Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Retroviral סריקה: מיפוי MLV אתרי אינטגרציה להגדרת אזורים רגולטוריים ספציפיים לתא

doi: 10.3791/55919 Published: May 28, 2017

Summary

כאן, אנו מתארים פרוטוקול המיפוי גנום רחב של אתרי אינטגרציה של מולוני Murine לוקמיה וירוס מבוססי וקטורים רטרוביראל בתאים אנושיים.

Abstract

Mukoney Murine לוקמיה (MLV) וירוס מבוססי וקטורים retroviral להשתלב בעיקר משפרי acetylated ויזמים. מסיבה זו, אתרי אינטגרציה mLV יכולים לשמש כסמנים פונקציונליים של רכיבים רגולטוריים פעילים. כאן, אנו מציגים כלי סריקה retroviral, אשר מאפשר זיהוי גנום רחב של משפרי תא ספציפי ומקדמים. בקצרה, האוכלוסייה היעד היעד transduced עם וקטור נגזר mLV ו DNA גנומי מתעכל עם אנזים הגבלת חיתוך לעתים קרובות. לאחר קשירת שברי הגנום עם מקשר DNA תואם, linker בתיווך פולימראז התגובה שרשרת (LM-PCR) מאפשר הגברה של צומת הגנום וירוסים המארח. רצף מסיבי של amplicons משמש כדי להגדיר את פרופיל האינטגרציה mLV גנום רחב. לבסוף, אשכולות של אינטגרציות חוזרות מוגדרים לזיהוי אזורים רגולטוריים ספציפיים לתא, האחראים להפעלת תוכניות תמלול ספציפיות מסוג תא.

= "Jove_content"> כלי הסריקה retroviral מאפשר זיהוי גנום רחב של היזמים ספציפיים ספציפיות תא ב אוכלוסיות תאים היעד פרוספקטיבי. יש לציין, כי סריקה רטרו-ויראלית מייצגת טכניקה אינסטרומנטלית לזיהוי רטרוספקטיבי של אוכלוסיות נדירות ( כגון תאי גזע סומטיים) שאין להן סמנים חזקים לבידוד פוטנציאלי.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

זהות התא נקבעת על ידי ביטוי של קבוצות ספציפיות של גנים. תפקידם של אלמנטים רגולטוריים של CIS, כגון יזמים ומשפרים, הוא קריטי להפעלת תוכניות תמליל ספציפיות מסוג תאים. אזורים רגולטוריים אלה מאופיינים בתכונות כרומטיות ספציפיות, כגון שינויים היסטוניים מוזרים, גורמי תעתיק ושיתוף גורמי שיתוף, וגישה לכרומטין, אשר שימשו באופן נרחב להגדרת הגנום שלהם במספר סוגי תאים 1 , 2 , 3 . בפרט, פרופיל הגנום רחב של אצטילציה של היסטון H3 ליזין 27 (H3K27ac) משמש בדרך כלל להגדיר היזמים פעיל, משפרי ומשפר סופר 4 , 5 , 6 .

Moloney Murine וירוס לוקמיה (MLV) הוא גמא רטרווירוס כי הוא בשימוש נרחב עבור הגןהעברה בתאי יונקים. לאחר הדבקה של תא מטרה, הגנום רטרובייראלי RNA הוא retro- transcribed במולקולה דנ"א כפול תקועים המחייבת חלבונים ויראליים וסלולריים להרכיב את מורכבות מראש אינטגרציה (PIC). PIC נכנס הגרעין וקושרת את הכרומטין התא המארח. כאן, אינטגרז ויראלי, מרכיב PIC מפתח, מתווך את האינטגרציה של ה- DNA פרובייר לתוך הגנום תא המארח. אינטגרציה של mLV בדנ"א הגנומי אינה אקראית, אלא מתרחשת במרכיבים פעילים של cis-regulation, כגון מקדמי ומשפר, בתא ספציפי 7 , 8 , 9 , 10 . פרופיל אינטגרציה מוזר זה מתווכת על ידי אינטראקציה ישירה בין אינטגרז mLV לבין חלבונים Bromodomain הסלולר ו extrerminal תחום (BET) חלבונים 11 , 12 , 13 . חלבונים BET (BRD2, BRD3, וBRD4) לשמש גשר בין הכרומטין המארח ל mLV PIC: דרך bromodomains שלהם הם מכירים מאוד cety- רגולציה אזורים, ואילו תחום extrerminal אינטראקציה עם אינטגרציה mLV 11 , 12 , 13 .

כאן, אנו מתארים את הסריקה רטרו-ויראלי, כלי חדש למפות אזורים פעילים cis- רגולציה מבוסס על תכונות שילוב של mLV. בקצרה, תאים transduced עם וקטור mLV הנגזר retroviral להביע את חלבון פלואורסצנטי ירוק משופרת (eGFP) גן הכתב. לאחר החילוץ הדנ"א הגנומי, הצמתים בין ה - LTR של ה - LTR של ה - LTR של וקטור ה - mLV לבין הדנ"א הגנומי מתוגברים על ידי PCR בתיווך מקושר (LM-PCR) ו רצף מאסיבי. אתרי אינטגרציה של mLV ממופים לגנום האנושי ולאזורים הגנומיים הממוקדים על ידי mLV מוגדרים כאשכולות של אתרי אינטגרציה mLV.

סריקת רטרו - ויראליNing שימש כדי להגדיר תא ספציפי אלמנטים רגולטוריים פעילים כמה תאים ראשוניים האנושי 14 , 15 . מקבצים mLV במשותף עם יזמים מוגדרים epigenetically ו משפרי, אשר רובם טמון סימני היסטון פעיל, כגון H3K27ac, היו ספציפיים תא. סריקה רטרו-ויראלית מאפשרת זיהוי גנום רחב של אלמנטים רגולטוריים של דנ"א באוכלוסיות תאים מטופלות פרוספקטיבית , 7 , 14 , כמו גם באוכלוסיות תאים מוגדרות רטרוספקטיבית, כגון תאי גזע קרטינוציטים, חסרים סמנים יעילים לבידוד פוטנציאלי 15 .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. MLV התמרה של תאים אנושיים

  1. לבודד תאים היעד transduce אותם עם וקטור mLV הנגזר retroviral מחסה את הגן הכתב eGFP ו pseudotyped עם Vesicular Stomatitis Virus (VSV-G) או המעטפה גליקופרוטין amphotropic 16 .
    1. שמור על תאים מעושה transduced כבקרה שלילית עבור הניתוחים הבאים. מאז וקטורים rVroviral מבוסס mLV יכול transduce יעיל חלוקת תאים, תרבות האוכלוסייה היעד האוכלוסייה בתנאים הממריצים חלוקת התא. תנאי התמרה צריך להיות מותאם במיוחד עבור כל סוג התא תחת מחקר. גידול תאים ותנאי התמרה של אבות hematopoietic האדם, תאי T ותאי האפידרמיס מתוארים הפניות 7, 14, 15, ו - 17.
  2. 48 שעות לאחר התמרה, resuspend 100,000 תאים μL 300 של מלוחים שנאגרו מלוחים (PBS) המכיל 2% בסרום שור עוברית ולמדוד ביטוי eGFP ידי Fניתוח cytometric נמוך (488 ננומטר עירור לייזר). השתמש בתאים מדומים מדומים כביקורת שלילית. עבור אחזור אתר אינטגרציה אופטימלית, לטהר תאים GFP + על ידי מיון הקרינה מופעלת תא (FACS).
  3. איסוף 0.5-5 מיליון תאים להכנת DNA גנומי. תקופת תרבות ארוכה יותר (7 ימים) מעדיפה לדלל את provirus הלא משולב ואת הצורך בעת ניתוח הצאצאים לטווח ארוך של בתאי גזע בתום לב (ראה סעיף דיון התייחסות 15 ). כדורי התא יכול להיות הצמד קפוא מאוחסן ב -80 מעלות צלזיוס עד לשימוש.

2. הגברה של אתרי אינטגרציה mLV על ידי קישור-מתווך-PCR (LM-PCR)

  1. הכנת DNA גנומי (gDNA)
    1. חלץ gDNA באמצעות ערכת מבוססי דנ"א חילוץ עקוב אחר פרוטוקול תאים בתרבית, על פי הוראות היצרן.
  2. הגבלת אנזים digestiעַל
    1. הגדרת 4 עיכול אנזים עיכוב לכל מדגם צינורות 1.5 מ"ל. לעכל 0.1-1 ggNA מיקרוגרם בכל צינור על ידי הוספת 1 μL של Tru9I (10U) ו 1 μL של המאגר M בנפח סופי של 10 μL. דגירה את התגובות על 65 מעלות צלזיוס במשך 6 שעות או לילה.
    2. הוסף כל תגובה 1 μL של PSTI (10U), 1 μL של חיץ H ו 8 μL של מים. דגירה את התגובות על 37 מעלות צלזיוס למשך 6 שעות או לילה. דוגמאות ניתן לאחסן ב -20 ° C עד השימוש.
  3. לינקר קשירת
    1. הכן 100 מיקרומטר Tru9I פתרון המניה מקשר בצינור 1.5 מ"ל על ידי ערבוב מקשר בתוספת גדיל ומקשר מינוס oligonucleotides גדיל בריכוז 100 מיקרומטר. שים את הצינור בתוך סט מים על 100 מעלות צלזיוס ולתת לו להתקרר בטמפרטורת החדר. Tru9I פתרון המניה מקשר ניתן לאחסן ב -20 מעלות צלזיוס עד לשימוש.
    2. הגדר 8 קשירת קשירת תגובות 1.5 צינורות מ"ל. עבור כל תגובה, הוסף את הרכיב הבאS ל 10 μL של עיכול אנזים הגבלה: 1.4 μL של 10X T4 DNA Ligase התגובה חיץ, 1 μL של 10 מיקרומטר Tru9I מקשר, 1 μL (2,000U) של ליגז T4 DNA ו 0.6 μL של מים. לדגור על 16 מעלות צלזיוס במשך 3 עד 6 שעות. דוגמאות ניתן לאחסן ב -20 ° C עד השימוש.
  4. PCR הראשון
    1. הגדר 48 תגובות PCR (6 תגובות מכל צינור קשירת) ב 0.2 צינורות מ"ל. עבור כל PCR, להוסיף את ריאגנטים הבאים μL 2 של תגובה קשירת: 5 μL של חיץ 10X PCR, 2 μL של 50 מ"מ מגנזיום סולפט, 1 μL של 10 mox deoxynucleotide (dNTP) מערבבים, 1 μL של 10 תחל מקשר מיקרומטר, 1 ΜL של 10 מיקרומטר mLV-3 'LTR תחל, 0.3 μL (1.5U) של פולימרז דנ"א Taq ו 37.7 μL של מים. טבלאות פריימר מסופקות בטבלה 1.
    2. בצע תגובה PCR ב cycler תרמית עם מכסה מחומם, כדלקמן: 95 מעלות צלזיוס למשך 2 דקות; 25 מחזורים של 95 מעלות צלזיוס למשך 15 שניות, 55 מעלות צלזיוס למשך 30 שניות, 72 מעלות צלזיוס למשך דקה אחת; 72 °; C למשך 5 דקות; להחזיק ב 4 ° C. דוגמאות ניתן לאחסן ב -20 ° C עד השימוש.
  5. PCR השני
    1. הגדרת 48 תגובות PCR (1 מכל "PCR הראשון" צינור) ב 0.2 צינורות מ"ל. עבור כל PCR, להוסיף את הרכיבים הבאים μL 2 של התגובה הראשונה PCR: 5 μL של חיץ PCR 10X, 2 μL של 50 מ"מ מגנזיום סולפט, 1 μL של 10 mM dNTP מיקס, 1 μL של 10 מיקרומטר מקשר מקוננות פריימר, 1 ΜL של 10 מיקרומטר mLV-3 'LTR מקוננות תחל, 0.3 μL של פולימרז דנ"א Taq (1.5 U) ו 37.7 μL של מים. השתמש primers מקוננות המיועד ספציפית אסטרטגיית רצף מסיבי נבחר: (i) מקושר מקושר פריימר ו mLV-3 'LTR מקוננות תחל תואם פלטפורמה Illumina; (Ii) מקשר מקושר מקושר ו mLV-3 'LTR מקוננות תחל תואם פלטפורמת Roche. רצפים פריימר מופיעים בטבלה 1 .
    2. בצע תגובה PCR ב cycler תרמית עם מכסה מחומם, כדלקמן: 95 מעלות צלזיוס למשך 2 דקות; 25מחזורים של 95 מעלות צלזיוס למשך 15 שניות, 58 מעלות צלזיוס למשך 30 שניות, 72 מעלות צלזיוס למשך דקה אחת; 72 מעלות צלזיוס למשך 5 דקות; להחזיק ב 4 ° C. דוגמאות ניתן לאחסן ב -20 ° C עד השימוש.
    3. בריכת 48 תגובות מקוננות PCR בצינור 15 מ"ל (נפח סופי של ~ 2.4 מ"ל). דוגמאות ניתן לאחסן ב -20 ° C עד השימוש.
  6. לקבוע את הנוכחות ואת הגודל של מוצרים LM-PCR ידי אלקטרופורזה agarose ג'ל.
    1. הוסף 4 μL של חיץ טוען ל 20 μL של מוצרים LM-PCR לטעון את המדגם על ג'ל agarose 1%, יחד עם סולם DNA 100 BP. הפעל את הג'ל ב 5 V / cm במשך 30 עד 60 דקות לדמיין את מוצרי ה- PCR על ידי מכתים ethidium bromide.
    2. הפעל תגובה LM-PCR מן המדומה מדומה transduced כמו שליטה שלילית.
  7. לזרז את amplicons על ידי הוספת 0.1 כרכים של תמיסת אצטט נתרן (3 M, pH 5.2) ו 2.5 כרכים של אתנול 100%. מערבבים להקפיא ב -80 מעלות צלזיוס למשך 20 דקות.
    1. ספין ב פוLl מהירות microcentrifuge רגיל ב 4 מעלות צלזיוס למשך 20 דקות. מחק supernatant ולשטוף את גלולה עם אתנול 70%. ספין במלוא המהירות microcentrifuge סטנדרטי ב 4 מעלות צלזיוס במשך 5 דקות.
    2. מחק supernatant ויבש את האוויר גלולה. הוסף 200 μL של מים PCR כיתה resuspend את ה- DNA. דוגמאות ניתן לאחסן ב -20 ° C עד השימוש.
  8. הוסף 20 μL של חיץ טוען 100 μL של מוצרים LM-PCR לטעון את המדגם על גבי ג'ל agarose 1%, יחד עם סולם DNA 100 BP.
    1. הפעל את הג'ל ב 5 V / ס"מ במשך 30 עד 60 דקות לחתוך את החלק של ג'ל המכיל 150 עד 500 amplicons bp.
    2. לטהר את המוצרים LM-PCR עם ג 'ל מבוססי עמודה החילוץ ערכת למדוד את הריכוז באמצעות ספקטרופוטומטר UV.
  9. השתמש 1 μL של הספרייה כדי להעריך את אורך LM-PCR מוצרים באמצעות מכשיר bioanalyzer, על פי הוראות היצרן.
  10. השתמש 20 ng של מוצרים מטוהרים LM-PCR לשכפל אותם וקטור pCR2.1-TOPO, על פי הוראות היצרן.
  11. ביצוע תגובות רצף באמצעות M13 יוניברסל פריימר, ואחריו מיפוי גנומי של רצפים שהתקבלו, כדי לחשוף את נוכחותם של צמתים ויראליים גנום (כולל mLV-3 'LTR מקוננות פריימר) ב> 50% של שיבוטים כדי לזהות דגימות מתאים עבור רצף מסיבי. דוגמה לצומת ויראלי-גנומי:
    צוֹמֶת
    MLV-3 'LTR מקוננות תחל 454 ו מקשר מקוננות פריימר 454 ( טבלה 1 ) מסומנים מודגש ואת הקצה 3' של LTR ויראלי נטוי. רצף הגנום האנושי מודגש בטקסט אדום (chr10: 6439408-6439509, hg19).

3. מסיבי רצף של אתרי אינטגרציה mLV

הערה: LM-PCR prodUcts ניתן רצף באמצעות פלטפורמות מסחריות (בחירת זוג מקוננות נאות מקוננות התגובה השנייה PCR, ראה סעיף 2.5.1). עבור רצף על ידי Roche GS-FLX pyrosequencing פלטפורמה, עיין מאמרים קודמים 7 , 14 , 15 . בסעיף זה, פרוטוקול מותאם במיוחד עבור פלטפורמת רצף Illumina מתואר.

  1. הכנת ספריה
    1. הגדרת 1 אינדקס התגובה PCR לכל מדגם צינורות 0.2 מ"ל. עבור כל PCR, להוסיף את ריאגנטים הבאים ל 5 μL (150-170 ng) של המוצר מטוהרים LM-PCR: 5 μL של פריימר אינדקס 1, 5 μL של פריימר אינדקס 2, 25 μL של מיקס מאסטר 2X ו 10 μL של PCR- מים כיתה. השתמש בצירוף אינדקס שונה עבור כל מדגם.
    2. בצע תגובות PCR ב cycler תרמית עם מכסה מחומם, כדלקמן: 95 מעלות צלזיוס למשך 3 דקות; 8 מחזורים של 95 מעלות צלזיוס למשך 30 שניות, 55 מעלות צלזיוס למשך 30 שניות, 72 מעלות צלזיוס למשך 30 שניות; 72 מעלות צלזיוס במשך 5 מ 'In להחזיק ב 4 ° C.
    3. לטהר את המוצרים PCR באמצעות מוצק בשלב הפיכת immobilization (SPRI) פרוטוקול בידוד חרוז: ב צינורות 1.5 מ"ל חדש, להוסיף 56 μL של חרוזים למדגם כל ולהמשיך בהתאם להוראות היצרן. Elute μL 25 של Tris-HCl 10 מ"מ. ספריות ניתן לאחסן ב -20 ° C עד לשימוש.
  2. בדיקת ספריה
    1. השתמש 1 μL של המדגם להעריך את גודל הספרייה באמצעות מכשיר bioanalyzer.
    2. השתמש 1 μL של מדגם לכמת מולריות הספרייה באמצעות assay מבוסס הקרינה בזמן אמת PCR, על פי הוראות היצרן.
  3. דילול בספריה ורצף
    1. מדולל ספריות ל -10 ננומטר באמצעות Tris-HCl 10 מ"מ. עבור ספריות איגום, להעביר 5 μL של הספרייה כל מדולל לצינור 1.5 מ"ל חדש ולאחר מכן לדלל את הבריכה עד 4 ננומטר ב- Tris-HCl 10 מ"מ.
    2. מערבבים 5 μL של הבריכה בדילול עם 5 μL של 0.2 N NaOH ב 1.5 מ 'חדשL צינור, מערבולת בקצרה, ספין למטה דגירה במשך 5 דקות בטמפרטורת החדר כדי להכחיש את הספריות.
    3. שים צינורות על הקרח ולהוסיף 990 μL של חיץ הכלאה מראש צונן (HT1). Aliquot 300 μL של בריכה מפוגל בצינור חדש 1.5 מ"ל ולהוסיף 300 μL של HT1 טרום צונן להשיג 10 הספרייה הסופי הספרייה.
    4. במקביל, לערבב 2 μL של ספריית הבקרה PhiX (10 ננומטר) עם 3 μL של Tris-HCl 10 מ"מ בצינור 1.5 מ"ל. הוסף 5 μL של NaOH 0.2 N, מערבולת בקצרה, ספין למטה דגירה במשך 5 דקות בטמפרטורת החדר כדי להכשיר את PhiX מדולל. שים צינור על הקרח ולהוסיף 990 μL של HT1 טרום צונן.
    5. Aliquot 300 μL של PhiX מפוגל בצינור חדש 1.5 מ"ל ולהוסיף 300 μL של HT1 טרום צונן להשיג PhiX 10 pM הסופי.
    6. בצינור 1.5 מ"ל חדש, לערבב 510 μL של מאגר ספריה denatured עם 90 μL של ספריית PhiX מפוגל, ובכך להשיג בריכה 10 pM הסופי עם 15% של שליטה PhiX.
    7. פיפטה אלה 600 μL של המדגםנפח לתוך המאגר לטעון מדגם של מחסנית מופשר רצף ריצף ולהמשיך מיד לבצע ריצה אחת לקרוא מחזור 150.
      הערה: ריאגנטים קריטיים רצפים תחל נדרש בפרוטוקול זה מפורטים בטבלה 1 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

זרימת עבודה של הליך הסריקה רטרו-ויראלי

זרימת העבודה של הליך הסריקה retroviral הוא schematized באיור 1 . אוכלוסיית תאים היעד מטוהרים transduced עם וקטור retroiral mLV הנגזר להביע גן הכתב eGFP. הטרנסגן מוקף בשני חזרות טרמינל ארוכות (5 'ו -3' LTR), המבטיחות סינתזה, שעתוק לאחור ואינטגרציה של הגנום הנגיפי לדנ"א המארח. יעילות התמרה מוערכת על ידי ניתוח FACS של ביטוי eGFP. אוכלוסיית התאים המכילה שיעור גבוה (> 30%) של תאים המועברים על ידי mLV מוגברת ולאחר מכן lysed לחלץ DNA גנומי המכיל את קלטות נגיפי mLV משולב. הדנ"א הגנומי הוא מתעכל ligated עם מקשר תואם את צמתים בין 3 "נגיפי LTRs ו הגנום המארח מוגברים על ידי LM-PCR. Virצומת הגנום המארח אותנו מאופיינים ברצף מאסיבי באמצעות פלטפורמות Roche או Illumina. לבסוף, אתרי אינטגרציה mLV ממופים לגנום האנושי כדי להגדיר אשכולות גנומיים של אתרי הכנסה חוזרים.

הגברה של אתרי אינטגרציה mLV על ידי LM-PCR

LM-PCR הוא schematized באיור 2 . הדנ"א הגנומי מופק מ mLV transduced תאים מתעכל עם אנזים הגבלה Tru9I, אשר חותך לעתים קרובות את הגנום האנושי, יצירת שברי עם אורך חציון של 70 bp. אנזים הגבלה השני (PstI) משמש כדי למנוע הגברה של משולבים ולא משולבים 5 "שברי LTR פנימי. Tru9I מקשר פעמיים תקוע הוא ligated מכן לשברים הגנומי LM-PCR מבוצע עם primers ספציפי עבור המקשר ו 3 'LTR כדי להגביר את צומת הגנום וירוסים המארח. מקונן PCR ניתן לבצע באמצעות פריMers תואם Roche או פלטפורמות רצף Illumina.

ניתוח של amplicons גנום המארח צומת הגנום

בניסוי המיוצג באיור 3 , אנחנו מטהר CD34 - CD13 + אקווריום מיאלואידי / מבשרי (MPP) ו transduced אותם עם retroviral הנגזרות mLV להביע את הגן הכתב eGFP. יותר מ 60% של תאים MPP הביע eGFP 48 שעות לאחר התמרה (נתונים לא מוצג). 15 ימים לאחר התמרה, אספנו את התאים, חילוץ gDNA והגביר את צומת הגנום וירוסים המארח, כמתואר לעיל. Aliquot של מוצרי LM-PCR מאוחד נטען על ג'ל agarose 1% כדי לאמת את הנוכחות ואת הגודל של amplicons. אנו בהצלחה דמיינו כתם ה- DNA המתאים למוצרים LM-PCR בגדלים שונים, החל 150-1500 BP ( איור 3 א ). אמפליקונים היו אזמרוכז על ידי משקעים דנ"א נטען על ג'ל agarose 1%. מוצרי LM-PCR היו ג'ל מטוהרים ולהפעיל על מערכת bioanalyzer, המאשר את הגדלים amplicon צפוי (בין 150 ל 500 BP, איור 3 ב ).

מיפוי של אינטגרציות mLV לאזורים רגולטוריים פעילים ותא ספציפיים

בניסוי שדווח באיור 4 , תאי גזע / תאי מולקולות (HSPC), אורתרויד אבותטרויד / מבשרי (EPP) ואבות מיאלואידים / מבשרי (MPP) הועברו באמצעות וקטור רטרו-ויראלי נגזר mLV. תוצאות אלו התקבלו עיבוד דגימות רצף נגזר סוגי תאים שונים בנפרד, כדי למנוע זיהום / התנגשויות פוטנציאל 18 , 19 . רצף גלם קורא שנוצר על ידי רצף מסיבי עובדו על ידי ביואינפורמטיקה אוטומטיתצינור לחסל רצפים ויראליים וקישורים. לאחר מכן, רצפים ייחודיים של לפחות 20 bp היו ממופה על הגנום האנושי באמצעות Blat 17 . יישור גלם סוננו המחייבים את המשחק כדי להתחיל בתוך 3 נוקליאוטידים הראשונים, התאמות חד-משמעיות ומינימום של 95% זהות. אשכולות של אינטגרציות mLV חוזרות הוגדרו על ידי השוואה סטטיסטית עם מערך נתונים של רצפים גנומיים אקראיים, שנוצר באופן אקראי לחלץ עמדות הגנום מן הגנום האנושי עם מוטיב הגבלה Tru91 במרחק תואם פלטפורמת רצף. רצפים בקרה עברו אז באמצעות אותו מיפוי וסינון צינור המשמש רצפים אינטגרציה, כדי ליצור קבוצה אקראית של אתרים ייחודיים. כדי להגדיר אשכולות mLV, אנו מיישמים את האלגוריתם של הקבצנים DBSCAN 19 , המשווה את התפלגות האינטגרציות mLV הרציפות עם מספר שווה של אתרים אקראיים לזיהוי אזורים של אינטגרציה מקובצת, אשר defIne אלמנטים רגולטוריים ספציפיים לתא 7 , 14 , 15 . על מנת למנוע יצירת אשכולות שקר, בוצעו מספר מעברים ממערכת הבקרה האקראית. אנחנו ממופה על ידי LM-PCR ו pyrosequencing 32,574, 27,546 ו 36,358 mLV אתרי אינטגרציה HSPC, EPP ו- MPP, בהתאמה. אשכולות של אינטגרציה חוזרת mLV שיתוף ממופה עם משפרי acetylated ויזמים ( איור 4 א ). רוב האזורים הממוקדים mLV היו ספציפיים לתא, כגון: (i) היזם של הגן הספינקלי הספציפי HSPC ( איור 4 ב ); (Ii) אזור שליטה לוקוס המכיל משפר חזק של erythroid ספציפי β כמו גנים גלובין ( איור 4 ג ); (Iii) משפרי הממוקם במעלה של הגן MPY ספציפי LYZ ( איור 4D ). לבסוף, השתמשנו מבחני בלוציפראז כדי לאמתתת קבוצה של תאים ספציפיים ספציפיות mLV ממוקדות EPP ו- EPP ( איור 4E ).

איור 1
איור 1: סכימה כללית של תהליך המיפוי באתר האינטגרציה הרטרו-ויראלית. תאים היעד הם transduced עם וקטור retroiral mLV מבוסס המכיל קלטת eGFP. הדנ"א הגנומי המתקבל transduced תאים מתעכל עם Tru9I ו ligated עם מקשר תואם Tru9I פעמיים גדיל. אתרי אינטגרציה mLV היו מוגבר על ידי מקוננות LM-PCR ואת הספרייה של צומת הגנום וירוסים המארח יכול להיות רצף מאסיבי באמצעות Illumina או Roche פלטפורמות. הקריאות שהתקבלו ממופות לגנום האנושי כדי להגדיר אשכולות של אינטגרציות חוזרות ונשנות של mLV. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו. </ P>

איור 2
איור 2: הגברה של צומת הגנום וירוסים המארח ידי LM-PCR. הדנ"א הגנומי (gDNA) המכיל את פרוגרוס mLV משולב מתעכל עם אנזימים הגבלת Tru9I ו PstI, ו ligated עם מקשר Tru9I תואם. מקונן PCR מבוצע באמצעות primers ספציפי עבור LTR ואת מקשר. Tru9I ו PSTI אתרי הגבלה של ויראלי בגנום האנושי מצוינים. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 3
איור 3: ניתוח של amplicons LM-PCR. ( A ) LM-PCR מוצרים (נתיב +) היו לרוץ על ג'ל agarose 1% ו visualizedידי מכתים ethidium bromide. מדגם תבנית לא שימש מדגם שליטה שלילי, שבו רק פריימרים PCR היו דמיינו (נתיב -). ( ב ) לאחר טיהור ג'ל, LM-PCR גודל המוצר נבדקה על ידי אלקטרופורזה microcapillary. גודל הדגימה (bp) ועוצמת הקרינה (FU) מוצגים בצירים x ו- y של electropherogram, בהתאמה. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 4
איור 4: מיפוי אינטגרציה mLV לאזורים רגולטוריים מוגדרים אפיגנטית. ( א ) הגדרנו 3,498, 2,989 ו - 4,103 אשכולות של אתרי אינטגרציה חוזרת של mLV ב- HSPC, EPP ו- MPP, בהתאמה. בכל אוכלוסיית תאים,> 95% של אשכולות mLV חופפים עם שיפור מוגדר epigeneticallyErs ויזמים. ( B , C ו- D ) אזורים ספציפיים במיקרו-תאים ספציפיים ל- mLV היו אצטילציה גבוהה וקשורים לביטוי ספציפי לתא של הגן הממוקד ( SPINK2 , HBB ו- LYZ , שהובעו כמעט אך ורק ב- HSPC, EPP ו- MPP, בהתאמה, כפי שנקבע על ידי ניתוח שווי של ביטוי ג 'ין). אינטגרציה mLV אחת מתוארים עם סורגים קטנים. TPM מציין תג למיליון. ( E ) משוערת תא ספציפי mLV ממוקדות משפרי EPP ו- MPP. איור 4 מותאם מתוך התייחסות 14 . קיבלנו את ההרשאה להשתמש מחדש בתרשים זה תחת רישיון Creative Commons. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

כאן, תיארנו פרוטוקול מיפוי רחב הגנום של אתרי אינטגרציה של mLV, רטרווירוס כי מטרות אזורי הכרומטין, מסומנים epigenetically כמו יזמים פעיל ומשפר. צעדים קריטיים ו / או מגבלות של הפרוטוקול כוללים: (i) התמרה mLV של אוכלוסיית תאים היעד; (Ii) הגברה של צומת המארח וירוס על ידי LM-PCR; (Iii) אחזור של חלק גבוה של אתרי אינטגרציה. MLV מבוססי וקטורים retroviral ביעילות transduce חלוקת תאים. יעילות נמוכה של התמרה של תאים שאינם מחלקים (למשל שלאחר תאים מיטוטיים עצביים) היא מגבלה פוטנציאלית של טכניקה זו. עם זאת, ניתן להתגבר על ידי מיון תאים של האוכלוסייה transduced מבוסס על הביטוי של הגן הכתב ( למשל eGFP). הדור של amplicons קצר יחסית על ידי LM-PCR (150 עד 500 bp) הוא חובה כדי ליצור ספריה של amplicons תואם אסטרטגיות רצף מסיבית בשימוש הנוכחי כדי לאפשר gen מקיףניתוח Ome רחב של אתרי אינטגרציה mLV. לדוגמה, הגברה של 500 pp ארוך LM-PCR מוצרים יכול לנבוע מעיכול דנ"א גנומי חלקית או תוך קשירה של שברי גנומי Tru9I מתעכל, כפי שהוערך על ידי שיבוט רובה של amplicons LM-PCR (נתונים לא מוצגים). במקרה הראשון, הבעיה יכולה להיפתר על ידי מיטוב נוסף של בעיות העיכול דנ"א גנומי, ואילו, במקרה האחרון, רצף מסיבי מוצלח של אתרי אינטגרציה mLV ניתן להשיג באמצעות טיהור ג'ל של amplicons בין 150 ל 500 BP. לבסוף, השימוש באנזימי הגבלה כדי לחתוך את הדנ"א הגנומי יכול להוביל הגברה מועדף וזיהוי של אתרי אינטגרציה כי שקר קרוב לאתר הגבלה. אחוז אתרי האינטגרציה שאנזים הגבלה Tru9I יכול לאחזר מוערך כ -50%. לכן, טכניקה זו יכולה להיות מותאם עוד יותר כדי לשפר את אחזור אתר אינטגרציה באמצעות אנזימים הגבלה מרובים או ביצוע sheari דנ"א אקראיNg על ידי sonication 20 , 21 .

לאחרונה, יש לנו אופטימיזציה של רצף של אתרי אינטגרציה ויראלית באמצעות פלטפורמת Illumina בשימוש נרחב, כמפורט במאמר זה. שיטת ריצוף זו מאפשרת ליצור מספר קריאות גבוה יותר בהשוואה לפלטפורמת Roche, דבר שמגדיל מאוד את מספר אתרי האינטגרציה שמקורם בניסוי יחיד, ובכך מקטין את הזמן ואת העלויות.

זיהוי גנום רחב של אזורים רגולטוריים תא ספציפי דורש מיפוי של אחד עד שלושה שינויים היסטון על ידי שבב seq 6 (מונו ושלוש מתילציה של היסטון H3 ליזין 4 לזהות שיפורים ומקדמים, ו H3K27ac להבחין בין פעיל פעיל אלמנטים רגולטוריים) 4 , 5 , 6 ו השוואה שיטתית של סוגי תאים שונים כדי להגדירCis- משחק אלמנטים פעילים באופן בלעדי האוכלוסייה התא נקבע. אנחנו ממופה אתרי אינטגרציה mLV באוכלוסיות תאים היעד פרוספקטיבי פרוספקטיבי, כגון אבות hematopoietic multipotent ו הצאצא שלהם erythroid הצאצאים מיאלואיד 14 , תאי גזע עובריים, תאי גזע דמויי neuroepithelial ו kernatinocytes מובחן 15 . סריקה רטרו-ויראלית אפשרה את ההגדרה של גנום רחב של אלמנטים רגולטוריים ספציפיים לתאים בכל אוכלוסיית תאים, וניתנה את המחקר ההשוואתי לגנום. חשוב לציין, כלי זה יכול לשמש לזיהוי של אלמנטים רגולטוריים פעילים באוכלוסיות תאים נדירות ( למשל תאי גזע סומטיים), כי חסרים סמנים חזקים לבידוד פוטנציאלי ולא ניתן לנתח על ידי ניתוח שבב מבוסס ניתוח שינויים היסטון. באוכלוסיות אלה התא שילוב mLV הוא סמן גנטי קבוע של אזורי הרגולציה הפעילה, המאפשר thEir זיהוי רטרוספקטיבי של הצאצאים תא שופע יותר במבחנה in vivo. כדוגמה, השתמשנו בהצלחה באשכולות אינטגרציה mLV כמו סמנים חלופי של היזמים ו משפרי בתא גזע retropectyet מזוהה keratinocyte תא (KSC) האוכלוסייה. אנחנו transduced מוקדם- passage, נגזרת ערמונית תרבות keratinocyte המכיל KSCs עם וקטור mLV, אז אנחנו passaged תאים אלה עבור 35 הכפלות תא להעשיר בצאצאים של KSCs, כך מוגדרים על ידי היכולת שלהם לשמור על התרבות עבור מספר זה של מעברים. במקרה זה, אינטגרציות mLV מסומן באופן קבוע את האזורים הרגולטוריים הפעילים האוכלוסייה transduced המקורי KSC 15 . מחקרים עתידיים יכוונו לזהות בגנום רחב באופן ספציפי אלמנטים רגולטוריים תא במספר גדול יותר של אוכלוסיות תאים אנושיים נדירים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

למחברים אין מה לחשוף.

Acknowledgments

עבודה זו נתמכה על ידי מענקים של המועצה האירופית למחקר (ERC-2010-AdG, GT-SKIN), משרד החינוך האיטלקי, אוניברסיטאות ומחקרים (FIRB-Futuro ב- Ricerca 2010-RBFR10OS4G, FIRB-Futuro ב- Ricerca 2012-RBFR126B8I_003 , EPIGEN Epigenomics Flagship Project), משרד הבריאות האיטלקי (חוקרים צעירים קוראים 2011 GR-2011-02352026) ואת קרן מכון Imagine (פריז, צרפת).

Materials

Name Company Catalog Number Comments
PBS, pH 7.4 ThermoScientific 10010031 or equivalent
Fetal Bovine Serum ThermoScientific 16000044 or equivalent
0.2 ml tubes general lab supplier
1.5 ml tubes general lab supplier
QIAGEN QIAmp DNA mini Kit  QIAGEN 51306 or equivalent
T4 DNA ligase  New England BioLabs M0202T
T4 DNA Ligase Reaction buffer New England BioLabs M0202T
Linker Plus Strand oligonucleotide general lab supplier 5’-PO4-TAGTCCCTTAAGCGGAG-3’  (Purification grade: SDS-PAGE)
Linker Minus Strand oligonucleotide general lab supplier 5’-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3’ (Purification grade: SDS-PAGE)
Tru9I Roche-Sigma-Aldrich 11464825001
SuRE/Cut Buffer M Roche-Sigma-Aldrich 11417983001
PstI  Roche-Sigma-Aldrich 10798991001
SuRE/Cut Buffer H Roche-Sigma-Aldrich 11417991001
Platinum Taq DNA Polimerase High Fidelity  Invitrogen 11304011
10 mM dNTP Mix Invitrogen 18427013 or equivalent
PCR grade water general lab supplier
96-well thermal cycler (with heated lid) general lab supplier
linker primer general lab supplier 5’-GTAATACGACTCACTATAGGGC-3’ (Purification grade: PCR grade)
MLV-3’ LTR primer general lab supplier 5’-GACTTGTGGTCTCGCTGTTCCTTGG-3’ (Purification grade: PCR grade)
linker nested primer 454 general lab supplier 5’-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer 454 general lab supplier 5’-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
linker nested primer Illumina general lab supplier 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer Illumina general lab supplier 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
Sodium Acetate Solution (3M) pH 5.2 general lab supplier
Ethanol (absolute) for molecular biology Sigma-Aldrich E7023 or equivalent
Topo TA Cloning kit (with pCR2.1-TOPO vector) Invitrogen K4500-01
QIAquick Gel Extraction kit QIAGEN 28704
Agarose Sigma-Aldrich A9539 or equivalent
Ethidium bromide  Sigma-Aldrich E1510 or equivalent
100 bp DNA ladder Invitrogen 15628019 or equivalent
6x Loading Buffer ThermoScientific R0611 or equivalent
NanoDrop 2000 UV-Vis Spectrophotometer ThermoScientific ND-2000
Nextera XT Index kit Illumina FC-131-1001 or FC-131-1002
2x KAPA HiFi Hot Start Ready Mix  KAPA Biosystems KK2601
Dynal magnetic stand for 2 ml tubes Invitrogen 12321D or equivalent
Agencourt AMPure XP 60 ml kit Beckman Coulter Genomics A63881
Tris-HCl 10 mM, pH 8.5 general lab supplier
Agilent 2200 TapeStation system Agilent Technologies G2964AA or equivalent
D1000 ScreenTape Agilent Technologies 5067-5582 or equivalent
D1000 Reagents Agilent Technologies 5067-5583 or equivalent
KAPA Library Quantification Kit for Illumina platforms (ABI Prism) KAPA Biosystems KK4835
ABI Prism 7900HT Fast Real-Time PCR System Applied Biosystems 4329003
NaOH 1.0 N, molecular biology-grade general lab supplier
HT1 (Hybridization Buffer) Illumina  Provided in the MiSeq Reagent Kit
MiSeq Reagent Kit v3 (150 cycles) Illumina MS-102-3001
MiSeq System Illumina SY-410-1003
PhiX Control v3 Illumina FC-110-3001

DOWNLOAD MATERIALS LIST

References

  1. Ernst, J., et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature. 473, (7345), 43-49 (2011).
  2. Shlyueva, D., Stampfel, G., Stark, A. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet. 15, (4), 272-286 (2014).
  3. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  4. Heintzman, N. D., et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature. 459, (7243), 108-112 (2009).
  5. Creyghton, M. P., et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A. 107, (50), 21931-21936 (2010).
  6. Hnisz, D., et al. Super-enhancers in the control of cell identity and disease. Cell. 155, (4), 934-947 (2013).
  7. Cattoglio, C., et al. High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors. Blood. 116, (25), 5507-5517 (2010).
  8. Biasco, L., et al. Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. EMBO Mol Med. 3, (2), 89-101 (2011).
  9. De Ravin, S. S., et al. Enhancers are major targets for murine leukemia virus vector integration. J Virol. 88, (8), 4504-4513 (2014).
  10. LaFave, M. C., et al. mLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Res. 42, (7), 4257-4269 (2014).
  11. Gupta, S. S., et al. Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration. J Virol. 87, (23), 12721-12736 (2013).
  12. Sharma, A., et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proc Natl Acad Sci U S A. 110, (29), 12036-12041 (2013).
  13. De Rijck, J., et al. The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites. Cell reports. 5, (4), 886-894 (2013).
  14. Romano, O., et al. Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment. Sci Rep. 6, 24724 (2016).
  15. Cavazza, A., et al. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation. Stem Cell Reports. 6, (4), 618-632 (2016).
  16. Miller, A. D., Law, M. F., Verma, I. M. Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene. Mol Cell Biol. 5, (3), 431-437 (1985).
  17. Cattoglio, C., et al. High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion. PLoS One. 5, (12), e15688 (2010).
  18. Aiuti, A., et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science. 341, (6148), 1233151 (2013).
  19. Biffi, A., et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science. 341, (6148), 1233158 (2013).
  20. Gabriel, R., et al. Comprehensive genomic access to vector integration in clinical gene therapy. Nat Med. 15, (12), 1431-1436 (2009).
  21. Gillet, N. A., et al. The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones. Blood. 117, (11), 3113-3122 (2011).
Retroviral סריקה: מיפוי MLV אתרי אינטגרציה להגדרת אזורים רגולטוריים ספציפיים לתא
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).More

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter