Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Påvisning av enterohemorrhagiske Escherichia Coli kolonisering i Murine vert av ikke-invasiv i Vivo bioluminescens System

doi: 10.3791/56169 Published: April 9, 2018

Summary

Detaljert protokollen musemodell for enterohemorrhagiske E. coli (EHEC) kolonisering ved hjelp av bioluminescens-merket bakterier er presentert. Påvisning av disse bioluminescent bakterier av en ikke-invasiv i vivo imaging system i levende dyr kan gå vår nåværende forståelse av EHEC kolonisering.

Abstract

Enterohemorrhagiske E. coli (EHEC) O157: H7, som er en infeksjon patogen som causesdiarrhea, hemoragisk kolitt (HS), og Hemolytisk uremisk syndrom (HUS), kolonisere til tarmkanalen mennesker. For å studere detaljert mekanismen av EHEC kolonisering i vivo, er det viktig å ha dyremodeller overvåke og kvantifisere EHEC kolonisering. Vi viser her en mus-EHEC kolonisering modell ved å gjøre det bioluminescent uttrykke plasmider til EHEC overvåke og kvantifisere EHEC kolonisering i levende verter. Dyr inokulert med bioluminescens-merket EHEC viser intense bioluminescent signaler i mus av oppdagelsen med en ikke-invasiv i vivo tenkelig system. Etter 1 og 2 dager legge infeksjon, bioluminescent signaler fortsatt ble oppdaget i infiserte dyr, noe som antyder at EHEC kolonisere i verter i minst 2 dager. Vi viser også at disse bioluminescent EHEC finne til musen-tarmen, spesielt i cecum og kolon, fra ex vivo bilder. Denne musen-EHEC kolonisering modellen kan tjene som et verktøy for å fremme nåværende kunnskap av EHEC kolonisering mekanismen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EHEC O157: H7 er en patogen som forårsaker diaré1, HS2, HUS3og selv akutt nyresvikt4 gjennom forurenset vann eller mat. EHEC er en sykdomsfremkallende enterobacterium og colonizes til fordøyelsessystemet mennesker1. Når EHEC overholder først vert intestinal epitel, injiserer de kolonisering faktorene i verten cellene til type III sekresjon systemet (T3SS) som fungerer som en molekylær sprøyte indusere en feste og effacing (A/E) lesjon senere å håndheve vedheft (kolonisering)5. Disse genene involvert i A/E lesjon formasjon er kodet av locus enterocyte effacement (LEE) virusets øya5.

Bioluminescens er en lys-produserende kjemisk reaksjon, i luciferase som gir sin substrat luciferin å generere synlig lys6. Denne enzymatisk prosess krever ofte oksygen eller adenosin trifosfat (ATP)6. Bioluminescens imaging (BLI) tillater forskere visualisering og kvantisering vert-patogen samhandlinger i levende dyr7. BLI kan beskrive bakteriell infeksjon syklusen i levende dyr ved å følge bioluminescent bakterier som de migrere til og invadere forskjellige vev7; Dette avslører en dynamisk progresjon av infeksjon. Videre er bakterielle belastningen i dyr knyttet til bioluminescent signal8; Det er derfor en praktisk indikator å anslå patologisk forholdene i forsøksdyr på en enkel og direkte måte.

Plasmider her finnes luciferase operon, luxCDABE, som er fra bakterien Photorhabdus luminescens som koder egen luciferase substrat7,9. Ved å gjøre denne luciferase-uttrykke plasmider til bakterier, kan kolonisering og infeksjon prosessene overvåkes ved å observere disse bioluminescent bakterier i levende dyr. Samlet tillater BLI og bioluminesens-merket bakterier forskere å overvåke bakteriell tall og beliggenheten, bakteriell viability med antibiotika/terapi behandling og bakteriell genuttrykk i infeksjon/kolonisering6, 7. mange patogene bakterier har blitt rapportert som express luxCDABE operon undersøke deres infeksjon syklus og/eller genet uttrykk i infeksjon. Disse bakterier, inkludert uropathogenic E. coli10, EHEC8,11,12,13, enteropathogenic E. coli (EPEC)8, Citrobacter rodentium14,15, Salmonella typhimurium16, Listeria monocytogenes17, Yersinia enterocolitica18,19, og Vibrio cholerae20, dokumentert.

Flere eksperimentelle modeller er utviklet for å lette studiet av EHEC kolonisering i vitro og vivo21,22,23. Men er det en mangel på passende dyremodeller å studere av EHEC kolonisering i vivo, og dermed en resulterende mangelen på detaljer. For å lette studie av EHEC kolonisering mekanisme i vivo, er det verdifullt å bygge dyremodeller å observere og kvantifisere EHEC kolonisering i levende dyr på en ikke-invasiv metode.

Dette manuskriptet beskriver en mus-EHEC kolonisering modell som bruker en bioluminescent uttrykke system for å overvåke EHEC kolonisering over tid i levende verter. Mus er intragastrically inokulert med bioluminescens-merket EHEC og bioluminescent signalet registreres i mus med en ikke-invasiv i vivo imaging system13. Mus infisert bioluminescens-merket EHEC viste betydelige bioluminescent signaler i deres tarmen etter 2 dager legge infeksjon, som foreslo at de bakteriene kolonisert i vert tarmen etter 2 dager legge infeksjon. Ex vivo bildedata viste at denne colonization er spesielt i cecum og kolon av mus. Ved å bruke denne musen-EHEC-modellen, kan bioluminescent EHEC koloniseringen oppdages i levende vert av en i vivo tenkelig system, for å studere detaljert mekanismer for enteric bakterier kolonisering, som kan fremme videre forståelse i EHEC-indusert fysiologiske og patologiske endringer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Forsiktig: EHEC O157: H7 er en biosafety nivå 2 (BSL-2) patogen ifølge Centers for Disease Control og Prevention (CDC) biosikkerhet instruksjon (https://www.cdc.gov/). Derfor må alle eksperimentelle prosedyrer som involverer EHEC utføres i BSL-2 anlegg. Bruk labfrakker og hansker ved utføring av eksperimentet. Innarbeide en sertifisert biosafety kabinett (BSC). Desinfiser eksperimentelle benken før og etter den eksperimentelle prosedyren med 70% etanol. Alle instrumenter eller utstyr at kontakt (eller potensielt kontakt) EHEC bør desinfiseres med 70% etanol eller blekemiddel. Forurenset (eller potensielt kontaminerte) avfall skal være forseglet og autoklaveres nøye. Bære en maske, vernebriller, doble hansker eller en kjeledress, om nødvendig. 6-uke-gamle C57BL/6 kvinnelige musene ble kjøpt og vedlikeholdes på laboratoriet dyr senter av National Cheng Kung University (NCKU). Det dyreforsøkene ble godkjent av institusjonelle Animal Care og bruk komiteen av NCKU (godkjenningsnummer 104-039).

1. Bioluciferase-merket EHEC bakterier generasjon

  1. Mix 50 ng deoksyribonukleinsyre (DNA), 1 μL hver 10 μM vanlige og motsatte primere, 2 μL 2,5 deoxynucleotides (dNTPs), 2 μL 10 x buffer og 0,2 μL DNA polymerase sterilt dobbel-destillert vann (ddH2O) til et endelig antall 20 μL å forsterke den anti-kanamycin bånd nptII gene24. Malen DNA er fra pBSL18024, som er kjøpt fra National BioResource Project (NBRP). PCR forholdene er oppført i tabell 1 og primer sekvensen finnes i tabell 2.
  2. Ligate PCR produktene til en kommersiell kloning vektor etter kit protokollen (se Tabell for materiale).
  3. Avgiftsdirektoratet nptII gene fragment fra kloning vektoren som NsiI og SmaI og klone i pBBR1MCS4, som er fordøyd av NsiI og skalerbare pAKlux29 til å lage den kanamycin motstandsdyktig plasmider, pWF27813.
  4. Avgiftsdirektoratet luxCDABE operon, fra luciferase uttrykke plasmider9, pAKlux2, av SpeI-HF og ScaI og klone SpeI HF og SmaI fordøyd pWF278 for å generere kanamycin motstandsdyktig og luciferase uttrykke plasmider, pWF27913.
    Merk: Plasmider utdrag og forbrukeravgift fragment renselser, bruke kommersielle plasmider utvinning og gel utvinning kit, henholdsvis. For enzym fordøyelsen, bland 100 ng DNA, 1 μL 10 x buffer, 1 μL av hver valgte begrensning enzym og sterile ddH2O til et totalt volum på 10 μL, og ruge ved 37 ° C i 2,5-3 h.
  5. Forvandle pWF279 plasmider E. coli O157: H7 EDL933 kompetent celler av electroporation med 2500 V for 4 ms.
  6. Inkuber transformert bakterier cellene i 1 mL Luria-Bertani (LB) medium ved 37 ° C i 1 time.
  7. Plate bakterier på en LB agar plate med 50 µg/mL av kanamycin ved 37 ° C i 16-18 h.
  8. Sjekk bioluminescent signalet av platen av en i vivo tenkelig maskinen neste dag. Velg en enkelt koloni fra platen og kultur det i 3 mL LB supplert med 50 µg/mL kanamycin ved 37 ° C i 16-18 h.
  9. Forberede bakteriell lager medium fortynne 100% glyserol i sterilt ddH2O å 30% glyserol løsningen.
  10. Fryse kanamycin motstandsdyktig E. coli O157: H7 EDL933 bakterier skjuler luciferase plasmider som en bakteriell aksjer i en skrukork cryovial som en 1:1 ratio bakterier kultur og 30% glyserol løsning på-80 ° C. Siste konsentrasjonen av glyserol er 15%.

2. bioluminescent EHEC bakterier forberedelse til muntlig vaksinering

Merk: Tidslinjen flytskjemaet av eksperimentelle prosedyrer for EHEC forberedelse og mus muntlig gavage vises i figur 1 til hjelp i eksperimentell forberedelse.

  1. Strek E. coli O157: H7 EDL933 bakterier skjuler luciferase plasmider på en LB agar plate med 50 µg/mL kanamycin fra-80 ° C lager. Vokse bakterier på 16-18 h på 37 ° C.
  2. Velg en enkelt koloni fra overnatting plate og kultur i 3 mL LB medium med 50 µg/mL kanamycin 16-18 h i en inkubator 37 ° C på 220 rpm.
  3. Subkultur bakterier (1: 100 fortynning) i kanamycin (50 µg/mL) som inneholder LB kjøttkraft 2,5-3 h i en 37 ° C inkubator på 200 rpm. (For eksempel legge 2 mL natten kultivert bakterier til 200 mL LB medium med kanamycin (50 µg/mL) supplert).
  4. Ruge bakterier 2,5-3 h og måle optisk densitet verdien på 600 nm (OD600) til verdien er mellom 0,9 til 1. Bakteriell celle er på en tetthet av ca 108 kolonien danner enheter (CFU) / mL.
  5. Sentrifuge re kulturperler bakterier 8000 x g i 30 min, 4 ° C.
  6. Forkaste nedbryting uten agitating pellets bakterier og vask pellets med 100 mL 0,9% sterilt normal saline ved mild agitasjon.
  7. Gjenta trinn 2.5 og 2.6 en gang.
  8. Etter vask, sentrifuge bakteriell kultur 8000 x g i 30 min, 4 ° C og kast nedbryting forsiktig.
  9. Kondensat i pellet på 100-fold med 0,9% sterilt normal saline. For eksempel hvis 200 mL bakterier er centrifuged, legge 2 mL normal saline å suspendere pellet.
  10. Bekreft bakterier CFU (det skal være ca 109 CFU/100 μL etter kondens i vanlig saltvann) ved plating konsentrert bakterier gjennom en 10 ganger føljetong fortynning25.

3. musen muntlig Gavage av EHEC

  1. Behandle 6 uke gamle kvinnelige C57BL/6 mus med streptomycin vann (5 g/L) for 24 timer.
  2. Etter 24 timer, kan du bytte til vanlig drikkevann for en annen 24 timer før gavage. Etter behandling med vanlig vann 24 h, er mus klar for muntlig gavage av EHEC.
  3. Fyll sprøyten med 100 μL EHEC bakterier ved å trekke tilbake på stempelet. Kontroller at ingen luftbobler er i sprøyten. Fjerne bobler ved å feste sprøyten med fingrene.
  4. Løfte dyret forsiktig og plasser den på toppen av buret med forsiktighet.
  5. Ta tak musen halen nøye, og dyret vil grep toppen av bur og forsøk å flytte vekk.
  6. Forsiktig holde musen ved å ta tak det løs hud av halsen og baksiden av dyret med tommelen og pekefingeren hindre at leder av musen flytte.
  7. Hold musen i vertikal posisjon å sette inn gavage nålen og leder av musen er immobilisert og loddrett.
  8. Gavage nålen inn musen munnen etter taket av munnen og Flytt i spiserøret og magen.
  9. Når satt inn nålen er halv eller to tredjedeler lengde i musen, injisere 100 μL EHEC bakterier, som inneholder ca 109 CFU celler.

4. visualisering

  1. Etter den muntlige gavage, oppdage bioluminescent signalene på 1 og 2 dager.
  2. Før bioluminescent signaler av dyr, bedøve dem ved å sette dem i et kammer av 2,5% isoflurane med 1,5 L/min oksygen.
  3. Vent i 2-5 min til alle mus blitt bevisstløs og stoppe flytting. Dyrene er klar i vivo deteksjon av bioluminescens.
  4. Oppdage og image bioluminescent signaler av dyr av en i vivo tenkelig system. Se seksjon 5 "Datainnsamling" programvare drift. Under avbildingsprosessen er alle dyrene under en tilførsel av 2,5% isoflurane med 1,5 L/min oksygen.
    1. Klikk Fil > live og manuelt fokus på musen.
    2. Velg eksponering tid og laser intensiteten.
    3. Klikk erverve > fange.
  5. For ex vivo bildebehandling, euthanize musene av cervical forvridning og fjerne hele tarmen av infiserte mus. Plass tarmen 9 cm Petriskål og bilde av i vivo tenkelig system. Innstillingen er den samme som den i vivo imaging bortsett fra synsfelt er angitt som A/B. Se seksjon 5 "Datainnsamling" for detaljer.
    Merk: Metode for cervical forvridning: holde musene på buret av fatte halen med én hånd slik at dyrene grep buret. Plass en markør penn eller tommel og første finger på den andre hånden mot baksiden av halsen ved foten av skallen. Raskt presse frem med hånd objekt mens holde hodet og trekk bakover med hånden holder halen.
    Kontroller nøye bekrefte respirasjonsstans og ingen hjerteslag.

5. datainnsamling

Merk: Programvaren brukes for datainnsamling er oppført i Tabellen for materiale.

  1. For bildeopptak, åpner du kontrollpanelet oppkjøpet av programvaren (figur 2).
  2. Velg "Selvlysende", "Photograph", og "Overlegg."
  3. Angi tiden som «Auto». Angi Binning som "Medium".
  4. Angi ƒ/stopp som 1 for selvlysende og 8 for fotografi. Ƒ/stopp styrer mengden av lys mottatt av CCD detektoren.
  5. Angi synsfelt basert på feltet av bilder som er av interesse å kjøpe. Alternativet "D" kan passe fem 6 uke gamle mus og image dem alle samtidig. "C" kan bildet tre 6 uke gamle mus i ett felt.
  6. Når mus/prøvene er klart til avbilding, klikk "Hent" for bildeopptak.
  7. Åpne bildedataene som ble kjøpt.
  8. Åpne paletten for verktøyet for panelet (Figur 3).
  9. Velg ROI verktøy. Vi anbefaler sirkelen (den venstre) å variere bioluminescent området på bilder (Figur 4).
  10. Klikk "Mål ROIs" (blyantikon) for å måle overflate bioluminescent intensitet (Figur 3). ROI målinger panelet og kvantifisering verdiene vises (figur 5).
  11. Bruk Konfigurer måling avkastning mål-panelet til venstre velger verdier/informasjon som trengs (figur 6), ellers klikker "Export" for å eksportere denne tabellen og lagre som CSV-fil (figur 5).
  12. Bruk verdiene i kolonnen "Total Flux (p/s)" som bioluminescent intensitet kvantifiseringen i CSV-filen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Administrert vi bioluminescens-merket EHEC (~ 109 bakterielle celler) til 6 - uke gamle kvinnelige C57BL/6 mus ved muntlig gavage. Etter muntlig vaksinasjon av EHEC til mus innen 1 h, ble dyrene undersøkt for bioluminescent signalet av i vivo tenkelig systemet som vist i figur 7. Resultatene viste en sterk bioluminescent signal i gavage mus med bioluminescens-merket EHEC. Vi undersøkte signalene på 2 dager innlegget infeksjon. Som vist i figur 8A, musene inokulert med bioluminescens-merket vill-type EHEC EDL933 viste intense bioluminescent signaler selv etter 2 dager legge infeksjon, som foreslo EHEC kolonisert i verter med 2 dager. Vi har også intragastrically infisert bioluminescens-merket EDL933ΔrfaD (ΔrfaD) til mus (figur 8A). Denne mutant, hoppet i lipopolysakkarid (LPS), har vist seg å redusere kolonisering i verten i vår forrige studie. Som vist i figur 8A, det er ikke noe bioluminescent signal oppdaget i ΔrfaD-infiserte mus, som antyder at det er ingen eller mindre bakterier celler kolonisert i mus. Kvantifisering av fluorescerende signalet er vist i figur 8B. Deretter ble plasseringen av disse bioluminescens-merket bakteriene bestemt. Infiserte mus ble ofret Human og deres hele tarmen fjernet. Tarmen av mus 2 dager innlegget ble plassert på 9 cm Petri retter og fotografert ex vivo (figur 9A). Intestinal vev bioluminescens-merket EDL933 infiserte mus avslørte en betydelig økning i bioluminescent signaler i cecum og kolon, som foreslår at disse bioluminescent EHEC kolonisert i cecum og kolon av infiserte mus for 2 dager minst. Derimot redusert mus infisert med bioluminescens-merket ΔrfaD (figur 9A), avslørt bioluminescent signalet i deres tarmen tissue, som samsvarer med bildet i vivo (figur 8A ). Kvantifisering av fluorescerende signalet er vist i figur 9B.

Figure 1
Figur 1 : Tidslinje eksperimentell forberedelse flow diagram.
Oversikt over tidspunktet for å forberede bioluminescent EHEC bakterier og pretreat mus med streptomycin. (A) EHEC forberedelse. (B) mus forberedelse. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : I vivo imaging systemkontrollpanelet oppkjøpet.
Åpne IVIS oppkjøpet Kontrollpanel før imaging prøver. Velg "Selvlysende", "Photograph", og "Overlegg." Angi tiden som «Auto». Angi Binning som "Medium". Angi ƒ/stopp som 1 for selvlysende og 8 for fotografi. Ƒ/stopp styrer mengden av lys mottatt av CCD detektoren. Når prøvene er klart til avbilding, klikker du "Hent" for å hente bilder. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Paletten for verktøyet for panelet.
Bilde innhenting, bruk paletten for verktøyet for panelet for kvantifisering bioluminescent intensitet. Åpne paletten for verktøyet for panelet og image data. Velg en av Avkastningen verktøy til å variere bioluminescent signalene på bilder. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Bioluminescent signalet fra prøve for kvantifisering.
Bioluminescent signal området på bilder omkranset av Avkastningen verktøy. Alle bioluminescent signaler vises her er i den røde sirkelen. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5 : Avkastning mål.
Etter sirkle bioluminescent signaler og klikke "Mål ROIs" på paletten for verktøyet for panelet, presenteres verdier som vist. Bioluminescent intensitet kvantifiseringen brukes verdiene i kolonnen Total Flux (p/s). Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6 : Legge til informasjon om forskjellige kvantifisering.
Ved å klikke på Konfigurer måling avkastning mål-panelet til venstre, kan du velge andre ønskede kvantifisering verdier/informasjon. Klikk her for å se en større versjon av dette tallet.

Figure 7
Figur 7 : Representativt bilde av mus etter inokulert med bioluminescent EHEC.
Representativt bilde av mus inokulert med bioluminescent EHEC av muntlig gavage i 1 time. Fargeskala representerer utstråling (p/s/cm2/sr). Klikk her for å se en større versjon av dette tallet.

Figure 8
Figur 8 : Bilder av mus inokulert med bioluminescens-merket EHEC etter 2 dager.
(A) representerer bilde av mus inokulert med bioluminescent vill-type EHEC EDL933 og EDL933:ΔrfaD av muntlig gavage etter 2 dager legge infeksjon. (B) kvantifisering av bioluminescens intensiteten av mus infisert av EHEC. Feilfelt viser på standardavvikene. Representant bilder vises. Alle eksperimentene ble foretatt tre ganger med 2-3 dyr hver gang, og feilfelt viser på standardavvikene. P-verdier betegne resultatene av statistisk analyse av t-test. Fargeskala representerer utstråling (p/s/cm2/sr). Klikk her for å se en større versjon av dette tallet.

Figure 9
Figur 9 : Bilder av intestinal vev av infiserte mus med bioluminescens-merket EHEC.
(A) 2 dager etter vaksinering med bioluminescens-merket EHEC, mus var euthanized og hele intestinal vev ble fjernet og fotografert ex vivo. Representant bilder vises. (B) kvantifisering av bioluminescens intensiteten av intestinal vev fra mus infisert av EHEC. Alle eksperimentene ble foretatt tre ganger med 2-3 dyr hver gang, og feilfelt viser på standardavvikene. P-verdier betegne resultatene av statistisk analyse av t-test. Fargeskala representerer utstråling (p/s/cm2/sr). Skala linjen representerer 1 cm. Klikk her for å se en større versjon av dette tallet.

Trinn Temperatur Tid Antall sykluser
Første rødsprit 95 ° C 10 min 1
Rødsprit 95 ° C 30 sek 35
Avspenning 58.4 ° C 30 sek
Utvidelse 72 ° C 1,5 min
Endelig utvidelse 72 ° C 10 min 1
Hold 4 ° C 1

Tabell 1: Polymerase kjedereaksjon (PCR) forhold

Primere navn Sekvens
nptII F 5' CCTATGCATAATAATTCCGCTAGCTTCACG3'
nptII R 5' GCTCCACCGATAATATTCCTGAGTCATACT3'

Tabell 2: Primer sekvenser brukes til å forsterke nptII

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det har blitt rapportert at EHEC forvandlet luciferase plasmider blitt benyttet for å undersøke beliggenheten i verter eller genet uttrykk i vivo8,11,12. Murine modellen demonstrert her er også rapportert å gjenkjenne EHEC kolonisert tidsberegningen og lokalisering i murine vert8. Likevel, vi gir detaljert protokollen for hvordan å administrere EHEC vaksinering til mus intragastrically og nøye forberede bioluminescent bakterier muntlig gavage. Spesielt for musen muntlig gavage av EHEC (trinn 3.7) er plasseringen av musen hodet avgjørende når gavage nålen settes. Hvis plasseringen ikke er loddrett, det vil være vanskelig å passere nålen, og det kan muligens skade musen. I trinn 3.8, når gavage nålen inn i munnen av musen, legger tungen utenfor munnen litt. Hvis motstand når du passerer gavage p å spiserøret, stopper nålen fremover og trekke det umiddelbart. Endre nål plasseringen å sørge for at nålen inn spiserøret. Nålen kunne inn luftrøret når motstand oppstår, som ville føre til sprøytebruk bakterier i lungene i stedet for magen.

Programmet grønne fluorescerende protein (GFP) som en biosensor er vanlig i biologiske eksperimenter. Imidlertid, bruker GFP som reporter for å observere patogen infeksjon/koloniseringen i levende dyr av i vivo tenkelig ikke anbefales, fordi absorbansen ved hemoglobin, proteiner og vann er høye mellom 200-650 nm26, som overlapper med GFP (eksitasjon 480 nm, utslipp 510 nm)27. Derfor kan bruker GFP signalet som reporter for i vivo bildebehandling bli avbrutt av hemoglobin, proteiner og vann i dyr26. Nær infrarød (NIR) fluorescens er ideell for i vivo imaging fordi absorbansen vinduet er rundt 650-900 nm28, som er i størrelsesorden laveste absorpsjon koeffisient av hemoglobin (< 650 nm) og vann (> 900 nm)26 ,28 . Videre når vev absorberer lys, er det en sjanse til å indusere autofluorescence. Når bølgelengdene eksitasjon og utslipp rekkevidde i vinduet GFP, medfører mye mer autofluorescence enn NIR29. Bruk av NIR kan forbedre signal bakgrunn forhold sammenlignet med GFP ved å eliminere autofluorescence bakgrunn29. Bioluminescens krever ikke energi eksitasjon generere synlig lys. Det avhenger av reaksjonen å katalysere substrat luciferin av sin enzymet luciferase og generere lys. Siden bioluminescens ikke krever lys direkte på et utvalg, er bakgrunn signalet fra en prøve svært lav. Derfor bruk av bioluminescens som reporter er mer generelle og enklere i vivo bildebehandling. I motsetning krever fluorescens lys eksitasjon å indusere signal lys. Når vev absorberer lys, er det en sjanse at fluorescent lyset vil og indusere autofluorescence slik at deres signal-til-støy er høyere sammenlignet med bioluminescens.

Vurderer EHEC er naturlig mindre kolonisert i mus av oral smitte2,22, en naturlig mucosal patogen mus, kalt Citrobacter rodentium, blitt benyttet for å studere kolonisering mekanismen murine vert som en surrogat bakterie22,30. Begge EHEC og C. rodentium kolonisere tarmen og indusere dannelsen av A/E lesjoner i vert22,30. De inneholder også LEE virusets øya som koder en T3SS og flere effektor proteiner som indusert A/E lesjon22,30. Derfor rapportert bruk av luciferase uttrykke plasmider som reporter i C. rodentium oppdage kolonisering patologi og studere kolonisering mekanismen via et i vivo tenkelig system har også vært14, 15. likevel C. rodentium infeksjon mus er en nyttig modell å undersøke funksjonen til T3SS og mekanismen til A/E lesjon, C. rodentium inneholder ikke Shiga gift (Stx)30, som er en dominerende virulens faktor som anledninger nyresvikten inne EHEC, spesielt serotype O157: H73. Selv om en Stx-uttrykke C. rodentium belastning er konstruert nylig31, som er mer realistisk å EHEC infeksjon, den inneholder ikke andre potensielle EHEC virulens faktorer som er avgjørende for kolonisering og/eller infeksjon. Videre aksjer C. rodentium 67% av sine gener med EHEC32, noe som antyder at EHEC kan bruke en virulens forskjellig fra C. rodentium under kolonisering og/eller infeksjon.

Luciferase uttrykke plasmider brukt her, pWF27913, ble endret fra pAKlux29 som ryggraden er pBBR1MCS433. Selv om pBBR1MCS4 har blitt testet og replikert i ulike bakterier33, er det avgjørende å sikre opprinnelsen til replikering (ORI) av denne plasmider er egnet for bakteriell verten før du bruker denne plasmider-baserte luciferase system for eksperimentet og dermed bekrefter at denne luciferase uttrykke plasmider replikeres i bakteriell verten. Vi bruker antibiotika stress for å opprettholde stabiliteten i plasmider i bakterier. Når bakterier angir dyr i fravær av antibiotika, ble bioluminescent signalet av vill-type EHEC oppdaget i minst 2 dager. Men vi ikke etter smitte i mer enn 2 dager fordi vi allerede hadde sett en betydelig forskjell i selvlysende intensitet mellom EHEC WT og EHEC rfaD (som koder et gen kreves for EHEC syntetisere intakt LPS) mutant på 2 dager. For å opprettholde plasmider stabilt i bakterier under fraværet av antibiotika, kan en plasmider pCM1710,34 brukes til dette formålet. pCM17 koder et to-plasmider partisjonering system og post-segregational drapet mekanisme for å sikre at vedlikehold av plasmider i bakterier i fravær av antibiotika10,34. Plasmider pCM17 inneholder luxCDABE operon drevet av OmpC selskapet kan oppdages av bioluminescent signal for minst 7 dager8. En alternativ metode å få en kontinuerlig bioluminescent uttrykk bakterier i fravær av antibiotika er å sette inn luxABCDE gene i bakteriell kromosom35. Francis et al. brukes transposon inn luxABCDE operon og antibiotika kassetten tilfeldig inn kromosomet av Streptococcus pneumoniae hente bioluminescens stabil belastning35.

I vår forrige studie13utnyttet vi denne modellsystem for å undersøke EHEC kolonisering i en vert og sammenligne forskjellen av kolonisering EHEC wild type (WT) og mutant13. Når mus ble administrert bioluminescent EHEC rfaD mutant, bioluminescent signalene redusert dramatisk forhold til at av WT EHEC etter 2 dager legge infeksjon. Det gir bevis på at denne murine modellen kan analysere mutasjon effekten av EHEC kolonisering i verten. Videre terapeutiske behandlinger for å redusere koloniseringen av EHEC er en vurdert, potensielle løsning EHEC infeksjon siden bruken av antibiotika er kontraindisert5,36. Derfor er det verdt å teste om denne modellen systemet kan brukes til å undersøke effekten av anti-kolonisering narkotika og behandling mot enterobacteria kolonisering i verten. Vi tror at ved bruker denne modellen, er det mulig å undersøke tidsberegningen og plasseringen av ikke bare EHEC, men også andre enterobacteria kolonisering i vivo. Ved å bruke denne dyremodell, prosessen med EHEC kolonisering i mus kan overvåkes og kolonisering byrden på verten kan kvantifiseres for å fastslå romlige og tidsmessige kolonisering av EHEC i levende dyr. Visualisering og måling av enterobacteria kolonisering ved hjelp av denne modellen gjør det en stor verktøyet å undersøke og analysere de fine mekanismene for enterobacterial kolonisering og dermed kompensere for mangel på kolonisering forskning og forbedre dagens kunnskap.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Vi erkjenner Chi-Chung Chen fra Institutt for medisinsk forskning, Chi Mei Medical Center (Tainan, Taiwan) for hjelp i mus infeksjon og støtte fra laboratoriet dyr midten av National Cheng Kung University. Dette arbeidet er støttet av Minister for vitenskap og teknologi (mest) gir (mest 104-2321-B-006-019, 105-2321-B-006-011, and106-2321-B-006-005) til CC.

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
Påvisning av enterohemorrhagiske <em>Escherichia Coli</em> kolonisering i Murine vert av ikke-invasiv <em>i Vivo</em> bioluminescens System
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter