas y celulares para ensamblar el complejo de preinteligencia (PIC). El PIC entra en el núcleo y se une a la cromatina de la célula huésped. En este caso, la integrasa viral, un componente clave de PIC, media la integración del ADN proviral en el genoma de la célula huésped. MlV integración en el ADN genómico no es al azar, pero se produce en elementos activos cis-reguladores, tales como promotores y potenciadores, en una célula de forma específica 7 , 8 , 9 , 10 . Este peculiar perfil de integración está mediada por una interacción directa entre la integrasa mLV y las proteínas celulares de bromodominio y dominio extraterminal (BET) 11 , 12 , 13 . Las proteínas BET (BRD2, BRD3 yBRD4) actúan como puente entre la cromatina del huésped y el PIC mlV: a través de sus bromodominios reconocen regiones cis-reguladoras altamente acetiladas, mientras que el dominio extraterminal interactúa con la integrasa mLV 11 , 12 , 13 .

Aquí, describimos el escaneo retroviral, una herramienta novedosa para mapear regiones reguladoras cis-activas basadas en las propiedades de integración de mLV. Brevemente, las células se transducen con el vector retroviral derivado de mlV que expresa el gen indicador de proteína fluorescente verde (eGFP) mejorada. Después de la extracción del ADN genómico, las uniones entre la repetición terminal larga (LTR) de 3 'del vector mlV y el ADN genómico se amplifican mediante PCR (LM-PCR) mediada por enlazadores y se secuencian masivamente. MlV sitios de integración se asignan al genoma humano y las regiones genómicas altamente objetivo de mLV se definen como grupos de mlV sitios de integración.

Escaneo retroviralNing se utilizó para definir la célula específica de los elementos reguladores activos en varias células primarias humanas [ 14 , 15] . MlV clusters co-mapeados con epigenéticamente definidos promotores y potenciadores, la mayoría de los cuales albergan histonas marcas activas, como H3K27ac, y fueron específicos de células. El escaneo retroviral permite la identificación en todo el genoma de los elementos reguladores del ADN en poblaciones de células purificadas prospectivamente 7,14 , así como en poblaciones celulares definidas de forma retrospectiva, como las células madre de queratinocitos, que carecen de marcadores efectivos para el aislamiento prospectivo 15 .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Transducción MLV de células humanas

  1. Aislar las células diana y transducirlos con un vector retroviral derivado de mlV que alberga el gen reportero eGFP y pseudotipado con el virus de la estomatitis vesicular G (VSV-G) o la glicoproteína de la envoltura anfotrópica 16 .
    1. Mantenga las células simuladas transducidas como un control negativo para los siguientes análisis. Dado que los vectores retrovirales basados ​​en mLV pueden transducir células que se dividen eficazmente, cultivan la población de células diana en condiciones que estimulan la división celular. Las condiciones de transducción necesitan ser optimizadas específicamente para cada tipo de célula bajo estudio. Las condiciones de crecimiento celular y de transducción para progenitores hematopoyéticos humanos, células T y células epidérmicas se describen en las Referencias 7, 14, 15 y 17.
  2. 48 h después de la transducción, resuspender 100.000 células en 300 μl de solución salina tamponada con fosfato (PBS) que contiene 2% de suero bovino fetal y medir la expresión de eGFP por fAnálisis de baja citometría (láser de excitación de 488 nm). Utilizar células transducidas simulando como control negativo. Para una recuperación óptima del sitio de integración, purifique las células GFP + mediante Clasificación Celular Activada por Fluorescencia (FACS).
  3. Recoger 0,5 a 5 millones de células para la preparación del ADN genómico. Se prefiere un período de cultivo más largo (> 7 días) para diluir el provirus no integrado y es necesario cuando se analiza la progenie a largo plazo de células madre bona fide (véase la sección de discusión y la referencia 15 ). Los gránulos de células pueden congelarse instantáneamente y almacenarse a -80 ° C hasta su uso.

2. Amplificación de los sitios de integración de mLV mediante PCR-PCR (LM-PCR)

  1. Preparación de ADN genómico (gDNA)
    1. Extraer gDNA utilizando un kit de extracción de ADN a base de columna y seguir el protocolo para las células cultivadas, de acuerdo con las instrucciones del fabricante.
  2. Enzima de restricción digestien
    1. Preparar 4 digestiones de enzimas de restricción por muestra en tubos de 1,5 mL. Digerir 0,1 a 1 μg de gDNA en cada tubo añadiendo 1 μl de Tru9I (10 U) y 1 μl de Tampón M en un volumen final de 10 μl. Incubar las reacciones a 65 ° C durante 6 h o durante la noche.
    2. Añadir a cada reacción 1 μl de PstI (10 U), 1 μl de Tampón H y 8 μl de agua. Incubar las reacciones a 37 ° C durante 6 h o durante la noche. Las muestras pueden almacenarse a -20 ° C hasta su uso.
  3. Enlazador ligadura
    1. Preparar una solución madre Tru9I 100 μM de enlace en un tubo de 1,5 ml mezclando los oligonucleótidos de hebra más ligando y ligador menos una concentración de 100 μM. Poner el tubo en un conjunto de agua a 100 ° C y dejar enfriar a temperatura ambiente. La solución madre de ligante Tru9I se puede almacenar a -20 ° C hasta su uso.
    2. Establecer 8 reacciones de ligadura de ligadores en tubos de 1,5 mL. Para cada reacción, añada el siguiente componenteS a 10 μl de digestión con enzimas de restricción: 1,4 μl de tampón de reacción de 10 μg de ADN-ligasa T4, 1 μl de Tru9I de ligante 10 μM, 1 μL (2.000 U) de T4 DNA ligasa y 0,6 μl de agua. Incubar a 16 ° C durante 3 a 6 h. Las muestras pueden almacenarse a -20 ° C hasta su uso.
  4. Primera PCR
    1. Establecer 48 reacciones de PCR (6 reacciones de cada tubo de ligadura) en tubos de 0,2 ml. Para cada PCR, añada los siguientes reactivos a 2 μl de reacción de ligadura: 5 μl de tampón de PCR 10X, 2 μl de sulfato de magnesio 50 mM, 1 μl de desoxinucleótido 10 mM (dNTP), 1 μl de cebador 10 μM de ligante, Μl de cebador LTR mLV-3 '10 μM, 0,3 μl (1,5 U) de Taq DNA Polimerasa y 37,7 μl de agua. Las secuencias de cebador se proporcionan en la Tabla 1.
    2. Realizar la reacción de PCR en un termociclador con tapa calentada, como sigue: 95 ° C durante 2 min; 25 ciclos de 95 ° C durante 15 s, 55 ° C durante 30 s, 72 ° C durante 1 min; 72 °; C durante 5 min; Mantener a 4 ° C. Las muestras pueden almacenarse a -20 ° C hasta su uso.
  5. Segunda PCR
    1. Establecer 48 reacciones de PCR (1 de cada "primer tubo de PCR") en tubos de 0,2 ml. Para cada PCR, añada los siguientes componentes a 2 μL de la primera reacción de PCR: 5 μl de tampón de PCR 10X, 2 μL de Sulfato de Magnesio 50 mM, 1 μl de Mezcla de dNTP 10 mM, 1 μl de cebador anidado de ligante 10 μM, Μl de cebador anidado de 10 μM mLV-3 'LTR, 0,3 μL de Taq DNA Polimerasa (1,5 U) y 37,7 μl de agua. Utilizar cebadores anidados diseñados para la estrategia de secuenciación masiva específica elegida: (i) cebador anidado de enlace y cebador anidado de mLV-3 'LTR compatible con la plataforma Illumina; (Ii) cebador anidado de enlace y cebador anidado de LTR mLV-3 'compatible con la plataforma de Roche. Las secuencias de cebadores se enumeran en la Tabla 1 .
    2. Realizar la reacción de PCR en un termociclador con tapa calentada, como sigue: 95 ° C durante 2 min; 25Ciclos de 95 ° C durante 15 s, 58 ° C durante 30 s, 72 ° C durante 1 min; 72ºC durante 5 min; Mantener a 4 ° C. Las muestras pueden almacenarse a -20 ° C hasta su uso.
    3. Agrupe las 48 reacciones de PCR anidadas en un tubo de 15 ml (volumen final de ~ 2,4 ml). Las muestras pueden almacenarse a -20 ° C hasta su uso.
  6. Determinar la presencia y el tamaño de los productos de LM-PCR mediante electroforesis en gel de agarosa.
    1. Añadir 4 μl de tampón de carga a 20 μL de productos LM-PCR y cargar la muestra en un gel de agarosa al 1%, junto con una escala de ADN de 100 bp. Hacer funcionar el gel a 5 V / cm durante 30 a 60 minutos y visualizar los productos de PCR mediante tinción con bromuro de etidio.
    2. Ejecutar una reacción LM-PCR de la muestra de transducción simulada como control negativo.
  7. Se precipitaron los amplicones añadiendo 0,1 volúmenes de solución de acetato de sodio (3 M, pH 5,2) y 2,5 volúmenes de etanol al 100%. Mezclar y congelar a -80 ° C durante 20 min.
    1. Giro en fuLl en una microcentrífuga estándar a 4 ° C durante 20 min. Desechar el sobrenadante y lavar el sedimento con etanol al 70%. Girar a toda velocidad en una microcentrífuga estándar a 4 ° C durante 5 min.
    2. Desechar el sobrenadante y secar al aire el pellet. Añadir 200 μl de agua de grado PCR y resuspender el ADN. Las muestras pueden almacenarse a -20 ° C hasta su uso.
  8. Añadir 20 μl de tampón de carga a 100 μL de los productos de LM-PCR y cargar la muestra en un gel de agarosa al 1%, junto con una escalera de ADN de 100 bp.
    1. Se hace funcionar el gel a 5 V / cm durante 30 a 60 minutos y se corta la porción del gel que contiene 150 a 500 bp de largo amplicones.
    2. Purificar los productos LM-PCR con un kit de extracción de gel a base de columna y medir la concentración usando un espectrofotómetro UV.
  9. Utilice 1 μl de biblioteca para evaluar la longitud de los productos de LM-PCR usando un instrumento de bioanalizador, de acuerdo con las instrucciones del fabricante.
  10. Utilizar 20 ng de los productos LM-PCR purificados y clonarlos en el vector pCR2.1-TOPO, de acuerdo con las instrucciones del fabricante.
  11. Realizar reacciones de secuenciación utilizando el cebador universal M13, seguido de la cartografía genómica de las secuencias resultantes, para revelar la presencia de las uniones del genoma viral (incluido el cebador anidado de mLV-3 'LTR) en> 50% de los clones para identificar muestras adecuadas Para la secuenciación masiva. Ejemplo de una unión viral-genoma:
    Unión
    MLV-3 'LTR iniciador anidado 454 y el iniciador anidado de ligador 454 ( Tabla 1 ) se indican en negrita y el extremo 3' del LTR viral en cursiva. La secuencia genómica humana se destaca en texto rojo (chr10: 6439408 - 6439509, hg19).

3. Secuenciación masiva de los sitios de integración de mLV

NOTA: Producto LM-PCRLos procesos pueden ser secuenciados usando plataformas comerciales (eligiendo el par anidado apropiado en la segunda reacción PCR, véase la subsección 2.5.1). Para la secuenciación por Roche GS-FLX pyrosequencing plataforma, consulte a los documentos anteriores 7 , 14 , 15 . En esta sección, se describe un protocolo recién optimizado para la plataforma de secuenciación de Illumina.

  1. Preparación de la biblioteca
    1. Establecer una reacción de PCR de indexación por muestra en tubos de 0,2 ml. Para cada PCR, a~nadir los siguientes reactivos a 5 μl (150-170 ng) de producto LM-PCR purificado: 5 μl de Primer Indice 1, 5 μl de Indice Primer 2, 25 μL de 2X Master Mix y 10 μL de PCR- Grado de agua. Utilice una combinación de índice diferente para cada muestra.
    2. Realizar reacciones de PCR en un termociclador con tapa calentada, como sigue: 95 ° C durante 3 min; 8 ciclos de 95 ° C durante 30 s, 55 ° C durante 30 s, 72 ° C durante 30 s; 72 ° C durante 5 men; Mantener a 4 ° C.
    3. Purificar los productos de PCR usando un protocolo de aislamiento de perlas de inmovilización reversible en fase sólida (SPRI): en tubos nuevos de 1,5 ml, agregar 56 μL de perlas a cada muestra y proceder siguiendo las instrucciones del fabricante. Eluir en 25 μl de Tris-HCl 10 mM. Las bibliotecas pueden almacenarse a -20 ° C hasta su uso.
  2. Comprobación de la biblioteca
    1. Utilice 1 μl de muestra para evaluar el tamaño de la biblioteca utilizando un instrumento de bioanalizador.
    2. Utilizar 1 μl de muestra para cuantificar la molaridad de la biblioteca usando un ensayo de PCR en tiempo real basado en fluorescencia, de acuerdo con las instrucciones del fabricante.
  3. Dilución y secuenciación de la biblioteca
    1. Diluir las bibliotecas hasta 10 nM usando Tris-HCl 10 mM. Para la agrupación de las bibliotecas, transferir 5 μ l de cada biblioteca diluida a un nuevo tubo de 1,5 ml y luego diluir la piscina a 4 nM en Tris-HCl 10 mM.
    2. Mezclar 5 μL de la mezcla diluida con 5 μl de NaOH 0,2 N en un nuevo 1,5 mL, vórtice brevemente, centrifugue e incube durante 5 min a temperatura ambiente para desnaturalizar las bibliotecas.
    3. Ponga los tubos en hielo y agregue 990 μl de tampón de hibridación pre-enfriado (HT1). Alícuota de 300 μ l de piscina desnaturalizada en un nuevo tubo de 1,5 ml y añadir 300 μ l de pre-refrigerados HT1 para obtener una biblioteca final de 10 pM.
    4. En paralelo, mezclar 2 μl de biblioteca de control PhiX (10 nM) con 3 μl de Tris-HCl 10 mM en un tubo de 1,5 ml. Añadir 5 μL de NaOH 0,2 N, agitar brevemente vórtice, centrifugar e incubar durante 5 min a temperatura ambiente para desnaturalizar la PhiX diluida. Coloque el tubo sobre hielo y añada 990 μl de HT1 previamente enfriado.
    5. Alícuote 300 μl de PhiX desnaturalizada en un nuevo tubo de 1,5 ml y añada 300 μl de HT1 previamente enfriado para obtener una PhiX final de 10 μM.
    6. En un nuevo tubo de 1,5 ml, mezclar 510 μL de la piscina de la biblioteca desnaturalizada con 90 μL de la biblioteca PhiX desnaturalizada, obteniendo así un pool final de 10 μM con un 15% de control PhiX.
    7. Pipetear estos 600 μl de muestraDe volumen en el depósito de carga de muestra del cartucho de reactivo de secuenciación descongelado y proceda inmediatamente a realizar un ciclo de 150 ciclos.
      NOTA: Los reactivos críticos y secuencias de cebadores requeridos para este protocolo se enumeran en la Tabla 1 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Flujo de trabajo del procedimiento de exploración retroviral

El flujo de trabajo del procedimiento de exploración retroviral se esquematiza en la Figura 1 . La población de células diana se purifica y transduce con un vector retroviral derivado de mlV que expresa un gen informador eGFP. El transgén está flanqueado por las dos repeticiones terminales largas idénticas (5 'y 3' LTR), asegurando la síntesis, la transcripción inversa y la integración del genoma viral en el ADN del huésped. La eficiencia de transducción se evalúa mediante análisis FACS de expresión de eGFP. La población celular que contiene una alta proporción (> 30%) de células transducidas con mLV se amplifica y posteriormente se somete a lisis para extraer el ADN genómico que contiene las cassettes virales mLV integradas. El DNA genómico se digiere y se liga con un enlazador compatible y las uniones entre las LTRs 3 'virales y el genoma del huésped se amplifican mediante LM-PCR. VirUs-host genoma junctions son entonces masivamente secuenciado utilizando plataformas Roche o Illumina. Finalmente, los sitios de integración de mLV se mapean al genoma humano para definir grupos genómicos de sitios de inserción recurrentes.

Amplificación de sitios de integración de mLV por LM-PCR

La LM-PCR está esquematizada en la Figura 2 . El ADN genómico se extrae de las células transformadas con mLV y se digiere con la enzima de restricción Tru9I, que corta frecuentemente el genoma humano, generando fragmentos con una longitud media de 70 pb. Se utiliza una segunda enzima de restricción (PstI) para prevenir la amplificación de fragmentos LTR internos 5 'integrados y no integrados. Un ligador de doble hebra Tru9I se liga a continuación a los fragmentos genómicos y se realiza LM - PCR con cebadores específicos para el enlazador y El LTR 3 'para amplificar las uniones del genoma del virus-huésped. La PCR anidada se puede realizar usando priCompatibles con las plataformas de secuenciación Roche o Illumina.

Análisis de los amplicones de la unión del genoma del virus-huésped

En el experimento representado en la Figura 3 , hemos purificado CD34 - CD13 + progenitor / precursores mieloides (MPP) y transduced ellos con un retrovirus derivado de mLV que expresa el gen reportero eGFP. Más del 60% de las células MPP expresaron eGFP 48 h después de la transducción (datos no mostrados). 15 días después de la transducción, se recogieron las células, gDNA extraído y amplificado el virus de las uniones del genoma del huésped, como se ha descrito anteriormente. Se cargó una alícuota de los productos de LM-PCR agrupados en un gel de agarosa al 1% para verificar la presencia y el tamaño de los amplicones. Visualizamos con éxito un frotis de ADN correspondiente a los productos LM-PCR de diferentes tamaños, que van desde 150 a 500 pb ( Figura 3A ). Los amplicones fueron entoncesSe concentró por precipitación de ADN y se cargó en un gel de agarosa al 1%. Los productos de LM-PCR se purificaron en gel y se pusieron en funcionamiento en un sistema de bioanalizadores, confirmando los tamaños de amplicón esperados (entre 150 y 500 pb, Figura 3B ).

Mapeo de las integraciones de mLV en regiones reguladoras activas y específicas de células

En el experimento informado en la Figura 4 , las células progenitoras hematopoyéticas (HSPC), los progenitores / precursores eritroides (EPP) y los progenitores / precursores mieloides (MPP) se transdujeron con un vector retroviral derivado de mLV. Estos resultados fueron obtenidos de procesamiento y secuenciación de muestras derivadas de diferentes tipos de células por separado, para evitar la posible contaminación / colisiones [ 18 , 19] . Las lecturas de secuencias crudas generadas por la secuenciación masiva fueron procesadas por una bioinformática automatizadaPara eliminar las secuencias viral y enlazadora. A continuación, secuencias únicas de al menos 20 pb se mapearon en el genoma humano utilizando Blat 17 . Las alineaciones crudas se filtraron requiriendo que el partido comenzara dentro de los primeros 3 nucleótidos, coincidencias unívocas y un mínimo de 95% de identidad. Clusters de recurrente mLV integraciones se definieron mediante una comparación estadística con un conjunto de datos de secuencias genómicas aleatorias, generados extraer aleatoriamente las posiciones genómicas del genoma humano con un motivo de restricción Tru91 a una distancia compatible con la plataforma de secuenciación. Las secuencias de control fueron procesadas a través de la misma cartografía y filtrado utilizado para secuencias de integración, para generar un conjunto aleatorio de sitios únicos. Para definir clusters mLV, se aplicó el algoritmo de agrupación DBSCAN 19 , comparando la distribución de integraciones mLV consecutivas con la de un número igual de sitios aleatorios para identificar regiones de integraciones altamente agrupadas, que defIne, elementos reguladores específicos de células 7 , 14 , 15 . Con el fin de evitar la generación de grupos falsos, se realizaron múltiples extracciones del conjunto de datos de control aleatorio. Se mapearon por LM-PCR y pirosequencing 32.574, 27.546 y 36.358 mLV sitios de integración en HSPC, EPP y MPP, respectivamente. Grupos de recurrente mlV integraciones co-mapeado con acetilado potenciadores y promotores ( Figura 4A ]. La mayoría de las regiones reguladoras dirigidas por mLV eran específicas de células, tales como: (i) el promotor del gen SPINK2 específico de HSPC ( Figura 4B ); (Ii) la región de control de locus que contiene intensificadores potentes de los genes de globina β similares a eritroides ( Figura 4C ); (Iii) potenciadores situados aguas arriba del gen LYZ específico de MPP ( Figura 4D ). Finalmente, se utilizaron ensayos de luciferasa para validarUn subconjunto de putativo específicos de la célula mLV potenciadores en EPP y MPP ( Figura 4E ].

Figura 1
Figura 1: Esquema general del procedimiento de mapeo del sitio de integración retroviral. Las células diana se transducen con un vector retroviral basado en mLV que contiene un casete eGFP. El ADN genómico obtenido a partir de células transducidas se digiere con Tru9I y se liga con un conector Tru9I de doble hebra compatible. MlV sitios de integración fueron amplificados por anidados LM-PCR y la biblioteca de virus-host genoma junciones pueden ser masivamente secuenciado utilizando Illumina o Roche plataformas. Las lecturas resultantes se correlacionaron con el genoma humano para definir agrupaciones de integraciones de mLV recurrentes. Haga clic aquí para ver una versión más grande de esta figura. <Pabellón

Figura 2
Figura 2: Amplificación de las uniones del genoma del virus-huésped por LM-PCR. El ADN genómico (gDNA) que contiene el provirus mlV integrado se digiere con las enzimas de restricción Tru9I y PstI y se liga con un conector Tru9I compatible. La PCR anidada se realiza usando cebadores específicos para el LTR y el enlazador. Se indican los sitios de restricción Tru9I y PstI en el genoma viral y en el genoma humano. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3: Análisis de amplicones de LM-PCR. ( A ) Los productos LM-PCR (carril +) se pusieron en un gel de agarosa al 1% y se visualizaronPor tinción con bromuro de etidio. Una muestra de plantilla no sirvió como muestra de control negativo, en la que sólo se visualizaron cebadores de PCR (carril -). ( B ) Después de la purificación en gel, se verificó el tamaño del producto LM-PCR mediante electroforesis microcapilar. El tamaño de la muestra (pb) y la intensidad de fluorescencia (FU) se muestran en los ejes xey del electroferograma, respectivamente. Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4: Mapeo de la integración mLV en regiones reguladoras epigenéticamente definidas. ( A ) Se definieron 3,498, 2,989 y 4,103 racimos de sitios de integración de mLV recurrentes en HSPC, EPP y MPP, respectivamente. En cada población de células,> 95% de los grupos mLV se superponen con epigenetically definido enhancPromotores. ( B , C y D ) Las regiones específicas de la célula de mLV fueron altamente acetiladas y asociadas con la expresión específica de células del gen diana ( SPINK2 , HBB y LYZ , expresadas casi exclusivamente en HSPC, EPP y MPP, respectivamente, según se determinó Por el análisis Cap de la expresión génica). Las integraciones simples de mLV se representan con barras pequeñas. TPM indica Etiqueta por millón. ( E ) Potenciadores potenciadores especificados específicos de célula mLV en EPP y MPP. La figura 4 se adapta a partir de la referencia 14 . Recibimos el permiso para reutilizar esta figura bajo la licencia creative commons. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aquí, hemos descrito un protocolo para el genoma de la cartografía de los sitios de integración de mLV, un retrovirus que las regiones de la cromatina objetivo, epigenéticamente marcado como promotores activos y potenciadores. Los pasos críticos y / o limitaciones del protocolo incluyen: (i) transducción mLV de la población de células diana; (Ii) amplificación de las uniones huésped-virus por LM-PCR; (Iii) recuperación de una alta fracción de sitios de integración. Los vectores retrovirales basados ​​en mLV transfieren eficientemente las células en división. La baja eficiencia de la transducción de células no divisorias (por ejemplo, células neuronales postmitoticas) es una limitación potencial de esta técnica. Sin embargo, se puede superar mediante la clasificación celular de la población transducida basada en la expresión del gen indicador ( por ejemplo, eGFP). La generación de amplicones relativamente cortos por LM-PCR (150 a 500 bp) es obligatoria para generar una biblioteca de amplicones compatibles con las estrategias de secuenciación masiva actualmente utilizadas y permitir una genOme-wide analysis of mLV integration sites. Como ejemplo, la amplificación de productos de LM-PCR de 500 bp de largo puede resultar de digestión parcial del ADN genómico o intra-ligación de fragmentos genómicos digeridos con Tru9I, según se evaluó mediante clonaje con escopeta de amplicones de LM-PCR (datos no mostrados). En el primer caso, el problema se puede resolver optimizando las condiciones de digestión del ADN genómico, mientras que en este último caso, la secuenciación masiva exitosa de los sitios de integración de mLV puede lograrse mediante una purificación en gel de amplicones entre 150 y 500 pb. Por último, el uso de enzimas de restricción para cortar el ADN genómico puede conducir a la amplificación preferente y la detección de sitios de integración que se encuentran cerca de un sitio de restricción. El porcentaje de sitios de integración que la enzima de restricción Tru9I puede recuperar es estimado en ~ 50%. Por lo tanto, esta técnica puede optimizarse aún más para mejorar la recuperación del sitio de integración mediante el uso de múltiples enzimas de restricción o la realización de sheari de ADN aleatorioNg por sonicación 20 , 21 .

Recientemente, hemos optimizado la secuenciación de sitios de integración viral utilizando la plataforma ampliamente utilizada Illumina, como se detalla en este documento. Este enfoque de secuenciación permite la generación de un mayor número de lecturas por ejecución en comparación con la plataforma de Roche, aumentando en gran medida el número de sitios de integración recuperados de un solo experimento, reduciendo globalmente el tiempo y los costos.

La identificación a nivel genoma de las regiones reguladoras específicas de la célula requiere la cartografía de una a tres modificaciones de histonas por ChIP-seq 6 (mono- y trimetilación de la histona H3 lisina 4 para identificar potenciadores y promotores, y H3K27ac para distinguir entre activo e inactivo 4 , 5 , 6 y una comparación sistemática de diferentes tipos de células para definirCis que actúan activos exclusivamente en una determinada población celular. Hemos mapeado mLV sitios de integración en prospectivamente aislados poblaciones de células diana, como protoprotectores hematopoyéticos multipotentes y sus comprometidos eritroides y mieloides progenie 14 , las células madre embrionarias, neuroepitelial-como las células madre y diferenciado keratinocytes [ 15] . El escaneo retroviral permitió la definición de todo el genoma de los elementos reguladores específicos de células en cada población de células analizadas, haciendo que los estudios comparativos a nivel genoma no fueran estrictamente necesarios. Es importante destacar que esta herramienta puede utilizarse para la identificación de elementos reguladores activos en poblaciones de células raras ( por ejemplo, células madre somáticas), que carecen de marcadores robustos para el aislamiento prospectivo y no pueden ser analizados por el análisis basado en ChIP-seta de las modificaciones histonas 15 . En estas poblaciones de células mLV integración es un marcador genético permanente de las regiones reguladoras activas, lo que permiteSu identificación retrospectiva en la progenie celular más abundante in vitro e in vivo. Como ejemplo, hemos utilizado con éxito mlV integración clusters como sustituto marcadores de promotores y potenciadores en un retrospectivamente identificados keratinocyte células madre (KSC) población. Transdujeron un cultivo de queratinocitos derivado del prepucio, que contenía KSCs con un vector mLV, y luego pasamos estas células para duplicaciones de células> 35 para enriquecer en la progenie de KSCs, así definidas por su capacidad para mantener el cultivo para este número de Pasajes En este caso, mlV integraciones permanentemente marcado las regiones reguladoras activa en el original KSC transduced población [ 15] . Estudios futuros tendrán como objetivo identificar en un genoma en su conjunto los elementos reguladores específicos de células en un mayor número de raras poblaciones de células madre humanas.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este trabajo fue apoyado por subvenciones del Consejo Europeo de Investigación (ERC-2010-AdG, GT-SKIN), el Ministerio Italiano de Educación, Universidades e Investigación (FIRB-Futuro en Ricerca 2010-RBFR10OS4G, FIRB-Futuro en Ricerca 2012-RBFR126B8I_003 , EPIGEN Epigenomics Flagship Project), el Ministerio Italiano de Salud (Jóvenes Investigadores llaman 2011 GR-2011-02352026) y la Imagine Institute Foundation (París, Francia).

Materials

Name Company Catalog Number Comments
PBS, pH 7.4 ThermoScientific 10010031 or equivalent
Fetal Bovine Serum ThermoScientific 16000044 or equivalent
0.2 ml tubes general lab supplier
1.5 ml tubes general lab supplier
QIAGEN QIAmp DNA mini Kit  QIAGEN 51306 or equivalent
T4 DNA ligase  New England BioLabs M0202T
T4 DNA Ligase Reaction buffer New England BioLabs M0202T
Linker Plus Strand oligonucleotide general lab supplier 5’-PO4-TAGTCCCTTAAGCGGAG-3’  (Purification grade: SDS-PAGE)
Linker Minus Strand oligonucleotide general lab supplier 5’-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3’ (Purification grade: SDS-PAGE)
Tru9I Roche-Sigma-Aldrich 11464825001
SuRE/Cut Buffer M Roche-Sigma-Aldrich 11417983001
PstI  Roche-Sigma-Aldrich 10798991001
SuRE/Cut Buffer H Roche-Sigma-Aldrich 11417991001
Platinum Taq DNA Polimerase High Fidelity  Invitrogen 11304011
10 mM dNTP Mix Invitrogen 18427013 or equivalent
PCR grade water general lab supplier
96-well thermal cycler (with heated lid) general lab supplier
linker primer general lab supplier 5’-GTAATACGACTCACTATAGGGC-3’ (Purification grade: PCR grade)
MLV-3’ LTR primer general lab supplier 5’-GACTTGTGGTCTCGCTGTTCCTTGG-3’ (Purification grade: PCR grade)
linker nested primer 454 general lab supplier 5’-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer 454 general lab supplier 5’-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
linker nested primer Illumina general lab supplier 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer Illumina general lab supplier 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
Sodium Acetate Solution (3M) pH 5.2 general lab supplier
Ethanol (absolute) for molecular biology Sigma-Aldrich E7023 or equivalent
Topo TA Cloning kit (with pCR2.1-TOPO vector) Invitrogen K4500-01
QIAquick Gel Extraction kit QIAGEN 28704
Agarose Sigma-Aldrich A9539 or equivalent
Ethidium bromide  Sigma-Aldrich E1510 or equivalent
100 bp DNA ladder Invitrogen 15628019 or equivalent
6x Loading Buffer ThermoScientific R0611 or equivalent
NanoDrop 2000 UV-Vis Spectrophotometer ThermoScientific ND-2000
Nextera XT Index kit Illumina FC-131-1001 or FC-131-1002
2x KAPA HiFi Hot Start Ready Mix  KAPA Biosystems KK2601
Dynal magnetic stand for 2 ml tubes Invitrogen 12321D or equivalent
Agencourt AMPure XP 60 ml kit Beckman Coulter Genomics A63881
Tris-HCl 10 mM, pH 8.5 general lab supplier
Agilent 2200 TapeStation system Agilent Technologies G2964AA or equivalent
D1000 ScreenTape Agilent Technologies 5067-5582 or equivalent
D1000 Reagents Agilent Technologies 5067-5583 or equivalent
KAPA Library Quantification Kit for Illumina platforms (ABI Prism) KAPA Biosystems KK4835
ABI Prism 7900HT Fast Real-Time PCR System Applied Biosystems 4329003
NaOH 1.0 N, molecular biology-grade general lab supplier
HT1 (Hybridization Buffer) Illumina  Provided in the MiSeq Reagent Kit
MiSeq Reagent Kit v3 (150 cycles) Illumina MS-102-3001
MiSeq System Illumina SY-410-1003
PhiX Control v3 Illumina FC-110-3001

DOWNLOAD MATERIALS LIST

References

  1. Ernst, J., et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature. 473, (7345), 43-49 (2011).
  2. Shlyueva, D., Stampfel, G., Stark, A. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet. 15, (4), 272-286 (2014).
  3. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  4. Heintzman, N. D., et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature. 459, (7243), 108-112 (2009).
  5. Creyghton, M. P., et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A. 107, (50), 21931-21936 (2010).
  6. Hnisz, D., et al. Super-enhancers in the control of cell identity and disease. Cell. 155, (4), 934-947 (2013).
  7. Cattoglio, C., et al. High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors. Blood. 116, (25), 5507-5517 (2010).
  8. Biasco, L., et al. Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. EMBO Mol Med. 3, (2), 89-101 (2011).
  9. De Ravin, S. S., et al. Enhancers are major targets for murine leukemia virus vector integration. J Virol. 88, (8), 4504-4513 (2014).
  10. LaFave, M. C., et al. mLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Res. 42, (7), 4257-4269 (2014).
  11. Gupta, S. S., et al. Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration. J Virol. 87, (23), 12721-12736 (2013).
  12. Sharma, A., et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proc Natl Acad Sci U S A. 110, (29), 12036-12041 (2013).
  13. De Rijck, J., et al. The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites. Cell reports. 5, (4), 886-894 (2013).
  14. Romano, O., et al. Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment. Sci Rep. 6, 24724 (2016).
  15. Cavazza, A., et al. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation. Stem Cell Reports. 6, (4), 618-632 (2016).
  16. Miller, A. D., Law, M. F., Verma, I. M. Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene. Mol Cell Biol. 5, (3), 431-437 (1985).
  17. Cattoglio, C., et al. High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion. PLoS One. 5, (12), e15688 (2010).
  18. Aiuti, A., et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science. 341, (6148), 1233151 (2013).
  19. Biffi, A., et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science. 341, (6148), 1233158 (2013).
  20. Gabriel, R., et al. Comprehensive genomic access to vector integration in clinical gene therapy. Nat Med. 15, (12), 1431-1436 (2009).
  21. Gillet, N. A., et al. The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones. Blood. 117, (11), 3113-3122 (2011).
Escaneo Retroviral: Mapeo de sitios de integración MLV para definir regiones reguladoras específicas de células
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).More

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter