Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Påvisning af Enterohemorrhagic Escherichia Coli kolonisering i Murine vært ved Non-invasiv In Vivo bioluminescens System

doi: 10.3791/56169 Published: April 9, 2018

Summary

En detaljeret protokol i en musemodel for enterohemorrhagic E. coli (EHEC) kolonisering ved hjælp af bioluminescens-mærket bakterier er præsenteret. Påvisning af disse en bioluminescerende bakterier af en non-invasiv i vivo imaging system med levende dyr kan rykke vores nuværende forståelse af EHEC kolonisering.

Abstract

Enterohemorrhagic E. coli (EHEC) O157: H7, som er en fødevarebårne patogen, causesdiarrhea, blødende tarmbetændelse (HS), og Hæmolytisk uræmisk syndrom (HUS), kolonisere til tarmkanalen i mennesker. For at studere den detaljerede mekanisme af EHEC kolonisering in vivo er det vigtigt at have dyremodeller for at overvåge og kvantificere EHEC kolonisering. Vi viser her en mus-EHEC kolonisering model ved at omdanne den en bioluminescerende udtrykker plasmid til EHEC til at overvåge og kvantificere EHEC kolonisering i levende værter. Dyr podet med bioluminescens-mærket EHEC vise intens en bioluminescerende signaler i mus ved registrering med en non-invasiv i vivo imaging system. Efter 1-2 dage efter infektion, kunne en bioluminescerende signaler stadig kunne påvises i inficerede dyr, hvilket tyder på, at EHEC kolonisere hosts i mindst 2 dage. Vi viser også, at disse en bioluminescerende EHEC lokalisere til musen tarmen, specielt i cecum og colon, fra ex vivo billeder. Denne mus-EHEC kolonisering model kan tjene som et redskab til at fremme den aktuelle viden om EHEC kolonisering mekanisme.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EHEC O157: H7 er en patogen, der forårsager diarré1, HS2, HUS3og endda akut nyresvigt4 gennem forurenet vand eller mad. EHEC er en sygdomsfremkaldende enterobacterium og koloniserer til mavetarmkanalen hos mennesker1. Når EHEC overholder første vært intestinale epitel, injicere de kolonisering faktorer i værtsceller gennem type III sekretion system (T3SS), der fungerer som en molekylær sprøjte inducere en montering og effacing (A/E) læsion efterfølgende til at håndhæve friktion (kolonisering)5. Disse gener involveret i A/E læsion dannelse er kodet af locus af enterocyte effacement (LEE) patogenicitet ø5.

Bioluminescens er en lys-producerende kemiske reaktion, i hvilke luciferase katalyserer sit Bæremateriale luciferin for at generere synligt lys6. Denne enzymatiske proces kræver ofte tilstedeværelse af ilt eller adenosin trifosfat (ATP)6. Bioluminescens imaging (BLI) tillader forskere visualisering og kvantisering af vært-patogen interaktioner i levende dyr7. BLI kan karakterisere den bakterielle infektion cyklus i levende dyr ved at følge en bioluminescerende bakterier som de vandrer til og invadere forskellige væv7; Dette afslører en dynamisk progression af infektion. Derudover er bakteriemængde i dyr, der relateret til en bioluminescerende signal8; Det er således en bekvem indikator til at anslå de patologiske tilstande af forsøgsdyr i en enkel og direkte måde.

Plasmid brugt her indeholdt luciferase operonen, luxCDABE, som er fra bakterien Photorhabdus luminescens der koder sin egen luciferase substrat7,9. Ved at omdanne denne luciferase-udtrykker plasmid til bakterier, kan kolonisering og infektion processer overvåges ved at observere disse en bioluminescerende bakterier med levende dyr. Samlet set giver BLI og bioluminescens-mærket bakterier forskere til at overvåge bakteriel numre og placering, bakteriel levedygtighed med antibiotika/terapi behandling og bakteriel genekspression i infektion/kolonisering6, 7. mange patogene bakterier er blevet rapporteret at udtrykke luxCDABE operon at undersøge deres infektion cyklus og/eller gen udtryk i infektion. Disse bakterier, herunder uropathogenic E. coli10, EHEC8,11,12,13, enteropathogenic E. coli (EPEC)8, Citrobacter rodentium14,15, Salmonella typhimurium16, Listeria monocytogenes17, Yersinia enterocolitica18,19, og Vibrio cholerae20, er blevet dokumenteret.

Flere eksperimentelle modeller er blevet udviklet for at lette undersøgelsen af EHEC kolonisering i in vitro og i vivo21,22,23. Dog er der en mangel på egnet dyremodeller for at studere EHEC kolonisering i vivo, og dermed en deraf følgende mangel på detaljer. For at lette undersøgelsen af EHEC kolonisering mekanisme i vivo, er det værdifuldt at bygge dyremodeller for at observere og kvantificere EHEC kolonisering med levende dyr i en ikke-invasiv metode.

Dette manuskript beskriver en mus-EHEC kolonisering model, der bruger en en bioluminescerende udtrykker system til at overvåge EHEC colonization over tid i levende værter. Mus podes intragastrically med bioluminescens-mærket EHEC og en bioluminescerende signalet registreres i mus med en non-invasiv i vivo imaging system13. Mus inficeret med bioluminescens-mærket EHEC viste betydelig en bioluminescerende signaler i deres tarmen efter 2 dage efter infektion, som foreslog, at disse bakterier koloniseret i vært tarmen efter 2 dage efter infektion. Ex vivo billeddata viste, at denne colonization er specielt i cecum og colon af mus. Ved hjælp af denne mus-EHEC model, kan en bioluminescerende EHEC kolonisering afsløres i den levende vært ved en i vivo imaging system, for at studere de detaljerede mekanismer af enteriske bakterier kolonisering, som kan fremme yderligere forståelse i EHEC-induceret fysiologiske og patologiske ændringer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Forsigtig: EHEC O157: H7 er en biosikkerhed niveau 2 (BSL-2) patogen Ifølge Centers for Disease Control og forebyggelse (CDC) biosikkerhed instruktion (https://www.cdc.gov/). Derfor skal alle eksperimentelle procedurer, der involverer EHEC udføres på et anlæg, BSL-2. Bære lab frakker og handsker mens du udfører eksperimentet. Arbejde i et certificeret biosikkerhed kabinet (BSC). Desinficer den eksperimentelle bænk før og efter forsøgsmetoden med 70% ethanol. Alle instrumenter eller udstyr, kontakt (eller potentielt kontakt) EHEC skal desinficeres med 70% ethanol eller blegemiddel. Forurenet (eller potentielt forurenede) affald skal være forseglet og autoklaveres omhyggeligt. Bære en maske, øjenbeskyttelse, handsker eller en buksedragt, hvis nødvendigt. 6 uger gamle C57BL/6 hunmus blev købt og vedligeholdes på Laboratory Animal Center af nationale Cheng Kung-universitetet (NCKU). De dyreforsøg blev godkendt af institutionelle Animal Care og brug Udvalget af NCKU (godkendelsesnummer 104-039).

1. Bioluciferase-mærket EHEC bakterier Generation

  1. Mix 50 ng deoxyribonukleinsyre (DNA), 1 μl af 10 μM frem og bak primere, 2 μl 2,5 mM deoxynucleotides (dNTP'er), 2 μl 10 x buffer, 0,2 μl DNA polymerase og sterile dobbeltdestilleret vand (ddH2O) til en endelige mængden af 20 μL til at forstærke den anti-kanamycin kassette, nptII -genet24. Skabelonen DNA er fra pBSL18024, som er købt fra nationale BioResource projekt (NBRP). PCR-betingelser er angivet i tabel 1 og primer sekvens er tilgængelig i tabel 2.
  2. Ligate PCR-produkter til et kommercielt kloning vektor efter kit protokol (Se Tabel af materialer).
  3. Punktafgifter nptII -genet fragment fra kloning vektoren af NsiI og SmaI og klon i pBBR1MCS4, som er fordøjet af NsiI og ScaI fra pAKlux29 at skabe de kanamycin resistente plasmid, pWF27813.
  4. Punktafgifter luxCDABE operon fra luciferase udtrykker plasmid9, pAKlux2, af SpeI-HF og ScaI og klon til SpeI-HF og SmaI fordøjet pWF278 for at generere kanamycin resistente og luciferase udtrykker plasmid, pWF27913.
    Bemærk: For plasmid ekstraktioner og skåret fragment purifications, bruge den kommercielle plasmid udvinding og gel udvinding kit, henholdsvis. For enzymet fordøjelsen, blandes 100 ng DNA, 1 μl 10 x buffer, 1 μL af hver valgte begrænsning enzym og sterile ddH2O til en samlet maengde paa 10 μL, og der inkuberes ved 37 ° C i 2,5-3 h.
  5. Omdanne pWF279 plasmid til E. coli O157: H7 EDL933 kompetente celler af elektroporation med 2.500 V til 4 ms.
  6. Inkuber de transformerede bakterieceller i 1 mL Luria-Bertani (LB) medium ved 37 ° C i 1 time.
  7. Plade bakterier på en LB-agar plade suppleret med 50 µg/mL af kanamycin ved 37 ° C i 16-18 h.
  8. Kontrollere en bioluminescerende signalet fra pladen ved en i vivo billeddannelse maskinen næste dag. Vælge en enkelt koloni fra pladen og kultur det i 3 mL LB suppleret med 50 µg/mL kanamycin ved 37 ° C i 16-18 h.
  9. Forberede bakteriel stock medium ved fortynding af 100% glycerol i sterile ddH2O at gøre 30% glycerol løsning.
  10. Fryse kanamycin resistent E. coli O157: H7 EDL933 bakterier husly luciferase plasmid som en bakteriel lager i et skruelåg cryovial som en 1:1 ratio af bakterier kultur og 30% glycerol løsning ved-80 ° C. Den endelige koncentration af glycerol er 15%.

2. en bioluminescerende EHEC bakterier forberedelse til mundtlig podning

Bemærk: Tidslinje rutediagram af de eksperimentelle procedurer for EHEC forberedelse og mus mundtlige sonde er præsenteret i figur 1 til støtte i eksperimentel forberedelse.

  1. Streak E. coli O157: H7 EDL933 bakterier husly luciferase plasmid på en LB-agar plade med 50 µg/mL kanamycin fra-80 ° C materiel. Vokse bakterier i 16-18 timer ved 37 ° C.
  2. Vælge en enkelt koloni fra overnight plade og kultur i 3 mL LB medium med 50 µg/mL kanamycin i 16-18 timer i et 37 ° C inkubator ved 220 rpm.
  3. Subkultur bakterier (1: 100 fortynding) i kanamycin (50 µg/mL) der indeholder LB bouillon til 2,5-3 h i et 37 ° C inkubator ved 200 rpm. (For eksempel tilføje 2 mL natten kulturperler bakterier til 200 mL LB medium med kanamycin (50 µg/mL) suppleret).
  4. Inkuber bakterier til 2,5-3 h og måle værdien optisk tæthed på 600 nm (OD600) indtil værdien er mellem 0,9 til 1. Bakteriel celle nummer er med en tæthed på omkring 108 koloni danner enheder (CFU) / mL.
  5. Centrifugeres igen kulturperler bakterier på 8.000 x g i 30 min, 4 ° C.
  6. Supernatanten uden agiterer pellet af bakterier og vaske pellet med 100 mL 0,9% sterilt normale saltvand af blid agitation.
  7. Gentag trin 2.5 og 2.6 én gang.
  8. Efter vask, centrifugeres bakteriekulturen på 8.000 x g i 30 min, 4 ° C, og supernatanten forsigtigt.
  9. Kondensat pellet på 100-fold med 0,9% sterilt normale saltvand. For eksempel, hvis 200 mL bakterier er centrifugeres, tilføje 2 mL normale saltvand for at suspendere pelleten.
  10. Bekræft bakterier CFU (det bør være ca 109 CFU/100 μL efter kondens i normal saltvand) ved plettering koncentreret bakterier gennem en 10-fold seriel fortynding25.

3. mus mundtlige sonde af EHEC

  1. Behandle 6-uge-forhenværende kvindelig C57BL/6 mus med streptomycin vand (5 g/L) i 24 timer.
  2. Efter 24 h, skifte til regelmæssig drikkevand til en anden 24 timer før sonde. Efter behandling af med almindeligt vand i 24 timer, er musene klar til oral sonde af EHEC.
  3. Fyld sprøjten med 100 μL EHEC bakterier ved at trække tilbage i stemplet. Sikre ingen luftbobler i sprøjten. Fjerne boblerne ved snapping sprøjte med fingrene.
  4. Løfte dyret forsigtigt og placere den på toppen af buret med omhu.
  5. Tag fat med musen i halen omhyggeligt, og dyret vil greb toppen af buret og forsøger at flytte væk.
  6. Forsigtigt holde musen af grådige løs huden af halsen og bagsiden af dyret med tommel- og pegefinger til at forhindre, at lederen af musen flytte.
  7. Hold musen i en lodret position til at indsætte sonde nålen og sikre hovedet af musen er immobiliseret og lodret.
  8. Indsæt sonde nålen ind i musen munden efter taget af munden og flytte i spiserøret og mod maven.
  9. Når indsatte nålen er halvdelen eller to tredjedele længde i musen, indsprøjtes 100 μL EHEC bakterier, som indeholder ca 109 CFU celler.

4. visualisering

  1. Efter den mundtlige mavesonde, opdage de en bioluminescerende signaler på 1-2 dage.
  2. Før det undersøges af en bioluminescerende signaler af dyr, bedøver dem ved at sætte dem ind i et kammer i 2,5% isofluran med 1,5 L/min ilt.
  3. Vente 2-5 min, indtil alle mus bliver bevidstløs og stop flytning. Dyrene er klar til i vivo påvisning af bioluminescens.
  4. Opdage og image en bioluminescerende signaler af dyr af et i vivo imaging system. Se afsnit 5 "Opsamling" for software operation. Under billedprocessen er alle dyr under en fortsatte levering af 2,5% isofluran med 1,5 L/min ilt.
    1. Klik på fil > live, og manuelt fokus på musen.
    2. Vælg eksponering tid og laser intensiteten.
    3. Klik erhverve > fange.
  5. Ex vivo billeddannelse, aflive mus af cervikal dislokation og fjerne inficerede mus hele tarmen. Placer tarmene i en 9 cm petriskål og billede af i vivo imaging system. Indstillingen er den samme som den i vivo billeddannelse bortset synsfelt er angivet som A/B. Se afsnit 5 "Opsamling" for detaljer.
    Bemærk: Metode til cervikal dislokation: dy mus på toppen af buret af grådige hale med den ene hånd, således at dyrene greb buret. Placer en tusch eller tommel og første finger på anden side mod bagsiden af halsen i bunden af kraniet. Hurtigt skub fremad med hånden eller objekt mens fastholdende hovedet og trække sig tilbage med den hånd, der holder halen.
    Check nøje at bekræfte respirationsstop og ingen hjerteslag.

5. opsamling

Bemærk: Den software, der bruges til dataopsamling er opført i Tabel af materialer.

  1. Billede erhvervelse, hvis du Åbn kontrolpanelet erhvervelse af software (figur 2).
  2. Vælg "selvlysende," "Fotografere", og "Overlay".
  3. Indstille eksponeringstid som "Auto". Indstille Binning som "Medium."
  4. Indstille ƒ/stop som 1 for selvlysende og 8 for fotografi. Ƒ/stop styrer mængden af lys modtaget af CCD-detektor.
  5. Angiv det synsfelt, der er baseret på feltet af billeder, der er af interesse at erhverve. Option "D" kan passe fem 6 uger gamle mus og image dem alle på en gang. "C" kan billedet tre 6 uger gamle mus i ét felt.
  6. Når mus/prøver er klar til billedbehandling, skal du klikke på "Erhverve" for image erhvervelse.
  7. Åbn de billeddata, der blev erhvervet.
  8. Åbne panelet værktøjskassen (figur 3).
  9. Vælg ROI værktøjer. Vi anbefaler cirkel (den længst til venstre,) til at spænde en bioluminescerende området på billeder (figur 4).
  10. Klik på "Foranstaltning ROIs" (blyantikon) for at måle den overflade en bioluminescerende intensitet (figur 3). Panelet ROI målinger og kvantificering værdier vises (figur 5).
  11. Bruge den konfigurere måling i venstre hjørne af panelet ROI målinger at vælge værdier/nødvendige oplysninger (figur 6), ellers skal du klikke på "Export" for at eksportere denne datatabellen og gemme som .csv-fil (figur 5).
  12. Brug værdierne for kolonne "Samlede Flux (p/s)" som en bioluminescerende intensitet kvantificering i .csv-filen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi administreres bioluminescens-mærket EHEC (~ 109 bakterieceller) til 6 - uger gamle C57BL/6-hunmus af mundtlige sonde. Efter oral podning af EHEC til mus i 1 h, blev dyrene undersøgt for en bioluminescerende signal af det in vivo billeddannelse systemet som vist i figur 7. Resultaterne viste en stærk en bioluminescerende signal i sonde mus med bioluminescens-mærket EHEC. Vi undersøgte signaler på 2 dage efter infektion. Som vist i figur 8A, musene podet med bioluminescens-mærket wild-type EHEC EDL933 viste intens en bioluminescerende signaler, selv efter 2 dage efter infektion, som foreslog EHEC koloniseret i værter ved 2 dage. Vi har også intragastrically inficeret bioluminescens-mærket EDL933ΔrfaD (ΔrfaD) til mus (figur 8A). Denne mutant, hoppede i LPS (LPS), har vist sig at reducere kolonisering i værten i vores tidligere undersøgelse. Som vist i figur 8A, der er ikke en bioluminescerende signal fundet i ΔrfaD-inficerede mus, hvilket tyder på, at der er ingen eller mindre bakterier celler koloniseret i mus. Kvantificering af de fluorescerende signal er vist i fig. 8B. Næste, placeringen af disse bioluminescens-mærket bakterier blev fastsat. De inficerede mus blev ofret humant og deres hele tarmen fjernes. Tarme af mus 2 dage efter infektion var placeret på 9 cm petriskåle og afbildet ex vivo (figur 9A). Tarmens væv af bioluminescens-mærket EDL933 inficerede mus viste en betydelig stigning i en bioluminescerende signaler i cecum og colon, som tyder på, at disse en bioluminescerende EHEC koloniseret i cecum og colon af inficerede mus efter 2 dage på det mindste. Derimod faldt mus inficeret med bioluminescens-mærket ΔrfaD (figur 9A), afsløret en bioluminescerende signal i deres tarmens væv, som er i overensstemmelse med i vivo billedet (figur 8A ). Kvantificering af de fluorescerende signal er vist i figur 9B.

Figure 1
Figur 1 : Tidslinje af eksperimentelle forberedelse flowdiagram.
Oversigt over timingen for at forberede en bioluminescerende EHEC bakterier og forbehandle mus med streptomycin. (A) EHEC forberedelse. (B) mus forberedelse. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : In vivo imaging system erhvervelse Kontrolpanel.
Før imaging prøver, åbne IVIS erhvervelse Kontrolpanel. Vælg "selvlysende," "Fotografere", og "Overlay". Indstille eksponeringstid som "Auto". Indstille Binning som "Medium." Indstille ƒ/stop som 1 for selvlysende og 8 for fotografi. Ƒ/stop styrer mængden af lys modtaget af CCD-detektor. Når prøverne er klar til billedbehandling, skal du klikke på "Erhverve" for at erhverve billeder. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Værktøjskassen panelet.
Efter image erhvervelse, ved hjælp af værktøjskassen panelet til kvantificere en bioluminescerende intensitet. Åbne panelet værktøjskassen og de billeddata. Vælg en ROI-værktøjer til at spænde en bioluminescerende signalerne på billeder. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 : En bioluminescerende signal fra prøve til kvantificering.
En bioluminescerende signal område på billeder omkranset af ROI værktøjer. Alle en bioluminescerende signaler vist her er i den røde cirkel. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5 : ROI målinger.
Efter cirkling en bioluminescerende signaler og klikke på "Foranstaltning ROIs" på panelet værktøjskassen, er værdier præsenteret som vist. Værdierne i kolonnen samlede Flux (p/s) bruges til en bioluminescerende intensitet kvantificering. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6 : Tilføj forskellige kvantificering oplysninger.
Ved at klikke på Konfigurer måling i venstre hjørne af panelet ROI målinger, kan du vælge andre ønskede kvantificering værdier/oplysninger. Venligst klik her for at se en større version af dette tal.

Figure 7
Figur 7 : Repræsentativt billede af mus efter podet med en bioluminescerende EHEC.
Repræsentativt billede af mus podet med en bioluminescerende EHEC af mundtlige sonde inden for 1 h. Farveskalaen repræsenterer udstråling (p/s/cm2/sr). Venligst klik her for at se en større version af dette tal.

Figure 8
Figur 8 : Billeder af mus podet med bioluminescens-mærket EHEC efter 2 dage.
(A) repræsenterer billede af mus podet med en bioluminescerende vildtype EHEC EDL933 og EDL933:ΔrfaD af mundtlige sonde efter 2 dage efter infektion. (B) kvantificering af bioluminescens intensiteten af mus inficeret med EHEC. Fejllinjer angive standardafvigelser. Repræsentative billeder vises. Alle eksperimenter blev udført uafhængigt tre gange med 2-3 dyr hver gang, og fejllinjer angive standardafvigelser. P-værdier angiver resultaterne af den statistiske analyse af t-test. Farveskalaen repræsenterer udstråling (p/s/cm2/sr). Venligst klik her for at se en større version af dette tal.

Figure 9
Figur 9 : Billeder af tarmens væv af inficerede mus med bioluminescens-mærket EHEC.
(A) 2 dage efter podning med bioluminescens-mærket EHEC, musene blev aflivet og hele tarmens væv blev fjernet og afbildet ex vivo. Repræsentative billeder vises. (B) kvantificering af bioluminescens intensiteten af tarmens væv fra inficeret med EHEC-mus. Alle eksperimenter blev udført uafhængigt tre gange med 2-3 dyr hver gang, og fejllinjer angive standardafvigelser. P-værdier angiver resultaterne af den statistiske analyse af t-test. Farveskalaen repræsenterer udstråling (p/s/cm2/sr). Skalalinjen repræsenterer 1 cm. venligst klik her for at se en større version af dette tal.

Trin Temperatur Tid Antal cyklusser
Indledende denaturering 95 ° C 10 min 1
Denaturering 95 ° C 30 sek 35
Udglødning 58,4 ° C 30 sek
Udvidelse 72 ° C 1,5 min
Endelige udvidelse 72 ° C 10 min 1
Hold 4 ° C 1

Tabel 1: Polymerase kædereaktion (PCR) betingelser

Primere navn Sekvens
nptII F 5' CCTATGCATAATAATTCCGCTAGCTTCACG3'
nptII Rasmussen 5' GCTCCACCGATAATATTCCTGAGTCATACT3'

Tabel 2: Primer sekvenser brugt til at forstærke nptII

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det er blevet rapporteret, at EHEC omdannet med luciferase plasmid er blevet udnyttet til at undersøge dens lokalisering i værter eller gen udtryk i vivo8,11,12. Murine modellen demonstreret her er også blevet rapporteret til at opdage EHEC koloniseret timing og lokalisering i murine vært8. Ikke desto mindre, vi leverer detaljer protokollen af hvordan du administrere EHEC podning til mus intragastrically og hvordan man omhyggeligt forberede mundtlige sonde en bioluminescerende bakterier. Især for musen mundtlige sonde af EHEC (trin 3,7) er placeringen af musen hovedet kritisk når sonde nål indsættes. Hvis placeringen ikke er lodret, det vil være vanskeligt at passere nål, og det kunne eventuelt såre musen. I trin 3.8, når sonde nålen er inde i munden af musen, bliver tungen lå uden for munden lidt. Hvis modstand er stødt på ved forbikørsel sonde nålen til spiserøret, stoppe flytter nålen frem og trække det straks. Ændre nål holdning for at sikre, at nålen er ind i spiserøret. Nålen kan være indtastning luftrøret når resistens opstår, hvilket ville føre til indsprøjtning bakterier i lungerne i stedet for maven.

Anvendelse af grøn fluorescerende proteiner (NGL) som en biosensor er fælles i biologiske eksperimenter. Dog bruger normal god landbrugspraksis som reporter for at observere patogen infektion/kolonisering i levende dyr af i vivo billeddannelse ikke anbefales, fordi absorbans af hæmoglobin, proteiner og vand er høj mellem 200-650 nm26, der overlapper med Normal god landbrugspraksis (excitation 480 nm, emission 510 nm)27. Derfor, ved hjælp af normal god landbrugspraksis kan signal som reporter for i vivo billeddannelse være afbrudt af hæmoglobin, proteiner og vand i dyr26. Nær-infrarødt (NIR) Fluorescens er særdeles velegnet til i vivo billeddannelse fordi dets absorbans vindue er omkring 650-900 nm28, der er i regionen i laveste værdi af absorptionskoefficienten af hæmoglobin (< 650 nm) og vand (> 900 nm)26 ,28 . Desuden, når væv absorberer lys, der er en chance for at fremkalde autofluorescence. Når bølgelængder af excitations- og spænder i vinduet normal god landbrugspraksis, inducerer det meget mere autofluorescence end NIR29. Anvendelse af NIR kan forbedre signal-baggrund forholdet i forhold til normal god landbrugspraksis ved at fjerne autofluorescence baggrund29. Bioluminescens kræver ikke energi excitation at generere synligt lys. Det afhænger af reaktionen på katalyserer substrat luciferin af dens enzymet luciferase og skabe lys. Da bioluminescens ikke kræver lys direkte på en stikprøve, er baggrund signalet fra en prøve meget lav. Derfor, brug af bioluminescens som en journalist er mere almindelige og lettere for i vivo billeddannelse. Derimod kræver fluorescens lys excitation at fremkalde signallys. Når væv absorbere lys, er der en chance for at den fluorescerende lys vil blive udledt og fremkalde autofluorescence, således at deres signal til støj er højere sammenlignet med bioluminescens.

Overvejer EHEC er naturligvis mindre koloniseret i mus af oral infektion2,22, en naturlig slimhinde patogen af mus, kaldet Citrobacter rodentium, har været udnyttet til at studere kolonisering mekanisme til murine vært som en rugemor bakterie22,30. Begge EHEC og C. rodentium kolonisere tarmslimhinden og fremkalde dannelse af A/E læsioner i vært22,30. De indeholder også LEE patogenicitet ø, som koder en T3SS og flere effektor proteiner, som inducerede A/E læsion22,30. Derfor rapporteret brugen af luciferase udtrykker plasmid som en reporter i C. rodentium at opdage kolonisering patologi og studere kolonisering mekanisme via en in vivo billeddannelse systemet har også været14, 15. ikke desto mindre, mens C. rodentium infektion af mus er en nyttig model til at undersøge funktionen af T3SS og mekanismen af A/E læsion, C. rodentium indeholder ikke Shiga toksin (Stx)30, som er en dominerende virulens faktor, der forårsager nyresvigt i EHEC, især serotype O157: H73. Selv om en Stx-udtrykker C. rodentium stamme er bygget for nylig31, som er mere realistisk at EHEC infektion, omfatter ikke andre potentielle EHEC virulens faktorer der er afgørende for kolonisering og/eller infektion. Derudover deler C. rodentium 67% af sine gener med EHEC32, hvilket tyder på, at EHEC kan bruge en virulens adskiller sig fra C. rodentium under kolonisering og/eller infektion.

Luciferase udtrykker plasmid brugt her, pWF27913, blev ændret fra pAKlux29 hvis rygrad er pBBR1MCS433. Selvom pBBR1MCS4 er blevet testet og replikeres i forskellige bakterier33, det er afgørende at sikre, at oprindelsen af replikation (ORI) af denne plasmid er egnet til den bakterielle host før du bruger denne plasmid-baserede luciferase system for eksperimentet og hvilket bekræfter at denne luciferase udtrykker plasmid kan replikere i den bakterielle vært. Vi bruger antibiotika stress for at bevare stabiliteten i plasmid i bakterier. Når bakterier Indtast dyr i fravær af antibiotika, er wild-type EHEC en bioluminescerende signalet blevet opdaget i mindst 2 dage. Men vi gjorde ikke efter infektion i mere end 2 dage da vi allerede havde set en betydelig forskel i selvlysende intensitet mellem EHEC WT og EHEC rfaD (der koder et gen kræves for EHEC syntese intakt LP'ER) mutant på 2 dage. For at opretholde plasmid stabilt i bakterier under fravær af antibiotika, kan en plasmid pCM1710,34 bruges til dette formål. pCM17 koder en to-plasmid partitionering system og en post-segregational drab mekanisme til at sikre opretholdelse af plasmid i bakterier i fravær af antibiotika10,34. Den plasmidet pCM17 indeholdende luxCDABE operon drevet af OmpC promoter kan påvises ved en bioluminescerende signal for mindst 7 dage8. En alternativ metode til at opnå en kontinuerlig en bioluminescerende udtryk bakterier i fravær af antibiotika er at indsætte luxABCDE gen i den bakterielle kromosom35. Francis et al. anvendte transposon indsat luxABCDE operon og antibiotika kassette tilfældigt indsat i kromosom af Streptococcus pneumoniae at opnå bioluminescens stabil stamme35.

I vores tidligere undersøgelse13udnyttede vi denne modelsystem til at undersøge EHEC kolonisering i en vært og sammenligne forskellen kolonisering evne EHEC vildtype (WT) og mutant13. Når musene blev administreret af en bioluminescerende EHEC rfaD mutant, en bioluminescerende signalerne faldet dramatisk sammenlignet med at på WT EHEC efter 2 dage efter infektion. Det dokumenterer at denne murine model kan analysere mutation effekten af EHEC kolonisering i værten. Derudover terapeutiske behandlinger for at reducere kolonisering af EHEC er en velovervejet, potentielle løsning til EHEC infektion da brugen af antibiotika er kontraindiceret5,36. Derfor er det værd at teste om denne modelsystem kan bruges til at undersøge effekten af anti-kolonisering narkotika/behandlinger mod enterobacteria kolonisering i værten. Vi mener, at ved hjælp af denne modelsystem, det er muligt at undersøge timing og placering af ikke blot EHEC, men også andre enterobacteria kolonisering in vivo. Ved hjælp af denne dyremodel, processen med EHEC kolonisering i mus kan overvåges og kolonisering byrde i værtsmedlemsstaten kan kvantificeres Bestem rumlige og tidsmæssige kolonisering af EHEC med levende dyr. Visualisering og kvantificering af enterobacteria kolonisering ved hjælp af denne model gør det et fantastisk værktøj til at undersøge og analysere de fine mekanismer i enterobacterial kolonisering, og dermed kompensere for mangel på kolonisering forskning og forbedre nuværende viden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Vi anerkender Chi-Chung Chen fra Institut for medicinalforskning, Chi Mei Medical Center (Tainan, Taiwan) for hjælpen i mus, infektion, og støtte fra byens laboratorium dyr af National Cheng Kung University. Dette arbejde støttes af Minister for videnskab og teknologi (de fleste) tilskud (mest 104-2321-B-006-019, 105-2321-B-006-011, and106-2321-B-006-005) til CC.

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
Påvisning af Enterohemorrhagic <em>Escherichia Coli</em> kolonisering i Murine vært ved Non-invasiv <em>In Vivo</em> bioluminescens System
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter