Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Retroviral Tarama: Hücreye Özel Düzenleyici Bölgeleri Tanımlamak İçin MLV Entegrasyon Konumlarının Haritalandırılması

doi: 10.3791/55919 Published: May 28, 2017

Summary

Burada, insan hücrelerinde Moloney fare lösemi virüsü tabanlı retroviral vektörlerin entegrasyon alanlarının genom çapında haritalanması için bir protokolü açıklıyoruz.

Abstract

Moloney sıçangil lösemisi (MLV) virüs esaslı retroviral vektörler ağırlıklı olarak asetile arttırıcılar ve yükselticiler ile bütünleşir. Bu nedenle, mLV entegrasyon bölgeleri, aktif düzenleyici elementlerin işlevsel belirteçleri olarak kullanılabilir. Burada, hücreye özgü güçlendiricilerin ve yükselticilerin genom çapında tanımlanmasına olanak tanıyan bir retroviral tarama aleti sunuyoruz. Kısacası, hedef hücre popülasyonu, bir mLV türevi vektör ile transdüser hale getirilir ve genomik DNA sık sık kesme kısıtlama enzimi ile sindirilir. Genomik fragmanları uyumlu bir DNA bağlayıcısı ile bağladıktan sonra, linker aracılı polimeraz zincir reaksiyonu (LM-PCR), virüs konakçı genom kavşaklarının çoğaltılmasına izin verir. Genis çapında mLV entegrasyon profilini tanımlamak için amplikonların seri sıralaması kullanılır. Son olarak, tekrarlayan entegrasyon kümeleri, hücre tipine özgü transkripsiyonel programların aktivasyonundan sorumlu, hücreye özgü düzenleyici bölgelerin tanımlanması için tanımlanır.

ör., Somatik kök hücreler) retrospektif olarak tanımlanması için bir enstrümantal tekniktir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hücre kimliği, spesifik gen gruplarının ifadesi ile belirlenir. Organizmalar ve arttırıcılar gibi cis düzenleyici elemanların rolü, hücre tipi spesifik transkripsiyonel programların aktivasyonu için çok önemlidir. Bu düzenleyici bölgeler, çeşitli hücre tipleri 1 , 2 , 3'te genom geniş tanımlaması için yaygın olarak kullanılan özel histon modifikasyonları, transkripsiyon faktörleri ve ko-faktör bağlama ve kromatin erişilebilirliği gibi spesifik kromatin özellikleri ile karakterizedir. Özellikle, histone H3 lizin 27'nin (H3K27ac) asetillenmesinin genom çapındaki profili aktif promotörleri, arttırıcıları ve süper arttırıcıları 4 , 5 , 6 tanımlamak için yaygın olarak kullanılır.

Moloney fare lösemi virüsü (MLV) gen için yaygın olarak kullanılan bir gamma-retrovirüsüdürMemeli hücrelerinde transfer. Bir hedef hücrenin enfekte edilmesinden sonra, retroviral RNA genomu, ön entegrasyon kompleksini (PIC) birleştirmek için viral ve hücresel proteinleri bağlayan çift sarmallı bir DNA molekülüne retro-transkribe edilir. PIC çekirdeğe girer ve konakçı hücre kromatini bağlar. Burada, anahtar bir PIC bileşeni olan viral integraz, proviral DNA'nın konukçu hücre genomuna entegrasyonuna aracılık eder. Genomik DNA'daki mLV entegrasyonu rasgele değil, ancak promotör ve güç arttırıcılar gibi aktif cis düzenleyici elemanlarda, hücreye özel bir biçimde 7 , 8 , 9 , 10 meydana gelir. Bu özel entegrasyon profiline, mLV integraz ile hücresel bromodomain ve ekstraterminal alan (BET) proteinleri 11 , 12 , 13 arasındaki doğrudan etkileşim aracılık eder. BET proteinleri (BRD2, BRD3 veBRD4), konak kromatin ve mLV PIC arasında bir köprü görevi görürler: ekstratik alan, mLV integraz 11,12,13 ile etkileşirken, bromodomainsleri yoluyla yüksek oranda asetillenmiş cis düzenleyici bölgeleri tanımaktadırlar.

Burada, mLV'nin entegrasyon özelliklerine dayalı aktif cis düzenleyici bölgeleri haritalamak için yeni bir araç olan retroviral taramayı tarif ediyoruz. Kısaca hücreler, arttırılmış yeşil floresan protein (eGFP) raportör genini eksprese eden mLV türevi retroviral vektör ile transdüser hale getirilir. Genomik DNA özümlemesinden sonra, mLV vektörünün 3 'uzun terminal tekrarlaması (LTR) ile genomik DNA arasındaki bağlantı noktaları, bağlayıcı aracılı PCR (LM-PCR) ile çoğaltılmakta ve kitlesel sekanslanmaktadır. MLV entegrasyon bölgeleri insan genomuna eşlenir ve mLV tarafından yüksek oranda hedeflenen genomik bölgeler, mLV entegrasyon siteleri kümeleri olarak tanımlanır.

Retroviral taramaNing birçok insan primer hücrelerinde hücreye özgü aktif düzenleyici elementleri tanımlamak için kullanılmıştır 14,15. MLV kümeleri, çoğu H3K27ac gibi aktif histon işaretlerini barındıran ve hücreye spesifik olan, epigenetik olarak tanımlanmış yükselticiler ve eşlenik maddeler ile birlikte eşlendi. Retroviral tarama prospektif olarak saflaştırılmış hücre popülasyonlarında 7 , 14 yanı sıra prospektif izolasyon için etkili belirteçlerden yoksun olan keratinosit kök hücreleri gibi retrospektif olarak tanımlanmış hücre popülasyonlarında DNA düzenleyici elementlerin genom çapında belirlenmesini sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. İnsan Hücrelerinin MLV İletimi

  1. Hedef hücreleri izole edin ve bunları eGFP raportör genini barındıran ve Veziküler Stomatit Virüs G (VSV-G) veya amfotropik zarf glikoproteini 16 ile pseudotiplenen bir mLV türevi retroviral vektör ile transdüseyin.
    1. Aşağıdaki analizler için sahte transduced hücreleri olumsuz bir kontrol olarak tutun. MLV'ye dayalı retroviral vektörler etkili bir şekilde bölünen hücreleri dönüştürdüğünden, hedef hücre popülasyonunu hücre bölünmesini uyaran koşullarda kültürleyin. Transdüksiyon koşulları, çalışılan her hücre tipi için özel olarak optimize edilmelidir. İnsan hematopoietik progenitörleri, T hücreleri ve epidermal hücreler için hücre büyümesi ve transdüksiyon koşulları Referans 7, 14, 15 ve 17'de açıklanmaktadır.
  2. Transdüksiyondan 48 saat sonra, 100,000 hücreyi% 2 fetal sığır serumu içeren fosfat tamponlu salin (PBS) 300 mcL içinde tekrar süspanse edin ve eGFP ekspresyonunu f olarak ölçünDüşük sitometrik analiz (488 nm uyaran lazer). Sahte iletim hücreleri negatif kontrol olarak kullanın. En uygun entegrasyon bölgesi alımı için, GFP + hücrelerini Floresan Aktif Hücre Ayırma (FACS) ile arındırın.
  3. Genomik DNA hazırlığı için 0.5 ila 5 milyon hücre toplayın. Entegre edilmemiş provirüsün seyreltilmesi için uzun bir kültür periyodu (> 7 gün) tercih edilir ve iyi nazlı kök hücrelerin uzun vadeli yavrularının analizi yapılırken gereklidir (bkz. Tartışma Bölümü ve referans 15 ). Hücre peletleri derhal dondurulabilir ve kullanıma kadar -80 ° C'de saklanabilir.

2. Linker aracılı PCR (LM-PCR) ile mLV entegrasyon alanlarının amplifikasyonu

  1. Genomik DNA'nın (gDNA) hazırlanması
    1. Üreticinin talimatlarına göre, kolon bazlı bir DNA özütleme kiti kullanarak gDNA'yı çıkarın ve kültürlenmiş hücreler için protokolü takip edin.
  2. Restriksiyon enzim digestiüzerinde
    1. 1.5 mL tüpler içinde numune başına 4 kısıtlama enzim sindirimi oluşturun. 10 uL'lik bir son hacimde 1 uL Tru9I (10U) ve 1 uL Tampon M ilave ederek her tüpte 0.1 ila 1 μg gDNA'yı özümleyin. Reaksiyonları 6 saat boyunca veya gece boyunca 65 ° C'de inkübe edin.
    2. Her reaksiyona 1 μL PstI (10U), 1 μL Tampon H ve 8 μL su ilave edin. Reaksiyonları 37 ° C'de 6 saat veya gece boyunca inkübe edin. Numuneler, kullanılıncaya kadar -20 ° C'de saklanabilir.
  3. Bağlayıcı ligasyonu
    1. Bağlayıcı artı iplikçiği ve bağlayıcı eksi iplikçik oligonükleotidlerini 100 uM konsantrasyonda karıştırarak 1.5 mL'lik bir tüp içinde 100 uM Tru9I bağlayıcı stok solüsyonu hazırlayın. Tüpü 100 ° C'ye ayarlanmış bir suya koyun ve oda sıcaklığında soğumaya bırakın. Tru9I linker stok solüsyonu kullanıma kadar -20 ° C'de saklanabilir.
    2. 1.5 mL tüplerde 8 bağlayıcı ligasyon reaksiyonu oluşturun. Her reaksiyon için aşağıdaki bileşeni ekleyinS ila 10 uL kısıtlama enzimi sindirimi: 1.4 uL 10X T4 DNA Ligaz Reaksiyon tamponu, 1 uL 10 uM bağlayıcı Tru9I, 1 uL (2.000 U) T4 DNA ligazı ve 0.6 uL su. 16 ° C'de 3 ila 6 saat inkübe edin. Numuneler, kullanılıncaya kadar -20 ° C'de saklanabilir.
  4. Birinci PCR
    1. 0.2 mL tüpler içinde 48 PCR reaksiyonu (her ligasyon tüpünden 6 reaksiyon) ayarlayın. Her bir PCR için ligasyon reaksiyonundan 2 μL'ye aşağıdaki reaktifleri ekleyin: 5 μL 10X PCR tamponu, 50 μM magnezyum sülfat 2 μL, 10 μM deoksinükleotit (dNTP) Karışımı, 1 μL 10 uM bağlayıcı primer, 1 μL 10 uM mLV-3 'LTR primeri, 0.3 uL (1.5U) Taq DNA Polimeraz ve 37.7 uL su ilave edildi. Primer sekanslar Tablo 1'de verilmektedir.
    2. Aşağıdaki gibi ısıtılmış kapaklı bir termal döngüleyici içinde PCR reaksiyonu yapın: 95 ° C'de 2 dakika; 15 saniye için 95 ° C, 25 ° C'de 30 saniye, 72 ° C'de 1 dakika; 72 °5 dakika boyunca C; 4 ° C'de tutun. Numuneler, kullanılıncaya kadar -20 ° C'de saklanabilir.
  5. İkinci PCR
    1. 0.2 mL'lik tüplerde 48 PCR reaksiyonu ayarlayın (her biri "birinci PCR" tüpünden 1'dir). Her bir PCR için, ilk PCR reaksiyonunun 2 μL'sine aşağıdaki bileşenleri ekleyin: 5 μL 10X PCR tamponu, 50 mM Magnezyum Sülfat, 1 μL 10 mM dNTP Mix, 10 uM linker iç içe geçmiş primer 1 uL, 2 μL 10 uM mLV-3 'LTR iç içe astar, 0.3 uL Taq DNA Polimeraz (1.5 U) ve 37.7 uL su ilave edildi. Seçilen spesifik muazzam sıralama stratejisi için tasarlanmış iç içe geçmiş primerler kullanın: (i) Illumina platformuyla uyumlu bağlayıcı iç içe astar ve mLV-3 'LTR iç içe astar; (Ii) Roche platformuyla uyumlu bağlayıcı iç içe astar ve mLV-3 'LTR iç içe astar. Primer sekanslar Tablo 1'de listelenmiştir.
    2. Aşağıdaki gibi ısıtılmış kapaklı bir termal döngüleyici içinde PCR reaksiyonu yapın: 95 ° C'de 2 dakika; 2595 ° C'de 15 saniye, 58 ° C'de 30 saniye, 72 ° C'de 1 dakika; 72 ° C'de 5 dakika; 4 ° C'de tutun. Numuneler, kullanılıncaya kadar -20 ° C'de saklanabilir.
    3. 48 yuvalanmış PCR reaksiyonlarını 15 mL'lik bir tüpe (son hacim ~ 2.4 mL) doldurun. Numuneler, kullanılıncaya kadar -20 ° C'de saklanabilir.
  6. Agaroz jel elektroforezi ile LM-PCR ürünlerinin varlığını ve boyutunu belirleyin.
    1. 20 mcL LM-PCR ürünlerine 4 mcL Yükleme Tamponu ekleyin ve 100 bp DNA merdiven ile birlikte% 1 agaroz jel üzerine numune yükleyin. Jel 30 ila 60 dakika boyunca 5 V / cm'de çalıştırın ve etidyum bromid boyama ile PCR ürünlerini görselleştirin.
    2. Olumsuz kontrol olarak taklit transduced örnek bir LM-PCR reaksiyonu çalıştırın.
  7. Amfikonları, 0.1 hacim sodyum asetat çözeltisi (3 M, pH 5.2) ve 2.5 hacim% 100 etanol ekleyerek çöktürün. Karıştırıp -80 ° C'de 20 dakika boyunca dondurun.
    1. Fuarda dönüyorStandart bir mikrosantrifüjde 20 dakika 4 ° C'de hız uygulayacağız. Süpernatantı atın ve pelleti% 70 etanol ile yıkayın. Standart bir mikrosantrifüjde 4 ° C'de 5 dakika tam hızda döndürün.
    2. Süpernatantı atın ve peleti havayla kurutun. 200 μL PCR sınıfı su ekleyin ve DNA'yı tekrar süspanse edin. Numuneler, kullanılıncaya kadar -20 ° C'de saklanabilir.
  8. 100 μL LM-PCR ürününe 20 μL Yükleme Tamponu ekleyin ve 100 bp DNA merdiveni ile birlikte% 1 agaroz jel üzerine numune yükleyin.
    1. Jel 30 ila 60 dakika boyunca 5 V / cm'de çalıştırın ve 150 ila 500 bp uzunluğunda amplikon içeren jel kısmını kesin.
    2. LM-PCR ürünlerini kolon bazlı bir jel özütleme kiti ile saflaştırın ve bir UV spektrofotometre kullanarak konsantrasyonu ölçün.
  9. Üreticinin talimatlarına göre bir biyolojik analiz cihazı kullanarak LM-PCR ürünlerinin uzunluğunu değerlendirmek için 1 μL kitaplık kullanın.
  10. Saflaştırılmış LM-PCR ürünlerinden 20 ng kullanın ve üreticinin talimatlarına uygun olarak pCR2.1-TOPO vektörüne klonlayın.
  11. Uygun olan örnekleri tanımlamak için klonların% 50'sinde viral genom kavşakları (mLV-3 'LTR iç içe astar dahil) varlığını açığa çıkarmak için M13 Universal primerini ve ardından oluşan dizilerin genomik haritalanmasını takip eden sekanslama reaksiyonları gerçekleştirin Muazzam sıralama için. Bir viral-genom kavşağı örneği:
    kavşak
    MLV-3 'LTR iç içe astar 454 ve bağlayıcı iç içe astar 454 ( Tablo 1 ) kalın olarak ve viral LTR'nin italik olarak 3' ucunda belirtilmiştir. İnsan genom dizisi kırmızı metinle vurgulanır (chr10: 6439408-6439509, hg19).

3. mLV Entegrasyon Sitelerinin Devasa Dizilimi

NOT: LM-PCR prodTicari platformlar kullanılarak sekanslar sıralanabilir (ikinci PCR reaksiyonunda uygun iç içe geçmiş primer çiftinin seçilmesi, alt bölüm 2.5.1'e bakınız). Roche GS-FLX pirosequencing platformu ile sıralama için, önceki kağıtlara 7 , 14 , 15 bakınız. Bu bölümde, Illumina sıralama platformu için yeni optimize edilmiş bir protokol açıklanmaktadır.

  1. Kütüphane hazırlığı
    1. 0.2 mL tüpler içinde numune başına 1 endeksleme PCR reaksiyonu oluşturun. Her bir PCR için 5 μL (150-170 ng) saflaştırılmış LM-PCR ürününe aşağıdaki reaktifleri ekleyin: 5 μL Index Primer 1, 5 μL Index Primer 2, 25 μL 2X Master Mix ve 10 μL PCR- Düşük su. Her numune için farklı bir indeks kombinasyonu kullanın.
    2. Aşağıdaki gibi, ısıtılmış kapaklı bir termal döngüleyici içinde PCR reaksiyonlarını gerçekleştirin: 95 ° C'de 3 dakika; 30 saniye için 95 ° C, 8 saat 30 saniye boyunca 55 ° C, 30 saniye boyunca 72 ° C; 72 ° C'de 5 miçinde; 4 ° C'de tutun.
    3. Bir katı faz reversible immobilizasyon (SPRI) boncuk izolasyon protokolünü kullanarak PCR ürünlerini saflaştırın: Yeni 1.5 mL tüplerde, her bir numuneye 56 μL boncuk ekleyin ve üretici talimatlarını takip edin. 25 mcL Tris-HC1 10 mM içinde elute edin. Kütüphaneler kullanıma kadar -20 ° C'de saklanabilir.
  2. Kütüphane kontrolü
    1. Bir biyolojik analiz cihazı kullanarak kütüphane boyutunu değerlendirmek için 1 uL örnek kullanın.
    2. Üreticinin talimatlarına göre, floresan esaslı bir Gerçek zamanlı PCR testi kullanarak kütüphane molaritesini nicelemek için 1 uL numune kullanın.
  3. Kütüphane seyreltme ve sıralama
    1. Tris-HC1 10 mM kullanarak kütüphaneleri 10 nM'ye seyreltin. Kütüphaneleri bir araya getirmek için, her bir seyreltilmiş kütüphanenin 5 uL'ini yeni bir 1.5 mL tüpe aktarın ve ardından havuzu, 10 mM Tris-HC1 içinde 4 nM'ye seyreltin.
    2. 5 μL seyreltilmiş havuzu, 5 mcL 0.2 N NaOH ile yeni bir 1,5 mL tüp, kısaca vorteksleyin, aşağı spinleyin ve kütüphaneleri denatürecek şekilde oda sıcaklığında 5 dakika inkübe edin.
    3. Tüpleri buz üzerine koyun ve önceden soğutulmuş hibridizasyon tamponu (HT1) 990 μL ekleyin. Yeni bir 1.5 mL tüp içinde 300 uL denatüre edilmiş havuz alınır ve 10 pM son kütüphane havuzunu elde etmek için 300 μL önceden soğutulmuş HT1 ilave edin.
    4. Buna paralel olarak, 2 mL'lik bir PhiX kontrol kütüphanesi (10 nM) ile 3 mL Tris-HC1 10 mM içeren 1.5 mL'lik bir tüple karıştırın. Seyreltilmiş PhiX denatüre etmek için 5 μL NaOH 0.2 N, kısa bir süre vorteksleyin, spin aşağı indirin ve oda sıcaklığında 5 dakika inkübe edin. Tüpü buz üzerine koyun ve 990 μL önceden soğutulmuş HT1 ekleyin.
    5. Yeni bir 1.5 mL tüp içinde 300 uL denatüre PhiX ilave edin ve 10 pM final PhiX elde etmek için 300 μL önceden soğutulmuş HT1 ekleyin.
    6. Yeni bir 1.5 mL tüp içinde, denatüre edilmiş PhiX kitaplığının 90 uL'si ile denatüre edilmiş kütüphane havuzu 510 uL'yi karıştırın, böylece% 15 PhiX kontrollü bir son 10 pM havuz elde edin.
    7. Bu 600 μL numuneyi pipetleyinÇözülmüş sıralama reaktifi kartuşunun Load Sample deposuna boşaltın ve hemen tek okunan 150 çevrimlik bir çalışma yapmak için devam edin.
      NOT: Bu protokol için gerekli kritik reaktifler ve primer dizileri Tablo 1'de listelenmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Retroviral tarama prosedürünün iş akışı

Retroviral tarama prosedürünün iş akışı Şekil 1'de şematize edilmiştir. Hedef hücre popülasyonu arıtılır ve bir eGFP raportör geni ifade eden bir mLV türevi retroviral vektör ile transforme edilir. Transgen, viral genomun konak DNA'sına sentezini, ters transkripsiyonunu ve entegrasyonunu sağlayan, iki özdeş uzun terminal tekrarları (5 've 3' LTR) tarafından çevrelenmiştir. Transdüksiyon etkinliği eGFP ifadesinin FACS analizi ile değerlendirilir. Yüksek oranda (>% 30) mLV ile iletilen hücreler içeren hücre popülasyonu güçlendirilir ve ardından entegre mLV viral kasetleri içeren genomik DNA'nın özümlenmesi için parçalanır. Genomik DNA sindirilir ve uyumlu bir bağlayıcıyla bağlanır ve viral 3 'LTR'ler ile konukçu genomu arasındaki bağlantı noktaları LM-PCR ile çoğaltılır. VirDaha sonra Roche veya Illumina platformlarını kullanarak bizlerin konakçı genom kavşakları büyük bir sıralamaya tabi tutuldu. Son olarak, tekrarlayan ekleme yerlerinin genomik kümelerini tanımlamak için mLV entegrasyon bölgeleri insan genomuna eşlenir.

LV-PCR ile mLV entegrasyon alanlarının amplifikasyonu

LM-PCR, Şekil 2'de şematize edilmiştir. Genomik DNA, mLV ile çevrilen hücrelerden çıkarılır ve sıklıkla insan genomunu kesen ve 70 bp'lik bir orta uzunlukta fragmanlar üreten Tru9I kısıtlama enzimi ile sindirilir. Entegre edilmiş ve entegre edilmemiş dahili 5 'LTR fragmanlarının amplifikasyonunu önlemek için ikinci bir kısıtlama enzimi (PstI) kullanılır. Daha sonra, Tru9I çift sarmallı linker genomik fragmanlara bağlanır ve linker için spesifik primerlerle LM-PCR yapılır ve Virüs konakçı genom kavşakları çoğaltmak için 3 'LTR. İç içe PCR, pri kullanılarak gerçekleştirilebilirRoche veya Illumina sıralama platformlarıyla uyumlu mers.

Virüs konakçı genom kavşak amplikonlarının analizi

Şekil 3'te gösterilen deneyde, CD34 - CD13 + miyeloid progenitörü / öncülleri (MPP) saflaştırdık ve eGFP raportör genini ifade eden bir mLV türevi retroviral ile transformtik. MPP hücrelerinin% 60'ından fazlası, iletimden 48 saat sonra eGFP'yi ifade etmiştir (veriler gösterilmemiştir). Transdüksiyon işleminden 15 gün sonra hücreleri toplarız, gDNA'yı çıkarırız ve yukarıda tarif edildiği gibi virüs konakçı genom kavşaklarını büyüttük. Havuzlanmış LM-PCR ürünlerinin bir bölümü, amplikonların varlığını ve boyutunu doğrulamak için% 1 agaroz jeli üzerine yüklenmiştir. 150 ila 500 bp arasında değişen, farklı ebatlarda LM-PCR ürünlerine karşılık gelen bir DNA smear'ı başarılı bir şekilde görüntüledik ( Şekil 3A ). Amplicons daha sonraDNA çökeltisi ile yoğunlaştırıldı ve% 1 agaroz jel üzerine yüklendi. LM-PCR ürünleri jel ile saflaştırılmış ve beklenen amplikon boyutlarını teyit eden bir biyoanalizör sistemi üzerinde çalıştırılmıştır (150 ila 500 bp; Şekil 3B ).

MLV entegrasyonlarının aktif ve hücreye özgü düzenleyici bölgelere haritalanması

Şekil 4'te bildirilen deneyde, hematopoietik kök / progenitör hücreler (HSPC), eritroid progenitör / prekürsörler (EPP) ve miyeloid progenitör / prekürsörler (MPP), mLV türevi bir retroviral vektör ile transforme edildi. Bu sonuçlar potansiyel kirlenme / çarpışmalardan kaçınmak için farklı hücre tiplerinden türetilmiş numunelerin işlenmesi ve sıralanmasıyla elde edilmiştir 18,19. Büyük sıralamayla üretilen ham dizilim okumaları otomatik bir biyoinformatik ile işlendiBoru hattı viral ve bağlayıcı dizileri ortadan kaldırmak için. Ardından Blat 17'yi kullanarak insan genomu üzerinde en az 20 bp'lik benzersiz diziler eşleştirildi. Ham hizalanmalar, maçın ilk 3 nükleotid, tekli maç ve minimum% 95 kimlik içinde başlamasını gerektirerek filtrelendi. Tekrarlayan mLV entegrasyon kümeleri, sıralanma platformuyla uyumlu bir mesafede bir Tru91 kısıtlama motifli insan genomundan rastgele çıkarılmış genomik pozisyonlar üreten rasgele genomik sekansların bir veri seti ile istatistiksel bir karşılaştırma ile tanımlandı. Kontrol dizileri daha sonra, benzersiz sitelerin rastgele bir seti oluşturmak için, entegrasyon dizileri için kullanılan aynı haritalama ve filtreleme boru hattı aracılığıyla işlendi. MLV kümelerini tanımlamak için, DBSCAN kümeleme algoritmasını 19 uyguladık, yüksek düzeyde kümelenmiş entegrasyon bölgelerini belirlemek için ardışık mLV integrasyonlarının dağılımını eşit miktarda rastgele sitelerin dağılımı ile karşılaştırdık ve bu defIne hücreye özgü düzenleyici elemanlar 7 , 14 , 15 . Sahte kümelerin oluşumunu önlemek için rasgele kontrol veri setinden çoklu ekstraksiyon gerçekleştirildi. Sırasıyla HSPC, EPP ve MPP'de LM-PCR ve piro sekanslama 32,574, 27,546 ve 36,358 mLV eşleme siteleri haritası yaptık. Tekrarlayan mLV integrasyon kümeleri, asetillenmiş arttırıcılar ve yükselticiler ile birlikte eşlenmiştir ( Şekil 4A ). MLV hedefli düzenleyici bölgelerin çoğu hücreye spesifikti, örneğin: (i) HSPC'ye spesifik SPINK2 geninin promotörü ( Şekil 4B ); (Ii) eritroid-spesifik β-benzeri globin genlerinin güçlü arttırıcılarını içeren Lokus Kontrol Bölgesi ( Şekil 4C ); (Iii) MPP'ye spesifik LYZ geninin üst akışında yer alan arttırıcılar ( Şekil 4D ). Son olarak, doğrulamak için lüsiferaz testleri kullandıkEPP ve MPP'deki varsayılan hücreye spesifik mLV hedef arttırıcıların bir alt kümesidir ( Şekil 4E ).

Şekil 1
Şekil 1: Retroviral integrasyon bölgesi haritalama prosedürünün genel bir şeması. Hedef hücreler, bir eGFP kaset içeren bir mLV tabanlı retroviral vektör ile transforme edilir. Dönüştürülmüş hücrelerden elde edilen genomik DNA, Tru9I ile sindirilir ve uyumlu bir Tru9I çift sarmallı bağlayıcı ile bağlanır. MLV entegrasyon bölgeleri yuvalanmış LM-PCR ile amplifiye edildi ve virüs konakçı genom kavşakları kütüphanesi, Illumina veya Roche platformları kullanılarak kitlesel olarak dizilenebildi. Ortaya çıkan okumalar tekrarlayan mLV integrasyonlarının kümelerini tanımlamak için insan genomuna eşlendi. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız. </ P>

şekil 2
Şekil 2: Virüs konakçı genom kavşaklarının LM-PCR ile amplifikasyonu. Entegre mLV provirüsünü içeren genomik DNA (gDNA), Tru9I ve PstI restriksiyon enzimleri ile sindirilir ve uyumlu bir Tru9I bağlayıcı ile lige edilir. İç içe PCR, LTR'ye ve bağlayıcıya spesifik primerler kullanılarak gerçekleştirilir. Viral ve insan genomundaki Tru9I ve PstI kısıtlama alanları belirtilmiştir. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 3
Şekil 3: LM-PCR amplikonlarının analizi. ( A ) LM-PCR ürünleri (şerit +)% 1 agaroz jeli üzerinde çalıştırıldı ve görselleştirildiEtidyum bromid boyama ile. Yalnızca PCR primerleri görüntülendiğinde (şerit -) negatif kontrol örneği olarak sunulan şablon olmayan bir örnek. ( B ) Jel ​​saflaştırmasından sonra, LM-PCR ürün boyutu mikrokapiller elektroforez ile kontrol edildi. Örneklem büyüklüğü (bp) ve flüoresan yoğunluğu (FU) elektroferogramın x ve y eksenlerinde sırasıyla gösterilmektedir. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 4
Şekil 4: mLV entegrasyonunun epigenetik olarak tanımlanmış düzenleyici bölgelere haritalandırılması. ( A ) Sırasıyla HSPC, EPP ve MPP'de rekürren mLV integrasyon alanlarının 3,498, 2,989 ve 4,103 kümelerini tanımladık. Her bir hücre popülasyonunda,>% 95'lik mLV kümeleri, epigenetik olarak tanımlanan zenginleştirme ile çakışmaktadırErs ve promosyoncular. ( B , C ve D ) Hücrede spesifik mLV hedefli bölgeler, asetillenmiş ve hedeflenen genin ( SPINK2 , HBB ve LYZ'nin hücreye spesifik ekspresyonu ile bağlantılıydı , sırasıyla hemen hemen sadece HSPC, EPP ve MPP'de ifade edildiği gibi sırasıyla ifade edildi Gen Ekspresyonunun Cap analiziyle). MLV tekli integrasyonlar küçük çubuklarla gösterilmiştir. TPM, Milyona Göre Etiket'i belirtir. ( E ) EPP ve MPP'de varsayılan hücreye spesifik mLV hedef arttırıcılar. Şekil 4 referans 14'ten uyarlanmıştır. Bu rakamın yaratıcı ticaret lisansıyla tekrar kullanılmasına izin verildi. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Burada, kromatin bölgelerini hedefleyen bir epigenetik olarak aktif promotörler ve arttırıcılar olarak işaretlenmiş bir retrovirüs olan mLV'nin entegrasyon sitelerinin genom çapında haritalandırılması için bir protokolü açıkladık. Protokolün kritik adımları ve / veya sınırlamaları şunları içerir: (i) hedef hücre popülasyonunun mLV iletim; (Ii) LM-PCR ile virüs-konakçı bağlantı noktalarının çoğaltılması; (Iii) entegrasyon alanlarının yüksek bir kısmının alınması. MLV tabanlı retroviral vektörler bölerek bölünen hücrelere etkili bir şekilde dönüştürürler. Bölünmeyen hücrelerin (örn., Mitotik sonrası nöronal hücreler) transdüksiyonunun düşük verimi bu tekniğin potansiyel bir kısıtlılığıdır. Bununla birlikte, raportör geninin ekspresyonuna ( ör. EGFP) dayanan transduced popülasyonun hücre sıralama yoluyla aşılabilir. LM-PCR (150 ila 500 bp) ile nispeten kısa amplikonların üretilmesi, günümüzde kullanılan yoğun sekanslama stratejileri ile uyumlu amplikonların bir kütüphanesinin üretilmesi ve kapsamlı bir jenere olanak sağlamak için zorunludurMLV entegrasyon alanlarının ome çapında analizi. Örnek olarak,> 500 bp uzunluğundaki LM-PCR ürünlerinin amplifikasyonu, kısmi genomik DNA sindiriminden veya Tru9I ile sindirilmiş genomik fragmanların intra-ligandından (LM-PCR amplikonlarının av tüfeği klonlamasıyla değerlendirildiğinde) ortaya çıkabilir (veriler gösterilmemiştir). İlk durumda, genomik DNA sindirim koşullarını daha da optimize ederek sorun çözülebilirken, ikinci durumda, mLV entegrasyon alanlarının başarıyla seri biçimde dizilmesi, 150 ila 500 bp arasında amplikonların jel arıtılması ile gerçekleştirilebilir. Son olarak, genomik DNA'yı kesmek için kısıtlama enzimlerinin kullanılması tercih edilen amplifikasyona ve bir kısıtlama alanına yakın entegrasyon alanlarının saptanmasına yol açabilir. Tru9I sınır enziminin alabileceği entegrasyon sitelerinin yüzdesi ~% 50 olarak tahmin edilir. Bu nedenle, bu teknik, birden fazla kısıtlama enzimi kullanarak veya rasgele DNA şeriatının uygulanmasıyla entegrasyon alanının alınmasını iyileştirmek için daha da optimize edilebilirSonication 20 , 21'e göre .

Son zamanlarda, bu makalede ayrıntılı olarak açıklandığı üzere, yaygın olarak kullanılan Illumina platformunu kullanarak viral entegrasyon sitelerinin dizilimini optimize ettik. Bu sıralama yaklaşımı Roche platformuna kıyasla çalışma başına daha yüksek sayıda okuma oluşturarak tek bir deneyden alınan entegrasyon sitelerinin sayısını büyük ölçüde arttırır, böylece zaman ve maliyetleri küresel olarak azaltır.

Hücreye spesifik düzenleyici bölgelerin genom çapında belirlenmesi, ChIP-seq 6 (histon H3 lisin 4'ün arttırıcıları ve destekleyicileri tanımlamak için mono- ve tri-metilasyonu ve H3K27ac ile aktif ve pasif arasında ayırt etmek için mono- ve tri-metilasyon ile bir ila üç histon modifikasyonunun haritalanmasını gerektirir Düzenleyici elemanlar) 4 , 5 , 6 ve farklı hücre tiplerinin sistematik olarak karşılaştırılmasıBelirli bir hücre popülasyonunda münhasıran aktif olan cis-etkili elementler. Çok izotoplu hematopoietik progenitörler ve embriyonik kök hücreler, nöroepitelyal benzeri kök hücreler ve ayırt edici keratinositler 15 gibi prospektif olarak izole edilmiş hedef hücre popülasyonlarında mLV integrasyon sitelerini haritalandık. Retroviral tarama, analiz edilen her bir hücre popülasyonunda hücreye özgü düzenleyici elementlerin genom çapında tanımlanmasına imkân tanıdı ve karşılaştırmalı genom çapındaki çalışmaları kesinlikle gerekli olmadı. Önemli olan, bu araç, prospektif izolasyon için sağlam belirteçlerden yoksun ve histon modifikasyonlarının ChIP-seq tabanlı analizi ile analiz edilemeyen, nadir hücre popülasyonlarında ( örn., Somatik kök hücreler) aktif düzenleyici unsurların tanımlanması için kullanılabilir. Bu hücre popülasyonlarında, mLV integrasyonu, aktif düzenleyici bölgelerin kalıcı bir genetik göstergesi olup,In vitro ve in vivo olarak daha bol hücreli dölün retrospektif olarak tanımlanması . Örnek olarak, geriye dönük olarak tanımlanmış bir keratinosit kök hücresi (KSC) popülasyonunda, hızlandırıcıların ve arttırıcıların vekil belirteçleri olarak, mLV entegrasyon kümelerini başarıyla kullandık. Bir mLV vektörü olan KSC'leri içeren, erken geçit, sadelikten türetilmiş bir keratinosit kültürü transdüze edildik, sonra> 35 hücre çoğalması için bu hücreleri pasifleştirerek KSC'lerin soyunu zenginleştirdik, böylece bu sayıdaki kültürün korunma kabiliyeti tarafından tanımlandık. pasajlar. Bu durumda, mLV entegrasyonları orijinal transdüksiyon KSC popülasyonunda aktif olan düzenleyici bölgeleri kalıcı olarak işaretledi ( 15) . Gelecekteki çalışmalar genom çapında çok sayıda nadir insan kök hücre popülasyonunda hücreye özel düzenleyici unsurların tanımlanmasını amaçlıyor.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

Bu çalışma Avrupa Araştırma Konseyi (ERC-2010-AdG, GT-SKIN), İtalya Eğitim Bakanlığı, Üniversiteler ve Araştırma Bakanlığı'nın (Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003'teki FIRB-Futuro) hibeleriyle desteklendi , EPIGEN Epigenomik Flagship Projesi), İtalyan Sağlık Bakanlığı (Genç araştırmacılar Çağrı 2011 GR-2011-02352026) ve Imagine Enstitüsü Vakfı (Paris, Fransa).

Materials

Name Company Catalog Number Comments
PBS, pH 7.4 ThermoScientific 10010031 or equivalent
Fetal Bovine Serum ThermoScientific 16000044 or equivalent
0.2 ml tubes general lab supplier
1.5 ml tubes general lab supplier
QIAGEN QIAmp DNA mini Kit  QIAGEN 51306 or equivalent
T4 DNA ligase  New England BioLabs M0202T
T4 DNA Ligase Reaction buffer New England BioLabs M0202T
Linker Plus Strand oligonucleotide general lab supplier 5’-PO4-TAGTCCCTTAAGCGGAG-3’  (Purification grade: SDS-PAGE)
Linker Minus Strand oligonucleotide general lab supplier 5’-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3’ (Purification grade: SDS-PAGE)
Tru9I Roche-Sigma-Aldrich 11464825001
SuRE/Cut Buffer M Roche-Sigma-Aldrich 11417983001
PstI  Roche-Sigma-Aldrich 10798991001
SuRE/Cut Buffer H Roche-Sigma-Aldrich 11417991001
Platinum Taq DNA Polimerase High Fidelity  Invitrogen 11304011
10 mM dNTP Mix Invitrogen 18427013 or equivalent
PCR grade water general lab supplier
96-well thermal cycler (with heated lid) general lab supplier
linker primer general lab supplier 5’-GTAATACGACTCACTATAGGGC-3’ (Purification grade: PCR grade)
MLV-3’ LTR primer general lab supplier 5’-GACTTGTGGTCTCGCTGTTCCTTGG-3’ (Purification grade: PCR grade)
linker nested primer 454 general lab supplier 5’-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer 454 general lab supplier 5’-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
linker nested primer Illumina general lab supplier 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)
MLV-3’ LTR nested primer Illumina general lab supplier 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)
Sodium Acetate Solution (3M) pH 5.2 general lab supplier
Ethanol (absolute) for molecular biology Sigma-Aldrich E7023 or equivalent
Topo TA Cloning kit (with pCR2.1-TOPO vector) Invitrogen K4500-01
QIAquick Gel Extraction kit QIAGEN 28704
Agarose Sigma-Aldrich A9539 or equivalent
Ethidium bromide  Sigma-Aldrich E1510 or equivalent
100 bp DNA ladder Invitrogen 15628019 or equivalent
6x Loading Buffer ThermoScientific R0611 or equivalent
NanoDrop 2000 UV-Vis Spectrophotometer ThermoScientific ND-2000
Nextera XT Index kit Illumina FC-131-1001 or FC-131-1002
2x KAPA HiFi Hot Start Ready Mix  KAPA Biosystems KK2601
Dynal magnetic stand for 2 ml tubes Invitrogen 12321D or equivalent
Agencourt AMPure XP 60 ml kit Beckman Coulter Genomics A63881
Tris-HCl 10 mM, pH 8.5 general lab supplier
Agilent 2200 TapeStation system Agilent Technologies G2964AA or equivalent
D1000 ScreenTape Agilent Technologies 5067-5582 or equivalent
D1000 Reagents Agilent Technologies 5067-5583 or equivalent
KAPA Library Quantification Kit for Illumina platforms (ABI Prism) KAPA Biosystems KK4835
ABI Prism 7900HT Fast Real-Time PCR System Applied Biosystems 4329003
NaOH 1.0 N, molecular biology-grade general lab supplier
HT1 (Hybridization Buffer) Illumina  Provided in the MiSeq Reagent Kit
MiSeq Reagent Kit v3 (150 cycles) Illumina MS-102-3001
MiSeq System Illumina SY-410-1003
PhiX Control v3 Illumina FC-110-3001

DOWNLOAD MATERIALS LIST

References

  1. Ernst, J., et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature. 473, (7345), 43-49 (2011).
  2. Shlyueva, D., Stampfel, G., Stark, A. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet. 15, (4), 272-286 (2014).
  3. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  4. Heintzman, N. D., et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature. 459, (7243), 108-112 (2009).
  5. Creyghton, M. P., et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A. 107, (50), 21931-21936 (2010).
  6. Hnisz, D., et al. Super-enhancers in the control of cell identity and disease. Cell. 155, (4), 934-947 (2013).
  7. Cattoglio, C., et al. High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors. Blood. 116, (25), 5507-5517 (2010).
  8. Biasco, L., et al. Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. EMBO Mol Med. 3, (2), 89-101 (2011).
  9. De Ravin, S. S., et al. Enhancers are major targets for murine leukemia virus vector integration. J Virol. 88, (8), 4504-4513 (2014).
  10. LaFave, M. C., et al. mLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Res. 42, (7), 4257-4269 (2014).
  11. Gupta, S. S., et al. Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration. J Virol. 87, (23), 12721-12736 (2013).
  12. Sharma, A., et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proc Natl Acad Sci U S A. 110, (29), 12036-12041 (2013).
  13. De Rijck, J., et al. The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites. Cell reports. 5, (4), 886-894 (2013).
  14. Romano, O., et al. Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment. Sci Rep. 6, 24724 (2016).
  15. Cavazza, A., et al. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation. Stem Cell Reports. 6, (4), 618-632 (2016).
  16. Miller, A. D., Law, M. F., Verma, I. M. Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene. Mol Cell Biol. 5, (3), 431-437 (1985).
  17. Cattoglio, C., et al. High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion. PLoS One. 5, (12), e15688 (2010).
  18. Aiuti, A., et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science. 341, (6148), 1233151 (2013).
  19. Biffi, A., et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science. 341, (6148), 1233158 (2013).
  20. Gabriel, R., et al. Comprehensive genomic access to vector integration in clinical gene therapy. Nat Med. 15, (12), 1431-1436 (2009).
  21. Gillet, N. A., et al. The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones. Blood. 117, (11), 3113-3122 (2011).
Retroviral Tarama: Hücreye Özel Düzenleyici Bölgeleri Tanımlamak İçin MLV Entegrasyon Konumlarının Haritalandırılması
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).More

Romano, O., Cifola, I., Poletti, V., Severgnini, M., Peano, C., De Bellis, G., Mavilio, F., Miccio, A. Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions. J. Vis. Exp. (123), e55919, doi:10.3791/55919 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter