Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Обнаружение энтерогеморрагические Escherichia Coli колонизации в мышиных принимающей системой неинвазивные в Vivo биолюминесценции

doi: 10.3791/56169 Published: April 9, 2018

Summary

Представлен подробный протокол мыши модели для энтерогеморрагические E. coli (EHEC) колонизации с помощью биолюминесценции меченых бактерий. Обнаружение этих биолюминесцентных бактерий неинвазивные в vivo imaging системы в живых животных можно заранее нашего нынешнего понимания особенностей ЭГКП колонизации.

Abstract

Энтерогеморрагические E. coli (EHEC) O157: H7, который является пищевых патогенов, causesdiarrhea, геморрагический колит (СС), и гемолитический уремический синдром (ГУС), колонизации кишечного тракта человека. Чтобы изучить подробные механизм ЭГКП колонизации в естественных условиях, важно иметь животных моделей для мониторинга и количественной оценки ЭГКП колонизации. Мы демонстрируем здесь модель колонизации мыши-инфекции ЭГКП, превращая биолюминесцентных выражая плазмиды к инфекции ЭГКП для мониторинга и количественной оценки ЭГКП колонизации в жизни хозяев. Животные привиты с помечены биолюминесценция ЭГКП Показать интенсивной биолюминесцентных сигналов в мышей обнаружения с неинвазивные в vivo imaging системы. После того, как 1 и 2 дней после инфицирования, биолюминесцентных сигналы могут по-прежнему быть обнаружены в зараженных животных, который свидетельствует о том, что ЭГКП колонизировать в hosts для по крайней мере 2 дней. Мы также продемонстрировать, что эти биолюминесцентных ЭГКП locate для мыши кишечника, особенно в слепой кишки и толстой кишки, от ex vivo изображений. Эта модель колонизации мыши ЭГКП может служить в качестве инструмента для продвижения текущий набор знаний о механизме колонизации ЭГКП.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EHEC O157: H7 является возбудителя, который вызывает понос1, HS2, Гус3и4 даже острая почечная недостаточность через загрязненной воды или пищи. ЭГКП является патогенным enterobacterium и колонизирует желудочно-кишечного тракта человека1. Когда впервые ЭГКП придерживаться принимающей кишечного эпителия, они впрыскивают факторов колонизации в клетки хозяина через систему секреции типа III (T3SS), которая функционирует как молекулярные шприц вызывая присоединения и их стирания (A/E) поражения впоследствии для обеспечения адгезия (колонизация)5. Эти гены, участвующих в формировании A/E поражения кодируются Локус энтероцитах самоотречение (ли) патогенности остров5.

Биолюминесценции — свет производителей химическая реакция, в которой Люцифераза катализирует ее люциферин субстрат для создания видимый свет6. Это ферментативный процесс часто требует присутствия кислорода или аденозинтрифосфатом (АТФ)6. Биолюминесценции изображений (BLI) позволяет исследователям визуализации и квантование хост возбудитель взаимодействий в живых животных7. BLI могут характеризовать цикла бактериальной инфекции в живых животных, следуя биолюминесцентных бактерий, как они мигрируют к и вторгнуться в7различных тканей; Это показывает динамический прогрессирования инфекции. Кроме того бактериальной нагрузки в животных связана с биолюминесцентных сигнал8; Таким образом он является удобным показателем для оценки патологических условиях экспериментальных животных в простой и прямой путь.

Плазмиды, здесь содержится Оперон Люцифераза, luxCDABE, который от бактерии Photorhabdus luminescens , который кодирует его собственный Люцифераза субстрата7,9. Путем преобразования этого выражения Люцифераза плазмида в бактерии, колонизации и инфекции процессы может контролироваться путем наблюдать эти биолюминесцентных бактерий в живых животных. В целом BLI и биолюминесценции меченых бактерий позволяют исследователям для мониторинга бактериальных числа и местоположения, бактериальных жизнеспособности с антибиотиков терапии и выражение гена бактериальной инфекции/колонизации6, 7. поступили многочисленных патогенных бактерий, что Экспресс luxCDABE Оперон для изучения их выражение цикла и/или гена инфекции в инфекции. Эти бактерии, включая uropathogenic E. coli10, ЭГКП8,11,12,13, энтеропатогенные E. coli (EPEC)8, Citrobacter rodentium14,15, Salmonella typhimurium16, Listeria monocytogenes17, Yersinia enterocolitica18,19, и холерный вибрион20, документально подтверждены.

Некоторые экспериментальные модели были разработаны для содействия изучению колонизации ЭГКП in vitro и in vivo22,-21,23. Однако есть отсутствие подходящих животных моделей для изучения ЭГКП колонизации в естественных условияхи, таким образом, результирующая нехватка деталей. Чтобы облегчить изучение ЭГКП колонизации механизм в естественных условиях, он ценен для построения животных моделей для наблюдения и количественно ЭГКП колонизации в живых животных неинвазивным методом.

Эта рукопись описывает модель колонизации мыши-инфекции ЭГКП, которая использует систему биолюминесцентных выражая для мониторинга ЭГКП колонизации со временем в жизни хозяев. Мышей intragastrically привиты с помечены биолюминесценция ЭГКП и биолюминесцентных сигнала в мышах с неинвазивные в vivo imaging системы13. Мышей, инфицированных биолюминесценции меченых ЭГКП, показали значительные биолюминесцентных сигналов в их intestine после 2 дней после инфекции, которая предлагает что эти бактерии колонизировали в кишечнике хоста через 2 дня после заражения. Ex vivo данные изображения показали, что этот колонизации специально в слепой кишки и толстой кишки мышей. С помощью этой модели мыши-инфекции ЭГКП, биолюминесцентных колонизации ЭГКП могут быть обнаружены в узле жизни в естественных условиях imaging системы, чтобы изучить подробные механизмы колонизации кишечных бактерий, которые могут способствовать дальнейшему пониманию в ЭГКП индуцированной физиологические и патологические изменения.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Предупреждение: EHEC O157: H7 представляет собой биобезопасности уровня 2 (BSL-2) возбудителя по данным центров по контролю над заболеваниями и профилактике (CDC) Инструкция по биобезопасности (https://www.cdc.gov/). Таким образом должны выполняться все экспериментальные процедуры с участием ЭГКП в объекте BSL-2. Носите пальто лаборатории и перчатки при выполнении эксперимента. Работа в сертифицированных биобезопасности кабинета (BSC). Продезинфицируйте экспериментальный стенд до и после экспериментальной процедуры с 70% этиловом спирте. Все инструменты или оборудование, что контакт (или потенциально контакта) ЭГКП должен быть вылечен с 70% этанол или отбеливатель. Загрязненных (или потенциально загрязненной) отходов должны быть опечатаны и автоклавного тщательно. Носите маску, защита глаз, двойные перчатки или комбинезон, при необходимости. Самок мышей C57BL/6 6 week-old были приобретены и поддерживается на лабораторных животных центр национальных Ченг Кунг-университета (NCKU). Эксперименты на животных были утверждены институциональный уход животных и использование Комитета NCKU (номер 104-039 утверждения).

1. Bioluciferase меченых ЭГКП бактерий поколение

  1. Mix 50 нг дезоксирибонуклеиновой кислоты (ДНК), 1 мкл 10 мкм вперед и назад грунтовки, deoxynucleotides 2,5 мм 2 мкл (дНТФ), 2 мкл 10 x буфер, 0.2 мкл ДНК-полимеразы и стерильные двойной дистиллированной воды (ddH2O) окончательный объем 20 мкл усилить анти канамицин кассеты, nptII гена24. Шаблон ДНК-pBSL18024, которое закупается из национального проекта Биоресурс (NBRP). Условия PCR, перечислены в таблице 1 и последовательность праймера доступен в таблице 2.
  2. Перевязать продукты PCR коммерческие клонирования вектор после комплект протокола (см. Таблицу материалы).
  3. Акцизный фрагмента гена nptII от клонирования вектор НСИИ и ссии и клонировать в pBBR1MCS4, которая усваивается НСИИ и ScaI от9 pAKlux2 для создания устойчивых канамицин плазмида, pWF27813.
  4. Акцизный luxCDABE Оперон от Люцифераза, выражая плазмида9, pAKlux2, SpeI-HF и ScaI и клон SpeI-HF и ссии переваривается pWF278 для генерации канамицин устойчивостью и Люцифераза, выражая плазмида, pWF27913.
    Примечание: Для экстракции плазмиды и очищения подакцизным фрагмент, используйте извлечения коммерческих плазмиды и комплект извлечения геля, соответственно. Пищеварение энзима смешать 100 нг ДНК, 1 мкл 10 x буфер, 1 мкл каждого выбранного энзима ограничения, и стерильные ddH2O до общего объема 10 мкл и инкубировать при 37 ° C для 2,5-3 ч.
  5. Превратить плазмида pWF279 кишечной палочки O157: H7 EDL933 сведущие клетки путем электропорации с 2500 V для 4 мс.
  6. Инкубируйте преобразованные бактерий клеток в среде Бертани Лурия (LB) 1 мл при 37 ° C в течение 1 ч.
  7. Пластина бактерий на плите агар LB дополнена 50 мкг/мл при 37 ° C для 16-18 ч канамицин.
  8. Проверьте биолюминесцентных сигнал пластины, в естественных условиях imaging машины на следующий день. Выбрать один колонии от плиты и культура в 3 мл LB дополнена 50 канамицин мкг/мл при 37 ° C для 16-18 ч.
  9. Подготовить бактериальных акций средних путем разбавления 100% глицерина в стерильных ddH2O сделать 30% раствором глицерина.
  10. Заморозить канамицин устойчивые бактерии e.coli O157: H7 EDL933, укрывательство Люцифераза плазмида как бактериальный запас в cryovial колпачок в соотношении 1:1 бактерии культуры и 30% раствора глицерина-80 ° c. Конечная концентрация глицерина составляет 15%.

2. биолюминесцентных ЭГКП бактерий подготовка устных прививка

Примечание: Схема шкалы времени экспериментальных процедур для подготовки ЭГКП и пероральная затравка мыши представлен в Рисунок 1 помощь в подготовке экспериментальных.

  1. Бактерии e.coli O157: H7 EDL933 полоска укрывательство Люцифераза плазмида на агар плиту LB с 50 мкг/мл канамицин от-80 ° C складе. Рост бактерий для 16-18 ч при 37 ° C.
  2. Выберите один колонии от ночи пластины и культуры в 3 мл LB среде с 50 мкг/мл канамицин для 16-18 ч в инкубаторе 37 ° C на 220 об/мин.
  3. Субкультура бактерий (разбавления 1: 100) в канамицин (50 мкг/мл), содержащий LB отвара для 2,5-3 ч в инкубаторе 37 ° C на 200 об/мин. (Например, добавьте 2 мл на ночь культивированный бактерий до 200 мл LB среднего с канамицин (50 мкг/мл) дополнены).
  4. Инкубировать бактерий для 2,5-3 ч и измерения оптической плотности значение 600 Нм (600OD) до значения составляет от 0,9 до 1. В плотность около 108 колонии формируя единиц (CFU) являются бактериальных клеток / мл.
  5. Центрифуга для повторного культивировали бактерий на 8000 x г за 30 мин., 4 ° C.
  6. Отменить супернатант без агитацию Пелле бактерий и помыть лепешка с 100 мл 0,9% стерильный физиологический, нежный агитации.
  7. Повторите шаги 2.5 и 2.6 один раз.
  8. После стирки центрифуга бактериальной культуры на 8000 x г за 30 мин., 4 ° C и аккуратно удалить супернатант.
  9. Конденсат гранулы в 100-кратного с стерильный физиологический 0,9%. Например если 200 мл бактерии центрифугируется, добавьте 2 мл физиологическим приостановить гранулы.
  10. Подтвердите бактерии CFU (она должна быть около 10 кое/100 мкл9 после конденсации, в нормальное saline), покрытие концентрации бактерий через десятикратного последовательного растворения25.

3. мыши пероральная затравка инфекции ЭГКП

  1. Лечить 6 week-old самок мышей C57BL/6 с водой (5 г/Л) стрептомицина за 24 ч.
  2. После 24 часов переключитесь на регулярные питьевой воды для другой 24 часа до кормления. После лечения с очередной воды за 24 часа, мышей готовы пероральная затравка инфекции ЭГКП.
  3. Заполните шприц с 100 мкл Бактерии ЭГКП, потянув обратно на поршень. Убедитесь, что нет пузырьков воздуха в шприц. Удалите пузыри, щелкая шприц с пальцами.
  4. Аккуратно поднимите животного и поместите его на верхней части клетки с осторожностью.
  5. Взяв хвост мыши тщательно, и животное ручка в верхней части клетки и пытаться уйти.
  6. Нежно сдерживать мыши, держа дряблая кожа шеи и задней животное с большим и указательным пальцами, чтобы предотвратить перемещение головы мыши.
  7. Удерживайте кнопку мыши в вертикальном положении, чтобы вставить иглу кормления и гарантировать, что глава мыши иммобилизованных и вертикальные.
  8. Вставьте иглу затравки в после крыши рот рот мыши и двигаться вниз в пищевод и желудок.
  9. При вставленной иглы половину или две трети длины в мышь, придать 100 мкл ЭГКП бактерий, которые содержат приблизительно 109 CFU клетки.

4. Визуализация

  1. После пероральная затравка обнаружить биолюминесцентных сигналы на 1 и 2 дня.
  2. Перед изучением биолюминесцентных сигналы животных, анестезировать их, поместив их в камеру 2,5% изофлюрановая с кислородом 1,5 Л/мин.
  3. Ждать 2-5 мин, до тех пор, пока все мыши становятся бессознательное и остановить перемещение. Животные готовы в естественных условиях обнаружения биолюминесценции.
  4. Обнаружение и изображения биолюминесцентных сигналы животных в естественных условиях изображений системы. Пожалуйста, смотрите раздел 5 «Сбор данных» для эксплуатации программного обеспечения. В процессе обработки изображений все животные находятся под продолжение поставок 2,5% изофлюрановая с кислородом 1,5 Л/мин.
    1. Нажмите Файл > жить и вручную сосредоточиться на мыши.
    2. Выберите время и лазерной интенсивности воздействия.
    3. Нажмите кнопку приобрести > захват.
  5. Для ex vivo изображений, усыпить мышей, вывих шейного и удалить весь intestine зараженных мышей. Поместите кишечника в чашке Петри 9-cm и изображения, в естественных условиях imaging системы. Параметр является таким же, как в естественных условиях изображений за исключением поле зрения устанавливается как A/B. Для подробной информации смотрите раздел 5 «Сбор данных».
    Примечание: Метод для шейки матки дислокации: сдерживать мышей на верхней части клетки, держа хвост с одной стороны, так что животные сцепление клетке. Поместите маркер ручка или палец и первым пальцем другой руки против задней части шеи у основания черепа. Быстро вперед рукой или объект запрещая головы и тянуть назад с рукой, держа хвост.
    Проверьте внимательно, чтобы подтвердить дыхания и нет пульса.

5. сбор данных

Примечание: Программное обеспечение, используемое для получения данных указана в Таблице материалов.

  1. Для захвата изображений откройте панель управления приобретение программного обеспечения (рис. 2).
  2. Выберите «Светящийся», «фотография» и «Наложение».
  3. Задать время экспозиции как «Auto». Установите биннинга как «Среднее».
  4. Установите ƒ/стоп как 1 для люминесцентных и 8 для фотографий. Ƒ/стоп контроля количество света получено датчик CCD.
  5. Установите поле зрения на основе поля изображения, которые представляют интерес для приобретения. Опция «D» может поместиться пять 6 week-old мышей и изображения их все одновременно. «C» можно изображения три 6-week-old мышей в одном поле.
  6. Как только мышей/образцы готовы для обработки изображений, нажмите кнопку «Приобрести» для захвата изображений.
  7. Откройте данные изображения, который был приобретен.
  8. Откройте палитру инструментов панель (рис. 3).
  9. Выберите Инструменты ROI. Мы рекомендуем круг (один слева), чтобы диапазон биолюминесцентных области изображения (рис. 4).
  10. Нажмите кнопку «Мера ROI» (значок карандаша) для измерения поверхности биолюминесцентных интенсивности (рис. 3). Панель измерения ROI и количественная оценка значения появляются (рис. 5).
  11. Используйте настройки измерения в левом углу панели ROI измерения для выбора значения/необходимую информацию (Рисунок 6), в противном случае нажмите кнопку «Экспорт», чтобы экспортировать эту таблицу данных и сохранить как CSV-файл (Рисунок 5).
  12. Используйте значения столбца «Всего потока (p/s)» как количественная оценка биолюминесцентных интенсивности в CSV-файле.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Мы ведении помечены биолюминесценция ЭГКП (~ 109 бактериальной клетки) для 6 - неделю старых самок мышей C57BL/6 пероральная затравка. После устного прививка ЭГКП мышам в течение 1 ч животные были рассмотрены биолюминесцентных сигнала система электронного фотографирования в естественных условиях как показано на рисунке 7. Результаты показали сильный сигнал биолюминесцентных затравки мышей с помечены биолюминесценция ЭГКП. Мы изучили сигналы на 2 дня пост инфекции. Как показано на рис. 8А, мышах прививку с биолюминесценции меченых одичал тип инфекции ЭГКП EDL933 показали интенсивный биолюминесцентных сигналы даже после 2 дней после инфекции, который предложил ЭГКП колонизировали в хостов на 2 дня. Мы также intragastrically инфицированных биолюминесценции меченых EDL933ΔrfaD (ΔrfaD) для мышей (рис. 8A). Этот мутант, бежал в липополисахарида (LPS), было показано, уменьшить колонизации в узле в нашем предыдущем исследовании. Как показано на рис. 8А, существует биолюминесцентных сигнал не обнаружен в ΔrfaD-инфицированных мышей, которые предполагает, что есть нет или меньше бактерий клетки колонизировали в мышей. Количественная оценка флуоресцентного сигнала показано на Рисунок 8B. Далее было определено местоположение этих биолюминесценции меченых бактерий. Зараженных мышей были пожертвованы гуманно и удалены их весь intestine. Кишечник мышей 2 дней поста инфекции были размещены на 9 см Петри и образы ex vivo (рис. 9а). Кишечных тканях биолюминесценции меченых EDL933 инфицированных мышей показало значительное увеличение биолюминесцентных сигналов в слепой кишки и толстой кишки, которые позволяют предположить, что эти биолюминесцентных ЭГКП колонизировали в слепой кишки и толстой кишки зараженных мышей на 2 дней крайней мере. В отличие от мышей, инфицированных биолюминесценции меченых ΔrfaD (рис. 9а), показал сократилась биолюминесцентных сигнала в их кишечника ткани, которая согласуется с изображением в vivo (рис. 8А ). Количественная оценка флуоресцентного сигнала показано на Рисунок 9B.

Figure 1
Рисунок 1 : Временная шкала диаграммы потока экспериментальной подготовки.
Обзор о сроках, необходимых для подготовки биолюминесцентных Бактерии ЭГКП и предварительной обработки мышей с стрептомицина. (A) ЭГКП подготовка. (B) подготовка мышей. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : В естественных условиях изображений панели управления системы приобретения.
До обработки изображений образцов, откройте панель управления ИВИС приобретения. Выберите «Светящийся», «фотография» и «Наложение». Задать время экспозиции как «Auto». Установите биннинга как «Среднее». Установите ƒ/стоп как 1 для люминесцентных и 8 для фотографий. Ƒ/стоп контроля количество света получено датчик CCD. После того, как образцы готовы для обработки изображений, нажмите кнопку «Получить» для получения изображений. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 : Группа палитру.
После получения изображения используйте панель палитру для количественной оценки биолюминесцентных интенсивности. Открыть панель инструментов палитры и данных изображения. Выберите один из инструментов ROI в диапазоне биолюминесцентных сигналов на изображениях. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4 : Биолюминесцентных сигнал от образца для квантификации.
Площадь биолюминесцентных сигнала на изображениях, окруженных ROI инструменты. Все биолюминесцентных сигналы, показанный здесь находятся в красном круге. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5 : ROI измерения.
После круживший биолюминесцентных сигналов и нажав «Мера ROI» на панели инструментов палитры, значения представлены как показано. Для количественной оценки биолюминесцентных интенсивности используются значения столбца общего потока (p/s). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6 : Добавить различные количественной информации.
Нажав на настройки измерения на левом углу панели измерения ROI, вы можете выбрать другой желаемый количественной оценки значения/информации. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 7
Рисунок 7 : Представитель изображение мышей после прививки с биолюминесцентных ЭГКП.
Представитель изображение мышей прививанным с биолюминесцентных ЭГКП пероральная затравка в течение 1 ч. Цветовая шкала представляет сияние (/sr p/s/см2). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 8
Рисунок 8 : Изображения мышей прививанным с помечены биолюминесценция ЭГКП после 2 дней.
(A) представляют изображение мышей прививанным с биолюминесцентных одичал типа инфекции ЭГКП EDL933 и EDL933:ΔrfaD пероральная затравка после 2 дней после инфицирования. (B) количественная оценка интенсивности биолюминесценции мышей, инфицированных ЭГКП. Планки погрешностей указывают стандартных отклонений. Представитель изображения отображаются. Все эксперименты проводились независимо друг от друга три раза с 2-3 животных каждый раз, и погрешностей указывают стандартных отклонений. P-значения обозначают результаты статистического анализа, t теста. Цветовая шкала представляет сияние (/sr p/s/см2). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 9
Рисунок 9 : Изображения кишечных тканях инфицированных мышей с помечены биолюминесценция ЭГКП.
(A) через 2 дня после прививки с помечены биолюминесценция ЭГКП, мышей были умерщвлены и целом кишечных тканей были удалены и образы ex vivo. Представитель изображения отображаются. (B) количественная оценка интенсивности биолюминесценции кишечных тканей от мышей, инфицированных ЭГКП. Все эксперименты проводились независимо друг от друга три раза с 2-3 животных каждый раз, и погрешностей указывают стандартных отклонений. P-значения обозначают результаты статистического анализа, t теста. Цветовая шкала представляет сияние (/sr p/s/см2). Представляет линейку шкалы 1 cm. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Шаги Температура Время Количество циклов
Первоначальный денатурации 95 ° C 10 мин 1
Денатурация 95 ° C 30 сек 35
Отжиг 58,4 ° C 30 сек
Расширение 72 ° C 1.5 мин
Окончательное расширение 72 ° C 10 мин 1
Удерживайте 4 ° C 1

Таблица 1: Полимеразная цепная реакция (ПЦР) условия

Имя праймеры Последовательность
nptII F 5' CCTATGCATAATAATTCCGCTAGCTTCACG3'
nptII R 5' GCTCCACCGATAATATTCCTGAGTCATACT3'

Таблица 2: грунтовка последовательности используются для усиления nptII

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Сообщается, что ЭГКП преобразована с Люцифераза плазмида была использована для изучения его локализации в hosts или выражение гена в vivo8,,1112. Для обнаружения инфекции ЭГКП колонизировали сроков и локализации в мышиных хост8поступили также мышиных модели продемонстрировали здесь. Тем не менее мы предоставляем детали протокола как управлять ЭГКП прививка для мышей intragastrically и как подготовить тщательно биолюминесцентных бактерий пероральная затравка. Примечательно для мыши пероральная затравка ЭГКП (шаг 3.7), должность начальника мыши имеет решающее значение, когда игла затравки. Если позиция не является вертикальной, будет трудно пройти иглы, и возможно он может травмировать мыши. В шаге 3.8 когда игла затравки находится внутри рта мыши, язык будет лежать вне рта слегка. Если сопротивление при прохождении иглы кормления пищевода, остановить движение иглы вперед и снять его немедленно. Измените положение иглы, чтобы убедиться, что игла вводит esophagus. Игла может входить трахеи при возникновении сопротивления, которое приведет к инъекций бактерий в легких вместо желудка.

Применение зеленого флуоресцентного белка (ГПУП) как биодатчик является общим в биологических экспериментах. Однако с использованием GFP как репортер соблюдать возбудителя инфекции/колонизации в живых животных в естественных условиях изображений не рекомендуется, потому что между 200-650 Нм26, которая перекрывается с высоки поглощения гемоглобина, белки и воды GFP (возбуждения 480 Нм, выбросов 510 нм)27. Таким образом с использованием GFP сигнал как репортер в vivo изображений могут быть прерваны гемоглобина, белки и вода в животных26. Флуоресценции ближней ИК-области спектра (NIR) идеально подходит для в vivo изображений, потому что его поглощения окна составляет около 650-900 нм28, который находится в регионе низкий коэффициент поглощения гемоглобина (< 650 Нм) и воды (> 900 нм)26 ,28 . Кроме того когда ткань поглощает свет, есть шанс, чтобы побудить аутофлюоресценция. Когда в окне GFP диапазон длин волн возбуждения и выбросов, он вызывает гораздо больше аутофлюоресценция чем NIR29. Использование NIR может улучшить соотношение фон, по сравнению с GFP, устраняя аутофлюоресценция фон29сигнал. Биолюминесценции не требует энергии возбуждения для создания видимый свет. Это зависит от реакции катализируют люциферин подложке путем ее фермент Люцифераза и генерировать свет. Так как биолюминесценции не требуется свет непосредственно на образец, фонового сигнала от образца является очень низким. Таким образом использование биолюминесценции как репортер более общий и проще для изображений в естественных условиях . В противоположность этому флуоресценции требует света возбуждения побудить светового сигнала. Когда ткани поглощать свет, есть шанс, что дневной свет будет выделяться и побудить аутофлюоресценция, так что их сигнал шум выше по сравнению с биолюминесценции.

Учитывая ЭГКП, естественно, меньше колонизирована мышей устные инфекции2,22, естественный слизистой оболочки возбудителя мышей, называется Citrobacter rodentium, использовались для изучить механизм колонизации мышиных хост как суррогатной бактерия22,30. Обе инфекции ЭГКП и C. rodentium колонизации слизистой оболочке кишечника и вызвать образование A/E поражений в принимающей22,30. Они также содержат ли остров патогенности, который кодирует T3SS и несколько эффекторные белки, которые индуцированные поражения A/E22,30. Таким образом использование Люцифераза, выражая плазмида как репортер в C. rodentium для обнаружения патологии колонизации и изучить механизм колонизации через систему визуализации в естественных условиях также было сообщено14, 15. Тем не менее, в то время как C. rodentium заражение мышей является полезной моделью для изучения функции T3SS и механизму поражения A/E, C. rodentium не содержат Сига токсин (Stx)30, который является доминирующим фактор вирулентности, который вызывает почечной недостаточности в ЭГКП, особенно серотип O157: H73. Хотя штамм Stx выражая C. rodentium был построен недавно31, который является более реалистичным инфекции ЭГКП, она не включает другие потенциальные факторы вирулентности инфекции ЭГКП, которые имеют решающее значение для колонизации и/или инфекции. Кроме того C. rodentium разделяет 67% своих генов с EHEC32, которая предполагает, что EHEC может использовать вирулентности, отличается от C. rodentium во время колонизации и/или инфекции.

Люцифераза, выражая плазмида, используемый здесь, pWF27913, был изменен с pAKlux29 которого позвоночника является pBBR1MCS433. Хотя pBBR1MCS4 были протестированы и воспроизведены в различных бактерий33, важно обеспечить происхождение репликации (ОРИ) Эта плазмида подходит для бактериальных узла перед использованием этой системы на основе плазмида Люцифераза для эксперимента и подтвердив, что это Люцифераза, выражая плазмида можно реплицировать в узле бактериальных. Мы используем антибиотик стресс для поддержания стабильности плазмида в бактериях. Когда бактерии попадают животных в отсутствие антибиотиков, биолюминесцентных сигнал одичал тип инфекции ЭГКП был обнаружен в течение 2 дней. Однако, мы не после инфекции для более чем 2 дней, потому что мы уже видели существенная разница в интенсивности светящиеся ЭГКП WT и ЭГКП rfaD (который кодирует ген для инфекции ЭГКП, синтезирующий нетронутыми LPS) черепашки на 2 дня. Для поддержания плазмида стабильно в бактерий при отсутствии антибиотиков, плазмида pCM1710,34 может использоваться для этой цели. pCM17 кодирует системы перегородки двух плазмиды и post-segregational убийство механизм для обеспечить поддержание плазмида бактерий в отсутствие антибиотиков10,34. Плазмида pCM17, содержащий luxCDABE Оперон, движимый промоутер OmpC могут быть обнаружены биолюминесцентных сигналом для по крайней мере 7 дней8. Альтернативный метод для получения непрерывной биолюминесцентных выражение бактерий в отсутствие антибиотиков является вставка гена luxABCDE в бактериальной хромосоме35. Фрэнсис et al. используется transposon вставлены случайно вставлены в хромосоме пневмококк получить стабильный штамм биолюминесценции35кассеты Оперон и антибиотиков luxABCDE .

В наших предыдущих исследований13мы использовали эту модель системы для изучения ЭГКП колонизации в узле и сравнить разница колонизации способности инфекции ЭГКП дикого типа (WT) и мутант13. Когда мышь вводили биолюминесцентных ЭГКП rfaD мутант, биолюминесцентных сигналов, резко сократилось по сравнению с что WT инфекции ЭГКП после 2 дней после инфицирования. Он предоставляет доказательства того, что эта мышиных модель можно проанализировать эффект мутаций ЭГКП колонизации в узле. Кроме того терапевтическое лечение для уменьшения колонизации ЭГКП является считается, потенциальные решения инфекции ЭГКП, поскольку использование антибиотиков является противопоказано5,36. Таким образом стоит тестирование ли эта модель система может использоваться для изучения эффективности против колонизации наркотиков/лечения против колонизации энтеробактерий в узле. Мы считаем, что с помощью этой модели системы, это возможно для изучения сроков и местоположение не просто ЭГКП, но и других энтеробактерий колонизации в естественных условиях. С помощью этой модели на животных, процесс колонизации ЭГКП в мышей может контролироваться и колонизации бремя в узле может быть определена количественно определить пространственных и временных колонизации ЭГКП в живых животных. Визуализация и количественной оценки энтеробактерий колонизации с помощью этой модели делает его отличным инструментом для расследования и анализа тонкой механизмы энтеробактерий колонизации и таким образом компенсировать дефицит исследований колонизации и улучшение имеющихся знаний.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Мы признаем Чи-Чун Чен из департамента медицинских исследований, Chi Mei медицинский центр (Тайнань, Тайвань) за помощь в мыши, инфекции, а также поддержку от лабораторных животных центра национального университета Cheng Kung. Эта работа поддерживается министра науки и технологии (большинство) предоставляет CC (наиболее 104-2321-B-006-019, 105-2321-B-006--011,-005 and106-2321-B-006).

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
Обнаружение энтерогеморрагические <em>Escherichia Coli</em> колонизации в мышиных принимающей системой неинвазивные <em>в Vivo</em> биолюминесценции
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter