Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Retroviral Scanning: Kortlægning af MLV Integration Sites til at definere Cell-specifikke Regulatory Regions

doi: 10.3791/55919 Published: May 28, 2017

Summary

Her beskriver vi en protokol for genomgående kortlægning af integrationen af ​​Moloney-murine leukæmivirusbaserede retrovirale vektorer i humane celler.

Abstract

Moloney-murine leukæmi (MLV) virusbaserede retrovirale vektorer integrerer overvejende i acetylerede forstærkere og promotorer. Af denne grund kan mLV integration sites bruges som funktionelle markører af aktive regulerende elementer. Her præsenterer vi et retroviralt scanningsværktøj, som muliggør genomspændende identifikation af cellespecifikke forstærkere og promotorer. Kort fortalt transduceres målcellepopulationen med en mlV-afledt vektor, og genomisk DNA spaltes med et hyppigt skærende restriktionsenzym. Efter ligering af genomiske fragmenter med en kompatibel DNA-linker tillader linker-medieret polymerasekædereaktion (LM-PCR) amplifikationen af ​​virus-værtsgenomforbindelserne. Massiv sekventering af ampliconerne anvendes til at definere mLV-integrationsprofilgenomet bredt. Endelig defineres klynger af tilbagevendende integrationer for at identificere cellespecifikke regulatoriske regioner, der er ansvarlige for aktiveringen af ​​specifikke transkriptionsprogrammer af celletype.

fx somatiske stamceller), der mangler robuste markører til fremtidig isolering.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Celleidentitet bestemmes ved ekspression af specifikke gener af gener. Rollen af ​​cis-regulatoriske elementer, såsom promotorer og forstærkere, er afgørende for aktiveringen af ​​specifikke transkriptionsprogrammer fra celletypen. Disse regulatoriske regioner er kendetegnet ved specifikke chromatin-egenskaber, såsom særlige histon-modifikationer, transkriptionsfaktorer og co-faktorer bindende og chromatin tilgængelighed, som i vid udstrækning er blevet anvendt til deres genom-bred identifikation i flere celletyper 1 , 2 , 3 . Især benyttes den genomgående profil af acetylering af histon H3-lysin 27 (H3K27ac) almindeligt til at definere aktive promotorer, forstærkere og superforstærkere 4 , 5 , 6 .

Moloney-muse-leukæmivirus (MLV) er et gamma-retrovirus, der er meget anvendt til genOverførsel i pattedyrsceller. Efter inficering af en målcelle omdannes det retrovirale RNA-genom retro-transkriberet i et dobbeltstrenget DNA-molekyle, som binder virale og cellulære proteiner til at samle præintegrationskomplekset (PIC). PIC kommer ind i kernen og binder værtscellechromatinet. Her medierer den virale integrase, en nøgle-PIC-komponent integrationen af ​​det provirale DNA i værtscellegenomet. MlV-integration i det genomiske DNA er ikke tilfældigt, men forekommer i aktive cis-regulatoriske elementer, såsom promotorer og enhancere, på en cellespecifik måde 7 , 8 , 9 , 10 . Denne særlige integrationsprofil er medieret af en direkte interaktion mellem mLV integrasen og det cellulære bromodomain og extraterminalt domæne (BET) proteinerne 11 , 12 , 13 . BET proteiner (BRD2, BRD3 ogBRD4) virker som en bro mellem værtschromatin og mLV PIC: gennem deres bromodominer genkendes de stærkt acetylerede cis-regulatoriske regioner, mens extraterminalt domænet interagerer med mLV integrase 11 , 12 , 13 .

Her beskriver vi retroviral scanning, et nyt værktøj til kortlægning af aktive cis-regulatoriske regioner baseret på integrationen af ​​mLV. Kort fortalt transduceres celler med mLV-afledt retroviral vektor, der udtrykker det forstærkede grønne fluorescerende protein (eGFP) reportergen. Efter genomisk DNA-ekstraktion amplificeres krydsningerne mellem den 3'-lange terminale gentagelse (LTR) af mlV-vektoren og det genomiske DNA ved hjælp af linkermedieret PCR (LM-PCR) og massivt sekventeret. MlV-integrationssteder kortlægges til det humane genom og genomiske regioner, der er højt målrettet af mLV, defineres som klynger af mLV-integrationssteder.

Retroviral scanningNing blev anvendt til at definere celle-specifikke aktive regulatoriske elementer i adskillige humane primære celler 14 , 15 . MLV-klynger co-mapped med epigenetisk definerede promotorer og enhancers, hvoraf de fleste indeholdt aktive histonmærker, såsom H3K27ac, og var celle-specifikke. Retroviral scanning tillader genomfattende identifikation af DNA-regulatoriske elementer i prospektivt rensede cellepopulationer 7 , 14 såvel som i efterfølgende definerede cellepopulationer, såsom keratinocytstamceller, der mangler effektive markører til fremtidig isolering 15 .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. MLV-transduktion af humane celler

  1. Isoler målceller og transducer dem med en mLV-afledt retroviral vektor, der huser eGFP-reportergenet og pseudotypes med vesikulært stomatitisvirus G (VSV-G) eller det amfotrope kuvertglykoprotein 16 .
    1. Hold mock-transducerede celler som en negativ kontrol for de følgende analyser. Da mLV-baserede retrovirale vektorer kan transducere effektivt delende celler, dyrker målcellepopulationen i tilstande, der stimulerer celledeling. Transduktionsbetingelserne skal specifikt optimeres for hver celletype under undersøgelse. Cellevækst og transduktionsbetingelser for humane hæmatopoietiske stamceller, T-celler og epidermale celler er beskrevet i Referencerne 7, 14, 15 og 17.
  2. 48 timer efter transduktion, resuspender 100.000 celler i 300 μl phosphatbufret saltopløsning (PBS) indeholdende 2% føtalt bovint serum og måle eGFP-ekspression ved fLav cytometrisk analyse (488 nm excitationslaser). Brug mock-transducerede celler som negativ kontrol. For optimal optagelse af integrationssites, rens GFP + -celler ved hjælp af fluorescensaktiveret cellesortering (FACS).
  3. Indsamle 0,5 til 5 millioner celler til genomisk DNA-præparation. En længere kulturperiode (> 7 dage) foretrækkes for at fortynde det uintegrerede provirus og er nødvendigt, når man analyserer den langsigtede afkom af bona fide stamceller (se diskussionsafsnit og reference 15 ). Cellepellets kan snapsfrosne og opbevares ved -80 ° C indtil brug.

2. Amplifikation af mLV-integrationssteder ved linker-medieret-PCR (LM-PCR)

  1. Fremstilling af genomisk DNA (gDNA)
    1. Udvind gDNA ved anvendelse af et kolonnebaseret DNA-ekstraktionskit og følg protokollen for dyrkede celler i henhold til producentens anvisninger.
  2. Restriktionsenzym digesti
    1. Opsæt 4 restriktionsenzymfordøjelser pr. Prøve i 1,5 ml rør. Fordøj 0,1 til 1 μg gDNA i hvert rør ved at tilsætte 1 μl Tru9I (10U) og 1 μl buffer M i et slutvolumen på 10 μl. Inkuber reaktionerne ved 65 ° C i 6 timer eller natten over.
    2. Til hver reaktion tilsættes 1 μl PstI (10 U), 1 μl buffer H og 8 μl vand. Inkuber reaktionerne ved 37 ° C i 6 timer eller natten over. Prøver kan opbevares ved -20 ° C indtil brug.
  3. Linker ligation
    1. Forbered en 100 μM Tru9I linker stamopløsning i et 1,5 ml rør ved at blande linker plus streng og linker minus streng oligonukleotider ved en 100 μM koncentration. Sæt røret i et vand indstillet til 100 ° C og lad det afkøle ved stuetemperatur. Tru9I linker stamopløsning kan opbevares ved -20 ° C indtil brug.
    2. Opsæt 8 linkerligationsreaktioner i 1,5 ml rør. Til hver reaktion tilføjes følgende komponentS til 10 μl restriktionsenzymfordøjelse: 1,4 μl 10X T4 DNA ligase-reaktionsbuffer, 1 μl 10 μM linker Tru9I, 1 μl (2000U) T4 DNA-ligase og 0,6 μl vand. Inkuber ved 16 ° C i 3 til 6 timer. Prøver kan opbevares ved -20 ° C indtil brug.
  4. Første PCR
    1. Opsæt 48 PCR-reaktioner (6 reaktioner fra hvert ligeringsrør) i 0,2 ml rør. Til hver PCR tilsættes følgende reagenser til 2 μl ligeringsreaktion: 5 μl 10X PCR-buffer, 2 μl 50 mM magnesiumsulfat, 1 μl 10 mM deoxynukleotid (dNTP) -blanding, 1 μl 10 μM linker primer, 1 ΜL 10 μM mLV-3 'LTR primer, 0,3 μl (1,5 U) Taq DNA-polymerase og 37,7 μl vand. Primersekvenser er angivet i tabel 1.
    2. Udfør PCR-reaktion i en termisk cykler med opvarmet låg, som følger: 95 ° C i 2 minutter; 25 cyklusser på 95 ° C i 15 s, 55 ° C i 30 s, 72 ° C i 1 min; 72 °C i 5 minutter; Hold ved 4 ° C. Prøver kan opbevares ved -20 ° C indtil brug.
  5. Anden PCR
    1. Opsæt 48 PCR reaktioner (1 fra hvert "første PCR" rør) i 0,2 ml rør. For hver PCR tilføjes følgende komponenter til 2 μl af den første PCR-reaktion: 5 μl 10X PCR-buffer, 2 μl 50 mM magnesiumsulfat, 1 μl 10 mM dNTP-blanding, 1 μl 10 μM linkerbundet primer, 1 ΜL 10 μM mLV-3 'LTR-indlejret primer, 0,3 μl Taq DNA-polymerase (1,5 U) og 37,7 μl vand. Brug nestede primere designet til den specifikke massive sekventeringsstrategi valgt: (i) linker nestet primer og mLV-3 'LTR nestet primer kompatibel med Illumina platform; (Ii) linker nestet primer og mLV-3 'LTR nestet primer kompatibel med Roche platform. Primersekvenser er angivet i tabel 1 .
    2. Udfør PCR-reaktion i en termisk cykler med opvarmet låg, som følger: 95 ° C i 2 minutter; 25Cyklusser på 95 ° C i 15 s, 58 ° C i 30 s, 72 ° C i 1 min; 72 ° C i 5 minutter; Hold ved 4 ° C. Prøver kan opbevares ved -20 ° C indtil brug.
    3. Pool de 48 indlejrede PCR-reaktioner i et 15 ml rør (slutvolumen på 2,4 ml). Prøver kan opbevares ved -20 ° C indtil brug.
  6. Bestem tilstedeværelsen og størrelsen af ​​LM-PCR-produkterne ved hjælp af agarosegelelektroforese.
    1. Tilsæt 4 μL påfyldningsbuffer til 20 μl LM-PCR-produkter og lad prøven på en 1% agarosegel sammen med en 100 bp DNA-stige. Kør gelen ved 5 V / cm i 30 til 60 min og visualiser PCR-produkterne ved ethidiumbromidfarvning.
    2. Kør en LM-PCR-reaktion fra den mock-transducerede prøve som negativ kontrol.
  7. Præcipiter ampliconerne ved at tilsætte 0,1 volumener natriumacetatopløsning (3 M, pH 5,2) og 2,5 volumener 100% ethanol. Bland og frys ved -80 ° C i 20 minutter.
    1. Spin at fuLl hastighed i en standard mikrocentrifuge ved 4 ° C i 20 minutter. Kassér supernatanten og vask pelleten med 70% ethanol. Spin ved fuld hastighed i en standard mikrocentrifuge ved 4 ° C i 5 min.
    2. Kassér supernatanten og lufttør pelleten. Tilsæt 200 μl vand af PCR-kvalitet og resuspender DNA'et. Prøver kan opbevares ved -20 ° C indtil brug.
  8. Tilsæt 20 μL påfyldningsbuffer til 100 μl af LM-PCR-produkterne og lad prøven påføres på en 1% agarosegel sammen med en 100 bp DNA-stige.
    1. Kør gelen ved 5 V / cm i 30 til 60 minutter og skar den del af gelen, der indeholder 150 til 500 bp lange ampliconer.
    2. Rens LM-PCR-produkterne med et kolonnebaseret gelekstraktionskit og måle koncentrationen ved hjælp af et UV-spektrofotometer.
  9. Brug 1 μL bibliotek til at vurdere længden af ​​LM-PCR-produkterne ved hjælp af et bioanalysatorinstrument i overensstemmelse med producentens anvisninger.
  10. Brug 20 ng af de oprensede LM-PCR-produkter og klon dem i pCR2.1-TOPO-vektoren i overensstemmelse med producentens anvisninger.
  11. Udfør sekventeringsreaktioner under anvendelse af den universelle M13-primer efterfulgt af genomisk kortlægning af de resulterende sekvenser for at afsløre tilstedeværelsen af ​​virale genomtransportioner (inklusiv mlV-3'-LTR-indlejret primer) i> 50% af klonerne for at identificere prøver egnede Til massiv sekventering. Eksempel på et viral-genomklemme:
    Knudepunkt
    MLV-3 'LTR nestet primer 454 og linker nestet primer 454 ( tabel 1 ) er angivet med fed skrift og 3'-enden af ​​den virale LTR i kursiv. Den humane genomiske sekvens er fremhævet i rød tekst (chr10: 6439408-6439509, hg19).

3. Massiv sekventering af mLV Integration Sites

BEMÆRK: LM-PCR prodUcts kan sekventeres ved brug af kommercielle platforme (vælg det korrekte nestede primerpar i den anden PCR-reaktion, se afsnit 2.5.1). Til sekventering af Roche GS-FLX pyrosequencing platform henvises til tidligere papirer 7 , 14 , 15 . I dette afsnit beskrives en nyoptimeret protokol til Illumina-sekventeringsplatform.

  1. Bibliotek forberedelse
    1. Opsæt 1 indeksering PCR reaktion pr. Prøve i 0,2 ml rør. For hver PCR tilsættes følgende reagenser til 5 μl (150-170 ng) af oprenset LM-PCR-produkt: 5 μl Index Primer 1, 5 μL Index Primer 2, 25 μL 2X Master Mix og 10 μl PCR- Grade vand. Brug en anden indekskombination for hver prøve.
    2. Udfør PCR-reaktioner i en termisk cykler med opvarmet låg, som følger: 95 ° C i 3 minutter; 8 cyklusser på 95 ° C i 30 s, 55 ° C i 30 s, 72 ° C i 30 s; 72 ° C i 5 mi; Hold ved 4 ° C.
    3. Rens PCR-produkterne ved hjælp af en fast fase reversibel immobiliseringsprotokol (SPRI): i nye 1,5 ml rør tilsættes 56 μL perler til hver prøve og fortsæt efter producentens anvisninger. Eluer i 25 μl Tris-HCI 10 mM. Biblioteker kan opbevares ved -20 ° C indtil brug.
  2. Bibliotekskontrol
    1. Brug 1 μL prøve til at vurdere bibliotekets størrelse ved hjælp af et bioanalysatorinstrument.
    2. Brug 1 μL prøve til at kvantificere biblioteksmolaritet ved hjælp af en fluorescensbaseret realtids-PCR-analyse i overensstemmelse med producentens anvisninger.
  3. Bibliotek fortynding og sekventering
    1. Fortynd biblioteker til 10 nM ved anvendelse af Tris-HCI 10 mM. Til samling af biblioteker overføres 5 μl af hvert fortyndet bibliotek til et nyt 1,5 ml rør og fortyndes derefter puljen til 4 nM i Tris-HCI 10 mM.
    2. Bland 5 μl fortyndet pool med 5 μL 0,2 N NaOH i en ny 1,5 mL rør, hvirvel kort, spin-down og inkuber i 5 minutter ved stuetemperatur for at denaturere bibliotekerne.
    3. Sæt rør på is og tilsæt 990 μL forkølet hybridiseringsbuffer (HT1). Aliquot 300 μl denatureret pool i et nyt 1,5 ml rør og tilsæt 300 μL afkølet HT1 for at opnå en 10 pM endelig bibliotekspool.
    4. Parallelt blandes 2 μl PhiX kontrolbibliotek (10 nM) med 3 μl Tris-HCI 10 mM i et 1,5 ml rør. Tilsæt 5 μL NaOH 0,2 N, hvirvel kort, spin-down og inkuber i 5 minutter ved stuetemperatur for at denaturere den fortyndede PhiX. Sæt rør på is og tilsæt 990 μL forkølet HT1.
    5. Aliquot 300 μl denatureret PhiX i et nyt 1,5 ml rør og tilsæt 300 μL afkølet HT1 for at opnå en 10 pM endelig PhiX.
    6. I et nyt 1,5 ml rør blandes 510 μl denatureret bibliotekspool med 90 μl denatureret PhiX bibliotek, hvorved der opnås en endelig 10 pM pool med 15% PhiX kontrol.
    7. Pipetter disse 600 μL prøveVolumen ind i opsamlingsreservoiret for den optøede sekventeringsreagenspatron og fortsæt med det samme for at udføre en enkeltlæsning på 150 cykler.
      BEMÆRK: De kritiske reagenser og primer sekvenser, der kræves til denne protokol, er angivet i tabel 1 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Arbejdsstrøm af den retrovirale scanningsprocedure

Arbejdsstrømmen for retroviral scanningsproceduren er skematiseret i figur 1 . Målcellepopulationen renses og transduceres med en mLV-afledt retroviral vektor, der udtrykker et eGFP-reportergen. Transgenet flankeres af de to identiske lange terminale gentagelser (5'- og 3'-LTR), der sikrer syntese, revers transkription og integration af virusgenomet i værts-DNA. Transduktionseffektiviteten vurderes ved FACS-analyse af eGFP-ekspression. Cellepopulationen indeholdende en høj andel (> 30%) mLV-transducerede celler amplificeres og lyseres efterfølgende for at ekstrahere genomisk DNA indeholdende de integrerede mLV virale kassetter. Genomisk DNA spaltes og ligeres med en kompatibel linker, og krydsningerne mellem de virale 3'-LTR'er og værtsgenomet amplificeres ved LM-PCR. VirUs-vært genomkrydsninger er så massivt sekventeret ved hjælp af Roche eller Illumina platforme. Endelig er mlV-integrationssteder kortlagt til det humane genom til at definere genomiske klynger af tilbagevendende insertionssteder.

Amplifikation af mLV-integrationssteder ved LM-PCR

LM-PCR'en er skematiseret i figur 2 . Genomisk DNA ekstraheres fra mLV-transducerede celler og fordøjes med Tru9I-restriktionsenzymet, som ofte skærer det humane genom, der genererer fragmenter med en median længde på 70 bp. Et andet restriktionsenzym (PstI) anvendes til at forhindre amplifikation af integrerede og ikke-integrerede interne 5'-LTR-fragmenter. En Tru9I dobbeltstrenget linker ligeres derefter til de genomiske fragmenter, og LM-PCR udføres med primere, der er specifikke for linkeren og 3'-LTR'et for at amplificere virus-værtsgenomforbindelserne. Nested PCR kan udføres under anvendelse af priMers kompatible med Roche eller Illumina sequencing platforme.

Analyse af virus-værtsgenomforbindelsesamplikoner

I eksperimentet repræsenteret i figur 3 rensede vi CD34 - CD13 + myeloide stamceller / precursorer (MPP) og transducerede dem med en mLV-afledt retroviral, som udtrykte eGFP-reportergenet. Mere end 60% af MPP-celler udtrykte eGFP 48 timer efter transduktion (data ikke vist). 15 dage efter transduktion opsamlede vi cellerne, ekstraherede gDNA og amplificerede virus-værtsgenom-forbindelserne som beskrevet ovenfor. En alikvot af de puljerede LM-PCR-produkter blev fyldt på en 1% agarosegel for at verificere tilstedeværelsen og størrelsen af ​​ampliconerne. Vi har med succes visualiseret et DNA-smear svarende til LM-PCR-produkterne i forskellige størrelser, fra 150 til 500 bp ( figur 3A ). Ampliconer var daKoncentreret ved DNA-udfældning og påsat på en 1% agarosegel. LM-PCR-produkter blev gelrenset og kørt på et bioanalysatorsystem, hvilket bekræfter de forventede ampliconstørrelser (mellem 150 og 500 bp, figur 3B ).

Kortlægning af mLV-integreringer i aktive og celle-specifikke regulatoriske regioner

I eksperimentet rapporteret i figur 4 blev hæmatopoietiske stamceller / stamceller (HSPC), erythroid-stamceller / precursorer (EPP) og myeloid stamceller / forstadier (MPP) transduceret med en mLV-afledt retroviral vektor. Disse resultater blev opnået behandling og sekventering af prøver afledt fra forskellige celletyper separat for at undgå de potentielle forurening / kollisioner 18 , 19 . Råsekvenslæsninger genereret ved massiv sekventering blev behandlet af en automatiseret bioinformatikRørledning for at eliminere virus- og linkersekvenser. Derefter blev unikke sekvenser på mindst 20 bp kortlagt på det humane genom ved anvendelse af Blat 17 . Råjusteringer blev filtreret, hvilket kræver, at kampen skulle starte inden for de første 3 nukleotider, univokale kampe og mindst 95% identitet. Klynger af tilbagevendende mLV-integreringer blev defineret ved en statistisk sammenligning med et datasæt af tilfældige genomiske sekvenser, der genererede tilfældigt ekstrahering af genomiske positioner fra det humane genom med et Tru91-restriktionsmotiv i en afstand, der var kompatibel med sekventeringsplatformen. Kontrolsekvenser blev derefter behandlet gennem samme kortlægnings- og filtreringsrørledning anvendt til integrationssekvenser for at generere et tilfældigt sæt af unikke steder. For at definere mLV-klynger anvendte vi DBSCAN-klyngningsalgoritmen 19 , idet man sammenlignede fordelingen af ​​på hinanden følgende mLV-integreringer med den for et lige antal tilfældige steder for at identificere regioner med stærkt klyngede integrationer, hvilket defIne celle-specifikke regulatoriske elementer 7 , 14 , 15 . For at undgå dannelsen af ​​falske klynger blev multiple ekstraktioner fra random-styret datasættet udført. Vi kortlagt ved henholdsvis LM-PCR og pyrosequencing 32.574, 27.546 og 36.358 mLV integrationssteder i henholdsvis HSPC, EPP og MPP. Klynger af tilbagevendende mLV-integreringer co-mapped med acetylerede enhancere og promotorer ( Figur 4A ). De fleste af de mlV-målrettede regulatoriske regioner var celle-specifikke, såsom: (i) promotoren af HSPC- specifikt SPINK2- gen ( figur 4B ); (Ii) Locus Control Region indeholdende potent forstærkere af de erythroid-specifikke β-lignende globin gener ( Figur 4C ); (Iii) forstærkere placeret opstrøms for det MPP- specifikke LYZ- gen ( figur 4D ). Endelig anvendte vi luciferase-analyser for at validereEn delmængde af formodede cellespecifikke mLV-målrettede enhancere i EPP og MPP ( Figur 4E ).

figur 1
Figur 1: En generel skitse af den retrovirale integrationssite kortlægningsprocedure. Målceller transduceres med en mlV-baseret retroviral vektor indeholdende en eGFP-kassette. Genomisk DNA opnået fra transducerede celler fordøjes med Tru9I og ligeres med en kompatibel Tru9I dobbeltstrengslinker. MlV-integrationssteder blev amplificeret ved indlejret LM-PCR, og biblioteket af virus-værtsgenom-krydsninger kan massivt sekventeres ved anvendelse af Illumina- eller Roche-platforme. De resulterende læsninger blev kortlagt til det humane genom for at definere klynger af tilbagevendende mLV-integreringer. Klik her for at se en større version af denne figur. </ P>

Figur 2
Figur 2: Amplifikation af virus-værtsgenomkryds af LM-PCR. Genomisk DNA (gDNA) indeholdende det integrerede mLV-provirus fordøjes med Tru9I- og PstI-restriktionsenzymer og ligeres med en kompatibel Tru9I-linker. Nested PCR udføres under anvendelse af primere, der er specifikke for LTR og linkeren. Tru9l- og Pstl-restriktionssteder i viruset og i det humane genom er angivet. Klik her for at se en større version af denne figur.

Figur 3
Figur 3: Analyse af LM-PCR ampliconer. ( A ) LM-PCR-produkter (bane +) blev kørt på en 1% agarosegel og visualiseretVed ethidiumbromidfarvning. En ingen skabelonprøve fungerede som negativ kontrolprøve, hvor kun PCR-primere blev visualiseret (bane -). ( B ) Efter gelrensning blev LM-PCR produktstørrelse kontrolleret ved mikrokapillærelektroforese. Prøvestørrelse (bp) og fluorescensintensitet (FU) er vist på henholdsvis x og y-akserne i elektroferogrammet. Klik her for at se en større version af denne figur.

Figur 4
Figur 4: Kortlægning af mLV-integration i epigenetisk definerede regulatoriske regioner. ( A ) Vi definerede 3,498, 2,989 og 4,103 klynger af tilbagevendende mLV-integrationssteder i henholdsvis HSPC, EPP og MPP. I hver cellepopulation overlappedes> 95% mlV-klynger med epigenetisk defineret enhancErs og promotorer. ( B , C og D ) Cellespecifikke mLV-målrettede regioner blev yderst acetylerede og associeret med cellespecifik ekspression af det målrettede gen ( SPINK2 , HBB og LYZ , næsten udelukkende udtrykt i henholdsvis HSPC, EPP og MPP som bestemt Ved Cap analyse af gen ekspression). MLV enkeltintegrationer er afbildet med små stænger. TPM angiver tag pr. Million. ( E ) Putative celspecifikke mLV-målrettede enhancere i EPP og MPP. Figur 4 er tilpasset fra reference 14 . Vi har fået tilladelse til at genbruge denne figur under Creative Commons-licensen. Klik her for at se en større version af denne figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Her beskrev vi en protokol for genomgående kortlægning af integrationsstederne for mLV, et retrovirus, der målretter chromatinområder, epigenetisk markeret som aktive promotorer og enhancere. Kritiske trin og / eller begrænsninger af protokollen omfatter: (i) mLV-transduktion af målcellepopulationen; (Ii) amplifikation af virus-værtsforbindelser med LM-PCR; (Iii) hentning af en høj del af integrationssteder. MLV-baserede retrovirale vektorer transducerer effektivt dividende celler. Den lave effektivitet ved transduktion af ikke-delende celler (fx postmittotiske neuronale celler) er en potentiel begrænsning af denne teknik. Det kan imidlertid overvindes ved celle sortering af den transducerede population baseret på ekspressionen af ​​reportergenet ( fx eGFP). Generationen af ​​relativt korte ampliconer ved LM-PCR (150 til 500 bp) er obligatorisk til at generere et bibliotek af amplikoner, der er kompatible med de i øjeblikket anvendte massive sekventeringsstrategier og at tillade en omfattende genOme-bred analyse af mLV integration sites. Som et eksempel kan amplifikation af LM-PCR-produkter med> 500 bp skyldes enten delvis genomisk DNA-fordøjelse eller intra-ligering af Tru9I-fordøjede genomiske fragmenter, som evalueret ved haglgevirkeklonering af LM-PCR-amplikoner (data ikke vist). I det første tilfælde kan problemet løses ved yderligere optimering af genomiske DNA-fordøjelsesbetingelser, hvorimod i sidstnævnte tilfælde den vellykkede massive sekventering af mLV-integrationssteder kan udføres ved en gelrensning af ampliconer mellem 150 og 500 bp. Endelig kan anvendelsen af ​​restriktionsenzymer til at skære det genomiske DNA føre til præferenceopbygning og påvisning af integrationssteder, som ligger tæt på et restriktionssted. Andelen af ​​integrationssites, som Tru9I-restriktionsenzymet kan hente, anslås til ~ 50%. Denne teknik kan således yderligere optimeres for at forbedre integrationsstedets hentning ved anvendelse af flere restriktionsenzymer eller udførelse af tilfældig DNA-sheariNg ved sonication 20 , 21 .

For nylig har vi optimeret sekventeringen af ​​virale integrationssteder ved hjælp af den udbredte Illumina platform, som beskrevet i dette papir. Denne sekventerings tilgang gør det muligt at generere et højere antal læs pr. Runde sammenlignet med Roche-platformen, hvilket i høj grad øger antallet af integrationssites hentet fra et enkelt eksperiment, hvilket globalt reducerer tid og omkostninger.

Genomfattende identifikation af cellespecifikke regulatoriske regioner kræver kortlægning af en til tre histonmodifikationer med ChIP-seq 6 (mono- og trimethylering af histon H3-lysin 4 for at identificere enhancere og promotorer og H3K27ac at skelne mellem aktive og inaktive Regulatoriske elementer) 4 , 5 , 6 og en systematisk sammenligning af forskellige celletyper til at definereCis-virkende elementer, der udelukkende virker i en bestemt cellepopulation. Vi kortlagde mLV-integrationssteder i potentielt isolerede målcellepopulationer, såsom multipotente hæmatopoietiske stamceller og deres engagerede erythroid og myeloid afkom 14 , embryonale stamceller, neuroepitheliale-lignende stamceller og differentierede keratinocytter 15 . Retroviral scanning tillod den genomgående definition af cellepecifikke regulatoriske elementer i hver cellepopulation, der blev analyseret, hvilket gjorde de komparative genome-brede undersøgelser ikke strengt nødvendige. Det er vigtigt, at dette værktøj anvendes til identifikation af aktive reguleringselementer i sjældne cellepopulationer ( fx somatiske stamceller), der mangler robuste markører for fremtidig isolation og ikke kan analyseres ved ChIP-seq-baseret analyse af histon-modifikationer 15 . I disse cellepopulationer er mLV-integration en permanent genetisk markør for aktive regulatoriske regioner, der tillader thEir retrospektiv identifikation i den mere rigelige celleafkom in vitro og in vivo. Som et eksempel brugt vi succesfuldt mLV integrationsklynger som surrogatmarkører for promotorer og enhancere i en retrospektivt identificeret keratinocyt stamcelle (KSC) population. Vi transducerede en tidlig-passage, forhudsafledt keratinocytkultur indeholdende KSC'er med en mlV-vektor, så passerede vi disse celler til> 35 celle dublinger for at berige i afkom af KSC'er, således defineret af deres evne til at opretholde kulturen for dette antal passager. I dette tilfælde markerede mLV-integreringer permanent de regulatoriske regioner, der var aktive i den oprindelige transducerede KSC-population 15 . Fremtidige undersøgelser vil sigte på at identificere cellespecifikke reguleringselementer i et større antal sjældne humane stamcellepopulationer på genoom.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Dette arbejde blev støttet af tilskud fra Det Europæiske Forskningsråd (ERC-2010-AdG, GT-SKIN), det italienske ministerium for uddannelse, universiteter og forskning (FIRB-Futuro i Ricerca 2010-RBFR10OS4G, FIRB-Futuro i Ricerca 2012-RBFR126B8I_003 , EPIGEN Epigenomics Flagskibsprojekt), Det Italienske Sundhedsministerium (Unge forskere Ring 2011 GR-2011-02352026) og Imagine Institute Foundation (Paris, Frankrig).

Materials

Name Company Catalog Number Comments
PBS, pH 7.4 ThermoScientific 10010031 or equivalent
Fetal Bovine Serum ThermoScientific 16000044 or equivalent
0.2 ml tubes general lab supplier
1.5 ml tubes general lab supplier
QIAGEN QIAmp DNA mini Kit  QIAGEN 51306 or equivalent
T4 DNA ligase  New England BioLabs M0202T
T4 DNA Ligase Reaction buffer New England BioLabs M0202T
Linker Plus Strand oligonucleotide general lab supplier 5’-PO4-TAGTCCCTTAAGCGGAG-3’  (Purification grade: SDS-PAGE)
Linker Minus Strand oligonucleotide general lab supplier 5’-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3’ (Purification grade: SDS-PAGE)
Tru9I Roche-Sigma-Aldrich 11464825001
SuRE/Cut Buffer M Roche-Sigma-Aldrich 11417983001
PstI  Roche-Sigma-Aldrich 10798991001
SuRE/Cut Buffer H Roche-Sigma-Aldrich 11417991001
Platinum Taq DNA Polimerase High Fidelity  Invitrogen 11304011
10 mM dNTP Mix Invitrogen 18427013 or equivalent
PCR grade water general lab supplier
96-well thermal cycler (with heated lid) general lab supplier
linker primer general lab supplier 5’-GTAATACGACTCACTATAGGGC-3’ (Purification grade: PCR grade)
MLV-3’ LTR primer general lab supplier 5’-GACTTGTGGTCTCGCTGTTCCTTGG-3’ (Purification grade: PCR grade)
linker nested primer 454 general lab supplier 5’-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer 454 general lab supplier 5’-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
linker nested primer Illumina general lab supplier 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer Illumina general lab supplier 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
Sodium Acetate Solution (3M) pH 5.2 general lab supplier
Ethanol (absolute) for molecular biology Sigma-Aldrich E7023 or equivalent
Topo TA Cloning kit (with pCR2.1-TOPO vector) Invitrogen K4500-01
QIAquick Gel Extraction kit QIAGEN 28704
Agarose Sigma-Aldrich A9539 or equivalent
Ethidium bromide  Sigma-Aldrich E1510 or equivalent
100 bp DNA ladder Invitrogen 15628019 or equivalent
6x Loading Buffer ThermoScientific R0611 or equivalent
NanoDrop 2000 UV-Vis Spectrophotometer ThermoScientific ND-2000
Nextera XT Index kit Illumina FC-131-1001 or FC-131-1002
2x KAPA HiFi Hot Start Ready Mix  KAPA Biosystems KK2601
Dynal magnetic stand for 2 ml tubes Invitrogen 12321D or equivalent
Agencourt AMPure XP 60 ml kit Beckman Coulter Genomics A63881
Tris-HCl 10 mM, pH 8.5 general lab supplier
Agilent 2200 TapeStation system Agilent Technologies G2964AA or equivalent
D1000 ScreenTape Agilent Technologies 5067-5582 or equivalent
D1000 Reagents Agilent Technologies 5067-5583 or equivalent
KAPA Library Quantification Kit for Illumina platforms (ABI Prism) KAPA Biosystems KK4835
ABI Prism 7900HT Fast Real-Time PCR System Applied Biosystems 4329003
NaOH 1.0 N, molecular biology-grade general lab supplier
HT1 (Hybridization Buffer) Illumina  Provided in the MiSeq Reagent Kit
MiSeq Reagent Kit v3 (150 cycles) Illumina MS-102-3001
MiSeq System Illumina SY-410-1003
PhiX Control v3 Illumina FC-110-3001

DOWNLOAD MATERIALS LIST

References

  1. Ernst, J., et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature. 473, (7345), 43-49 (2011).
  2. Shlyueva, D., Stampfel, G., Stark, A. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet. 15, (4), 272-286 (2014).
  3. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  4. Heintzman, N. D., et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature. 459, (7243), 108-112 (2009).
  5. Creyghton, M. P., et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A. 107, (50), 21931-21936 (2010).
  6. Hnisz, D., et al. Super-enhancers in the control of cell identity and disease. Cell. 155, (4), 934-947 (2013).
  7. Cattoglio, C., et al. High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors. Blood. 116, (25), 5507-5517 (2010).
  8. Biasco, L., et al. Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. EMBO Mol Med. 3, (2), 89-101 (2011).
  9. De Ravin, S. S., et al. Enhancers are major targets for murine leukemia virus vector integration. J Virol. 88, (8), 4504-4513 (2014).
  10. LaFave, M. C., et al. mLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Res. 42, (7), 4257-4269 (2014).
  11. Gupta, S. S., et al. Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration. J Virol. 87, (23), 12721-12736 (2013).
  12. Sharma, A., et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proc Natl Acad Sci U S A. 110, (29), 12036-12041 (2013).
  13. De Rijck, J., et al. The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites. Cell reports. 5, (4), 886-894 (2013).
  14. Romano, O., et al. Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment. Sci Rep. 6, 24724 (2016).
  15. Cavazza, A., et al. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation. Stem Cell Reports. 6, (4), 618-632 (2016).
  16. Miller, A. D., Law, M. F., Verma, I. M. Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene. Mol Cell Biol. 5, (3), 431-437 (1985).
  17. Cattoglio, C., et al. High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion. PLoS One. 5, (12), e15688 (2010).
  18. Aiuti, A., et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science. 341, (6148), 1233151 (2013).
  19. Biffi, A., et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science. 341, (6148), 1233158 (2013).
  20. Gabriel, R., et al. Comprehensive genomic access to vector integration in clinical gene therapy. Nat Med. 15, (12), 1431-1436 (2009).
  21. Gillet, N. A., et al. The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones. Blood. 117, (11), 3113-3122 (2011).
Retroviral Scanning: Kortlægning af MLV Integration Sites til at definere Cell-specifikke Regulatory Regions
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).More

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter