Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

गोल्डन सीरियाई हंसटर संक्रमण के दौरान Leptospira interrogans Transposon प्रविष्टि म्यूटेंट की फिटनेस को मापने के लिए उच्च प्रवाह समानांतर अनुक्रमण

doi: 10.3791/56442 Published: December 18, 2017

Summary

हम यहां एक तकनीक का वर्णन है कि उच्च प्रवाह अनुक्रमण के साथ transposon mutagenesis को जोड़ती है की पहचान और हंसटर की एक चुनौती के बाद ऊतकों में transposon leptospiral म्यूटेंट यों यों । इस प्रोटोकॉल के लिए जानवरों में अस्तित्व और प्रसार के लिए म्यूटेंट स्क्रीन इस्तेमाल किया जा सकता है और भी इन विट्रो अध्ययन करने के लिए लागू किया जा सकता है ।

Abstract

इस पांडुलिपि में, हम एक transposon अनुक्रमण (तमिलनाडु-Seq) तकनीक का वर्णन करने की पहचान करने और Leptospira interrogans म्यूटेंट के लिए है स्वर्ण सीरियाई हंसटर के संक्रमण के दौरान फिटनेस में बदल । तमिलनाडु-Seq उच्च प्रवाह अनुक्रमण प्रौद्योगिकी की शक्ति के साथ यादृच्छिक transposon mutagenesis को जोड़ती है । पशु transposon म्यूटेंट (इनपुट पूल) के एक पूल के साथ चुनौती दी है, रक्त और ऊतकों की कटाई के बाद कुछ दिनों के बाद की पहचान करने के लिए और प्रत्येक अंग (आउटपुट पूल) में म्यूटेंट की संख्या मात्रा । आउटपुट पूल इनपुट पूल की तुलना में प्रत्येक उत्परिवर्ती के vivo में फिटनेस का मूल्यांकन कर रहे हैं । यह दृष्टिकोण पशुओं की एक सीमित संख्या में म्यूटेंट के एक बड़े पूल की स्क्रीनिंग में सक्षम बनाता है । मामूली संशोधनों के साथ, इस प्रोटोकॉल ऐसे हंसटर के रूप में चूहों और तीव्र संक्रमण मॉडल के रूप में लेप्टोस्पायरोसिस, जलाशय मेजबान मॉडल के किसी भी जानवर मॉडल के साथ किया जा सकता है, साथ ही साथ इन विट्रो अध्ययन में । तमिलनाडु-Seq vivo में और इन विट्रो फिटनेस दोषों के साथ म्यूटेंट के लिए स्क्रीन करने के लिए एक शक्तिशाली उपकरण प्रदान करता है ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

कुछ बैक्टीरिया, जैसे कि Leptospira एसपीपी., के लिए डाह जीन की पहचान के लिए उपलब्ध आनुवंशिक उपकरणों की सीमित संख्या की वजह से मुश्किल है । एक सामांय रूप से इस्तेमाल किया दृष्टिकोण यादृच्छिक transposon mutagenesis द्वारा प्रत्येक उत्परिवर्ती और एक पशु मॉडल में व्यक्तिगत transposon म्यूटेंट के डाह परीक्षण में सम्मिलन साइट की पहचान के बाद द्वारा म्यूटेंट का एक संग्रह का निर्माण होता है । इस दृष्टिकोण समय लेने वाली है, महंगा है, और पशुओं की एक बड़ी संख्या की आवश्यकता है ।

जब यादृच्छिक mutagenesis पहले रोगज़नक़ Leptospira interrogansके लिए विकसित किया गया था, डाह में शामिल जीन एक जानवर मॉडल में व्यक्तिगत म्यूटेंट परीक्षण द्वारा पहचाने गए थे1. म्यूटेंट मानदंडों के आधार पर इस तरह के संकेत या गतिशीलता में उनके संभावित भूमिकाओं या उनकी भविष्यवाणी की बाहरी झिल्ली या सतह स्थान के रूप में चयन किया गया । leptospiral जीन के बहुमत के रूप में 2अज्ञात समारोह के काल्पनिक प्रोटीन सांकेतिक शब्दों में बदलना, इन मानदंडों के आधार पर म्यूटेंट का चयन उपंयास leptospiral डाह जीन की खोज करने की क्षमता सीमा ।

हाल ही में, एल interrogans transposon म्यूटेंट के पूल हंसटर और माउस मॉडल3में infectivity के लिए जांच की गई । प्रत्येक जानवर को 10 म्यूटेंट के एक पूल के साथ चुनौती दी थी । एक उत्परिवर्ती के Infectivity के रूप में सकारात्मक अगर यह रक्त और गुर्दे से प्राप्त संस्कृतियों की पीसीआर द्वारा पता चला था बनाए गए थे । पीसीआर परीक्षण श्रमसाध्य क्योंकि यह पूल में प्रत्येक उत्परिवर्ती के लिए एक व्यक्ति पीसीआर प्रतिक्रिया की आवश्यकता थी । क्योंकि संस्कृतियों में प्रत्येक उत्परिवर्ती की आवृत्ति मात्रा नहीं था, दृष्टिकोण अत्यधिक तनु म्यूटेंट की पहचान की दिशा में पक्षपातपूर्ण था ।

हम डाह जीन के लिए और अधिक कुशलता से स्क्रीन करने के लिए एक रणनीति के रूप में एक transposon अनुक्रमण (तमिलनाडु-Seq) तकनीक का वर्णन । तमिलनाडु-seq transposon mutagenesis द्वारा म्यूटेंट के एक पुस्तकालय के निर्माण के बड़े पैमाने पर समानांतर अनुक्रमण4,5,6के बाद के होते हैं । संक्षेप में, transposon म्यूटेंट, पशुओं में inoculated, और बाद में विभिन्न अंगों (आउटपुट पूल) से बरामद कर रहे हैं । आउटपुट पूल से डीएनए निकाला और प्रतिबंध एंजाइमों के साथ पचा या sonication द्वारा कतरनी है । transposon बिंद स्थलों के जंक्शनों को टारगेट कर रहे पीसीआर के दो राउंड प्रदर्शन किए हैं । यह चरण sequencing के लिए आवश्यक एडेप्टर के अतिरिक्त सक्षम करता है । परिणामस्वरूप पीसीआर उत्पादों उच्च प्रवाह अनुक्रमण द्वारा विश्लेषण कर रहे है उनके रिश्तेदार बहुतायत है, जो उत्परिवर्ती के पूल की प्रारंभिक संरचना की तुलना में है के साथ साथ पूल के प्रत्येक उत्परिवर्ती के transposon प्रविष्टि साइट की पहचान ।

इस दृष्टिकोण का प्राथमिक लाभ के लिए एक साथ जानवरों की एक छोटी संख्या के साथ म्यूटेंट की एक बड़ी संख्या स्क्रीन करने की क्षमता है । तमिलनाडु-Seq transposon सम्मिलन साइटों जो नए Leptospira-विशिष्ट जीन कम समय और अधिक से अधिक दक्षता के साथ डाह में शामिल की खोज की संभावना बढ़ जाती है की पूर्व ज्ञान की आवश्यकता नहीं है । क्योंकि ऊतकों में leptospiral बोझ मूषक के घातक संक्रमण के लिए अतिसंवेदनशील मॉडलों में अपेक्षाकृत अधिक है (आमतौर पर 104 से 108 बैक्टीरिया/8,9 के साथ ही जलाशय मेजबानों में 10,11, ऊतकों सीधे संस्कृति की आवश्यकता के बिना विश्लेषण किया जा सकता है, इन विट्रो विकास के कारण पूर्वाग्रहों को कम करने ।

तमिलनाडु में सबसे बैक्टीरियल रोगज़नक़ों तिथि करने के लिए वर्णित के साथ Seq अध्ययन, सम्मिलनी mutagenesis की उच्च आवृत्ति म्यूटेंट युक्त बड़े पूल के साथ संक्रमण की अनुमति दी सामूहिक रूप से कई बारीकी से होने वाली अंतरिक्ष transposon हर जीन 4 के भीतर सम्मिलन ,12,13,14. तमिलनाडु-Seq भी एक जीवाणु है जिसके लिए mutagenesis आवृत्ति बहुत कम है के लिए विकसित किया गया है6Leptospiraके साथ, transposon म्यूटेंट के एक पुस्तकालय प्लाज्मिड द्वारा विकार एट अल15द्वारा वर्णित के रूप में एक समाजीय Slamti पर transposon शुरू करने से उत्पंन किया जा सकता है । हालांकि, एल interrogans के transposon mutagenesis की फ्रीक्वेंसी कम है । जब Himar1 transposon एक conjugative प्लाज्मिड पर पेश किया गया था, transconjugant आवृत्ति एल interrogans16 के लाइ तनाव के साथ केवल ८.५ x 10-8 प्रति प्राप्तकर्ता सेल होने की सूचना दी थी और होने की संभावना है इसी प्रकार एल interrogansके अधिकांश अंय उपभेदों के साथ गरीब । यहां वर्णित प्रोटोकॉल अरै burgdorferiके लिए विकसित किया गया है, जिसमें transposon बिंद mutagenesis की आवृत्ति भी कम6है के आधार पर भाग में है ।

हमारे प्रोटोकॉल के साथ पायलट प्रयोग के लिए17, हम एल interrogans serovar के साथ transposon mutagenesis का आयोजन किया है, क्योंकि अंय समूहों की सफलता के साथ तनाव में L495 सम्मिलन transposon अलग करने में अपने कम LD५० (घातक खुराक) डाह1के लिए । हम तमिलनाडु-Seq द्वारा ४२ म्यूटेंट की जांच की और कई उत्परिवर्ती डाह में दोषपूर्ण उंमीदवारों की पहचान की, एक उंमीदवार adenylate cyclase जीन में सम्मिलन के साथ दो सहित । हंसटर में दो म्यूटेंट के व्यक्तिगत परीक्षण की पुष्टि की है कि वे डाह17में कमी थी ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

चेतावनी: Leptospira एसपीपी के रोगजनक उपभेदों. 2 (बीएसएल-2) रोकथाम प्रक्रियाओं के तहत सुरक्षा स्तर नियंत्रित किया जाना चाहिए । उपयुक्त व्यक्तिगत सुरक्षा उपकरण (पीपीई) पहना जाना चाहिए । एक वर्ग द्वितीय सुरक्षा कैबिनेट रोगजनक Leptospira एसपीपी के सभी जोड़तोड़ के लिए इस्तेमाल किया जाना चाहिए ।

1. Transposon उत्परिवर्ती पुस्तकालय का निर्माण15

  1. transposon के Leptospira एसपीपी में स्थानांतरण. विकार द्वारा (चित्रा 1)
    1. लगाना रोगजनक Leptospira एसपीपी के घातीय चरण संस्कृति की एक मात्रा में 107 कोशिकाओं Ellinghausen-audio-जॉनसन-हैरिस मीडियम (EMJH)18,19के 10 मिलीलीटर में करने के लिए इसी । १५० rpm के साथ 30 ° c में मशीन मिलाते हुए जब तक घनत्व तक पहुंच 2-8 x10 8 कोशिकाओं/
      नोट: रोगजनक leptospires के दोहरीकरण समय 12 से 24 ज, तनाव पर निर्भर करता है ।
    2. लगाना ५० µ एल के दाता ई कोलाई तनाव β २१६३20 ले जा जुटाने की transposon प्लाज्मिड (pCjTKS2) में16 Luria शोरबा (पौंड) के ०.३ मिमी के साथ पूरक के 2, 6-diaminopimelicacid (डीएपी) के 5 मिलीलीटर, ५० µ g/ कनमीसिन (Km), और ५० µ g/spectinomycin के एमएल (Spc) और एक ३७ डिग्री सेल्सियस में रातोंरात जगह २५५ rpm पर मशीन ।
    3. लगाना ६० µ एल के ई. कोलाई कोशिकाओं के 3 मिलीलीटर में EMJH ०.३ मिमी डीएपी (EMJH + डीएपी) के साथ पूरक । 3-4 के लिए २५५ rpm आंदोलन में ३७ डिग्री सेल्सियस पर मशीन एक आयुध डिपो केलिए600nm ≈ ०.३ ।
    4. निस्पंदन इकाई (चित्रा 1) को इकट्ठा करने के लिए, आधार पर एक १२५ मिलीलीटर ओर हाथ Erlenmeyer कुप्पी, स्थान एक एसीटेट-फाइबर फिल्टर (ताकना आकार ०.१ मिमी, व्यास 25 मिमी) पर बेस है, और आधार पर कीप दबाना । एक वैक्यूम प्रणाली के लिए निस्पंदन इकाई से कनेक्ट करें ।
    5. Leptospira एसपीपीके 5 मिलीलीटर जोड़ें । संस्कृति और कीप में ई. कोलाई संस्कृति के ०.५ मिलीलीटर । फिल्टर के माध्यम से तरल निर्वात ।
    6. एक EMJH + DAPplate पर ऊपर का सामना करना पड़ बैक्टीरिया की सतह के साथ फिल्टर स्थानांतरण । ऊपर का सामना करना पड़ फिल्टर के साथ रात भर 30 ° c में मशीन ।
    7. एक 15 मिलीलीटर EMJH और 10 एस के लिए भंवर के 1 मिलीलीटर युक्त ट्यूब में फिल्टर प्लेस मीडिया में बैक्टीरिया जारी । प्रसार २०० µ पर निलंबन की l 5 EMJH platescontaining ५० µ g/एमएल का उपयोग कर किमी 10-15 1 मिमी बाँझ कांच मोती या एक बाँझ प्रयोज्य प्रसारक. parafilm के साथ प्लेटें लपेटें और उंहें 30 डिग्री सेल्सियस पर उल्टा नीचे 3 से 4 हफ्तों के लिए जब तक कालोनियों दिखाई दे रहे हैं ।
    8. EMJH के ५० µ जी/एमएल के 30 डिग्री सेल्सियस (EMJH + किमी) के अंतर्गत १५० rpm आंदोलन के लिए 7 से 10 दिनों तक संस्कृति को ≈ 108/mL. के घनत्व तक पहुंचता है जिसमें 3 मिलीलीटर में व्यक्तिगत रूप से कॉलोनियों का स्थानांतरण
      नोट: संस्कृतियों-८० ° c या तरल नाइट्रोजन (4% ग्लिसरॉल के साथ) में संग्रहित किया जा सकता है ।
  2. नेस्टेड पीसीआर द्वारा transposon बिंद स्थल की पहचान (चित्रा 2)
    1. लाइसे ५० µ 15 मिनट के लिए ९५ डिग्री सेल्सियस पर मशीन द्वारा पीसीआर ट्यूबों में प्रत्येक transposon उत्परिवर्ती के एल ।
      नोट: डीएनए के बजाय शुद्ध किया जा सकता है, एक डीएनए निष्कर्षण किट का उपयोग कर ।
    2. तालिका 1के अनुसार Deg1 और Tnk1 प्राइमरी (टेबल 3) के साथ पीसीआर मिक्स तैयार करें । प्रत्येक पीसीआर ट्यूब के लिए मिश्रण के २३.७ µ एल स्थानांतरण और लीजड कोशिकाओं के १.३ µ एल जोड़ें । कार्यक्रम भागो: 5 मिनट के लिए 95 ° c; ४० चक्र: ९५ डिग्री सेल्सियस के लिए 15 एस, ४० ° c 1 मिनट के लिए, ७२ ° c 2 मिनट के लिए; 10 मिनट के लिए ७२ ° c ।
    3. तालिका 2के अनुसार टैग और TnkN1 प्राइमरों (तालिका 3) के साथ पीसीआर मिक्स करें । प्रत्येक पीसीआर ट्यूब के लिए मिश्रण के २४.२ µ एल स्थानांतरण और पीसीआर #1 प्रतिक्रिया के ०.८ µ एल जोड़ें । प्रोग्राम चलाएं: 5 मिनट के लिए ९५ ° c; ३५ चक्र: ९५ ° c के लिए 15 एस, ५५ ° c के लिए 30 s, ७२ ° c for 2 min; 10 मिनट के लिए ७२ ° c ।
    4. 1% agarose जेल पर पीसीआर प्रोडक्ट्स की 3 µ एल रन 1x Tris-एसीटेट-EDTA (ताे) बफर के साथ 10-15 वी/सेमी पर (चित्रा 2 बी) ।
    5. पीसीआर शुद्धिकरण किट का उपयोग करते हुए सकारात्मक नमूनों के पीसीआर उत्पादों को शुद्ध करना । कम से डीएनए की एकाग्रता को अधिकतम करने के लिए किट द्वारा अनुमति दी मात्रा के साथ Elute डीएनए बरामद किया ।
    6. TnkN1 प्राइमर (तालिका 3) का उपयोग कर सैंज अनुक्रमण के लिए शुद्ध पीसीआर उत्पादों भेजें ।
    7. BLASTN विश्लेषण (http://blast.ncbi.nlm.nih.gov/) द्वारा पैतृक तनाव जीनोम अनुक्रम के साथ परिणामी अनुक्रम की तुलना करके सम्मिलन साइटों की पहचान करें या SpiroScope डेटाबेस (http://www.genoscope.cns.fr/agc/mage)21का उपयोग कर ।
    8. पीसीआर द्वारा transposon के सम्मिलन साइट की पुष्टि करें अस्तर मेजबान दृश्यों के लिए प्राइमरों एनीलिंग का उपयोग कर ।
      नोट: transposon ≈ 2 kb द्वारा वाइल्ड-टाइप अनुक्रम का आकार बढ़ाता है ।

2. पशु प्रयोग (चित्रा 3)

  1. Leptospira म्यूटेंट की संस्कृति
    1. व्यक्तिगत रूप से प्रत्येक चयनित transposon उत्परिवर्ती EMJH के 10 मिलीलीटर + 30 डिग्री सेल्सियस पर १५० rpm आंदोलन में 107-108 leptospires/एमएल के घनत्व को बढ़ाएं ।
    2. एक Petroff-Hausser काउंटर या के रूप में23मिलर द्वारा वर्णित के साथ काले क्षेत्र माइक्रोस्कोपी द्वारा leptospires गिनती ।
    3. EMJH में एक ही घनत्व के लिए प्रत्येक संस्कृति को पतला, उदाहरण के लिए 106 कोशिकाओं/
    4. इनपुट पूल को इकट्ठा करने के लिए, बराबर मात्रा में पतला संस्कृतियों को एक साथ मिलाएं ।
      नोट: loa2217,24 और अनछुए फिटनेस जैसे ligB17,25के साथ म्यूटेंट जैसे ज्ञात फिटनेस दोषों के साथ म्यूटेंट जोड़कर इनपुट पूल में नियंत्रणों को शामिल करें, क्रमश. म्यूटेंट के पूल-८० डिग्री सेल्सियस या तरल नाइट्रोजन में 4% ग्लिसरॉल के साथ संग्रहित किया जा सकता है ।
  2. चुनौती
    नोट: यहां वर्णित तरीकों दिग्गजों मामलों ग्रेटर लॉस एंजिल्स संस्थागत पशु देखभाल और उपयोग समिति (प्रोटोकॉल #09018-14) द्वारा अनुमोदित किया गया ।
    1. intraperitoneally एक इंसुलिन सिरिंज 26G एक्स ½ "सुई के साथ U-१०० के साथ प्रत्येक जानवर के लिए इनपुट पूल के 1 मिलीलीटर सुई.
      नोट: पायलट प्रयोग में 8 जानवरों को इनपुट पूल के 1 एमएल, यानी 106 बैक्टीरिया कुल17के साथ चुनौती दी गई । इच्छामृत्यु के लिए 4 दिन पहले संक्रमण को आगे बढ़ने की इजाजत दी गई थी ।
    2. इनपुट पूल के 10 मिलीलीटर ले लीजिए, और ३,२२० x जी में 20 मिनट के लिए स्पिन ध्यान से गोली परेशान बिना supernatant निकालें । दुकान पर सेल गोली-80 ˚ सी उपयोग जब तक (कदम 3.1.3) ।
    3. जानवरों की निगरानी दैनिक जब तक वे पूर्व निर्धारित समापन बिंदु पर समाप्त कर रहे हैं । हंसटर दैनिक वजन और समापन बिंदु मानदंड के लिए देखो: भूख की हानि, चाल या सांस लेने में कठिनाई, रुक्न, व्याकुल फर, या की हानि > 10% अधिकतम वजन की प्राप्त की ।
  3. इन विट्रो प्रयोग
    1. चुनौती के दिन, लगाना 3 EMJH के 25 मिलीलीटर की कुप्पी + Km इनपुट पूल के 5 मिलीलीटर के साथ । १५० rpm आंदोलन के तहत 30 डिग्री सेल्सियस पर संस्कृतियों हो जाना ।
    2. खंड 2.1.2 की विधियों में से किसी एक का उपयोग कर leptospires दैनिक गणना । जब घनत्व ≈ 1 x 108/mL तक पहुंच जाता है, ३,२२० x g पर 20 मिनट के लिए प्रत्येक निलंबन नीचे स्पिन
    3. सेल छर्रों पर-८० ° c उपयोग तक स्टोर ।
  4. फसल और ऊतकों का भंडारण
    1. Euthanize isoflurane द्वारा जानवरों की साँस लेना द्विपक्षीय thoracotomy द्वारा पीछा किया26.
    2. तुरंत एक 3 मिलीलीटर सिरिंज और एक 25G एक्स 5/8 सुई के साथ कार्डियक पंचर द्वारा रक्त की 1 से 2 मिलीलीटर इकट्ठा । EDTA युक्त ट्यूब में रक्त हस्तांतरण । उलटा करके मिश्रण, 5 से 6 बार ।
    3. एक गुर्दे ले लीजिए और cryotubes में जिगर की ventral औसत पालि के ½ के लिए ⅓ ।
    4. -८० ° c उपयोग तक के ऊतकों को स्टोर करें ।

3. उच्च प्रवाह अनुक्रमण के लिए जीनोमिक पुस्तकालयों का निर्माण (चित्रा 4)

  1. डीएनए निष्कर्षण
    1. खून से डीएनए निष्कर्षण ।
      1. EDTA ट्यूब से रक्त के १०० µ एल स्थानांतरण एक microcentrifuge ट्यूब करने के लिए ।
      2. डीएनए एक डीएनए निष्कर्षण किट का उपयोग कर शुद्ध । निर्माता के निर्देशों का पालन करें ।
    2. ऊतकों से डीएनए निष्कर्षण ।
      1. नश्तर और कैंची का प्रयोग, ५० के बीच पासा छोटे टुकड़ों में प्रत्येक अंग के ८० मिलीग्राम (1 मिमी x 1 मिमी), और एक बाँझ पेंच टोपी सूखी ट्यूब में उन्हें हस्तांतरण. एक सटीक संतुलन के साथ ऊतक के वजन को मापने ।
      2. ट्यूब में बाँझ पंजाबियों के ५०० µ एल जोड़ें ।
      3. प्रति सेकंड 5 आंदोलनों में 1 मिनट के लिए विघटनकारी का उपयोग करके नमूने Homogenize ।
      4. ऊतक के 25 मिलीग्राम निंनलिखित समीकरण का उपयोग करने के लिए इसी मात्रा की गणना:
        Equation 1
      5. डीएनए निष्कर्षण किट में गणना की मात्रा स्थानांतरण । निर्माता के निर्देशों का पालन डीएनए शुद्धि के साथ आगे बढ़ें ।
    3. इनपुट पूल से डीएनए निष्कर्षण और इन विट्रो संस्कृतियों में
      1. 5-10 मिनट के लिए कमरे के तापमान पर गल बैक्टीरियल छर्रों ।
      2. किट के साथ निर्देशों के बाद डीएनए निष्कर्षण के साथ आगे बढ़ें ।
    4. डीएनए पर-८० ° c उपयोग तक स्टोर ।
  2. बाल काटना डीएनए (चित्रा 5)
    1. एक १.५ मिलीलीटर microcentrifuge ट्यूब पर निकाले डीएनए के ५० µ एल स्थानांतरण ।
    2. sonicator कप ठंडे पानी (4 डिग्री सेल्सियस) से भरा सींग के रैक में ट्यूबों प्लेस ।
    3. 10 एस के साथ ८०% तीव्रता पर 3 मिनट के लिए पल्स पर sonicator और 5 पल्स बंद एस भागो ।
      चेतावनी: सुनवाई की रक्षा के लिए कान muffs या कान प्लग पहनें ।
    4. 2% agarose जेल पर कतरनी डीएनए के २.५ µ एल चलाने की पुष्टि करें कि डीएनए के अधिकांश आकार में < 600 bp है ।
  3. सी-टेल के अलावा
    1. एक छोटी सी मात्रा spectrophotometer के साथ डीएनए एकाग्रता को मापने ।
    2. निंनलिखित समीकरण का उपयोग करके डीएनए के ५०० एनजी करने के लिए इसी मात्रा की गणना:
      Equation 2
    3. पुच्छ प्रतिक्रिया तैयार करें (तालिका 4) । ३७ डिग्री सेल्सियस पर 1 एच मशीन; 20 मिनट के लिए ७५ ° c पर निष्क्रिय ।
      नोट: १४.५ µ l से अधिक वॉल्यूम के लिए समायोजन की आवश्यकता होती है जो नमूने के लिए, ४० µ l के लिए प्रतिक्रिया की अंतिम खंड बढ़ाएँ और शेष घटकों तदनुसार स्केल करें ।
    4. नमूनों को पीसीआर शुद्धिकरण किट से साफ किया । डीएनए को Elute के साथ 12 µ l का रेफरेंस बफर है ।
  4. नेस्टेड पीसीआर
    1. पीसीआर #1
      1. तैयार टेबल 3 और 5के अनुसार पीसीआर घोला जा सकता है । प्रत्येक पीसीआर ट्यूब के लिए पुस्तकालय मिश्रण के 22 µ एल स्थानांतरण और शुद्ध डीएनए के 3 µ एल जोड़ें । नियंत्रण मिश्रण के साथ इसी तरह आगे बढ़ें ।
        नोट: प्राइमर TnkN317 transposon और प्राइमर olj376 के लिए विशिष्ट है6 सी पूंछ के लिए विशिष्ट है । नियंत्रण मिश्रण TnkN3 प्राइमर है, जो विशेष रूप से transposon लक्ष्य कमी है ।
      2. निंन प्रोग्राम चलाएं: 2 मिनट के लिए ९५ ° c; 24 चक्र: ९५ ° c 30 s के लिए, ६० ° c के लिए 30 s, ७२ ° c 2 min के लिए; 2 मिनट के लिए ७२ ° c ।
    2. पीसीआर #2 ।
      1. टेबल 3 और 6के अनुसार दूसरी पीसीआर घोला जा सकता है तैयार करें । प्रत्येक पीसीआर ट्यूब के लिए पुस्तकालय मिश्रण के ४९ µ एल स्थानांतरण और पीसीआर #1 पुस्तकालय प्रतिक्रिया के 1 µ एल जोड़ें । स्थानांतरण २४.५ प्रत्येक पीसीआर ट्यूब करने के लिए नियंत्रण मिश्रण के µ एल और पीसीआर #1 नियंत्रण प्रतिक्रिया के ०.५ µ एल जोड़ें ।
        ध्यान दें: प्राइमर pMargent2 transposon के लिए विशिष्ट है, और आईपी प्राइमरों6 छह आधार जोड़ी बारकोड और विशिष्ट अगली पीढ़ी के अनुक्रमण मंच द्वारा मांयता प्राप्त दृश्यों होते हैं ।
      2. निंन प्रोग्राम चलाएं: 2 मिनट के लिए ९५ ° c; 18 चक्र: ९५ ° c 30 s के लिए, ६० ° c के लिए 30 s, ७२ ° c 2 min के लिए; 2 मिनट के लिए ७२ ° c ।
    3. 2% agarose जेल पर 3 µ एल भागो । पुस्तकालय २०० के बीच संकेत के बहुमत के साथ एक धब्बा दिखाना चाहिए ६०० bp (चित्रा 6) और नियंत्रण प्रतिक्रिया के लिए कोई प्रवर्धन ।
  5. पीसीआर उत्पादों का शुद्धिकरण ।
    नोट: निर्माता के निर्देशों के बाद एक पीसीआर शोधन किट के साथ जीनोमिक पुस्तकालयों को साफ । डीएनए को Elute के साथ 30 µ l का रेफरेंस बफर है ।
  6. एक fluorometer का उपयोग डीएनए एकाग्रता उपाय । औसत 2 से 3 पढ़ता है ।
  7. नीचे समीकरण का उपयोग कर एनजी 15 या 20 के लिए प्रत्येक पुस्तकालय के बराबर की मात्रा की गणना:
    Equation 3
  8. पिछले परिकलनों के अनुसार सभी लाइब्रेरीज़ को एक साथ मिलाएं. निंनलिखित वेबसाइट के समीकरण के साथ डीएनए के दाढ़ एकाग्रता का निर्धारण:
    http://www.molbiol.edu.ru/eng/scripts/01_07.html
    चेतावनी: डीएनए एकाग्रता और मात्रा आवश्यकताओं sequencing मंच पर निर्भर करते हैं ।

4. उच्च प्रवाह अनुक्रमण और डेटा विश्लेषण

  1. अनुक्रमण
    1. अनुक्रम पुस्तकालयों के रूप में ६४ बीपी एकल अंत कस्टम अनुक्रमण प्राइमर pMargent3 और मानक वाणिज्यिक अनुक्रमण प्राइमर का उपयोग कर पढ़ता है । sequencing प्लेटफ़ॉर्म सभी अनुक्रमण पढ़ता के साथ FastQ फ़ाइलें प्रदान करेगा ।
  2. आकाशगंगा सॉफ्टवेयर के साथ विश्लेषण
    1. जीनोम अनुक्रम फ़ाइल डाउनलोड करें
      1. SpiroScope डाटाबेस मुखपृष्ठ में (लिंक के लिए कदम 1.2.7 देखें), प्रयोग के लिए इस्तेमाल किया जीव और क्लिक करें "जीनोम ब्राउज़र में लोड" चुनें ।
      2. टूलबार में (मुखपृष्ठ के शीर्ष के निकट), "अनुक्रम (फसता)" पंक्ति में "खोज/निर्यात करें > डाउनलोड डेटा", का चयन करें "जीनोम" अनुक्रम डाउनलोड करने के लिए ।
      3. नोटपैड (PC) या TextEdit (Mac) के साथ फ़ाइल खोलें और गुणसूत्र का नाम बदलें (उदाहरण के लिए "चरी") । फसता स्वरूप को बनाए रखें ।
      4. गुणसूत्र द्वितीय के अनुक्रम डाउनलोड करने के लिए एक ही कदम का पालन करें । प्रतिलिपि बनाने और चिपकाने के द्वारा दोनों गुणसूत्र अनुक्रम एक एकल. txt फ़ाइल में संयोजित करें ।
        नोट: गुणसूत्र दृश्यों भी NCBI वेबसाइट (https://www.ncbi.nlm.nih.gov) से डाउनलोड किया जा सकता है और एक एकल. txt फ़ाइल में संयुक्त ।
    2. आकाशगंगा सर्वर पर फ़ाइलें अपलोड करें
      नोट: आकाशगंगा एक खुला स्रोत है, वेब आधारित डेटा गहन bioinformatics कार्यप्रवाह27,28,29,30 और https://usegalaxy.org/पर पहुंचा जा सकता है के प्रबंधन के लिए मंच ।
      1. उपकरण मेनू में, "डेटा प्राप्त करें > अपने कंप्यूटर से अपलोड फ़ाइल" चुनें. खींचें और ड्रॉप sequencing प्लेटफ़ॉर्म द्वारा जनरेट किया गया. fastq फ़ाइल (फ़ाइलें) विंडो में फिर क्लिक करें "प्रारंभ" ।
      2. Leptospira जीनोम अनुक्रम. txt फ़ाइल अपलोड करने के लिए एक ही चरणों का पालन करें ।
    3. दूल्हा पढ़ता
      1. चुनें "NGS: QC और हेरफेर > FASTQ दूल्हे" उपकरण मेनू से ।
      2. दूल्हे के लिए फ़ाइल के बगल में, कदम 4.2.2 में अपलोड पुस्तकालयों का चयन करें । इनपुट FASTQ गुणवत्ता स्कोर प्रकार में, उपयुक्त sequencing सिस्टम का चयन करें । उंनत विकल्प के लिए, छुपाएं उंनत Office चयनित छोड़ें ।
      3. क्लिक करें "निष्पादन" ।
    4. अनुक्रमण कलाकृतियों निकालें
      1. चुनें "NGS: QC और हेरफेर > अनुक्रमण कलाकृतियों को दूर" । लाइब्रेरी के आगे फ़िल्टर करने के लिए, चरण 4.2.3 में जेनरेट की गई तैयार की गई फ़ाइलों का चयन करें. क्लिक करें "निष्पादन" ।
    5. C-पुच्छ अनुक्रम निकालें
      नोट: सभी C-पुच्छ निकाल दिए जाते हैं, यह सुनिश्चित करने के लिए एक या दो बार इन चरणों को दोहराएँ ।
      1. चुनें "NGS: QC और हेरफेर > क्लिप एडेप्टर अनुक्रम" ।
      2. का चयन करें या निंन दर्ज करें:
        लायब्रेरी के लिए क्लिप: चरण 4.2.4 में जनरेट की गई फ़ाइलों का चयन करें ।
        न्यूनतम अनुक्रम लंबाई: 15
        स्रोत: कस्टम अनुक्रम दर्ज करें
        कस्टम क्लिपिंग अनुक्रम दर्ज करें: CCCCCCC
        एडाप्टर अनुक्रम और इसे का पालन करें जो x आधार रखने के लिए गैर-शूंय मान दर्ज करें: 0
        अज्ञात (N) ठिकानों के साथ अनुक्रम छोड़ें: हां
        आउटपुट विकल्प: आउटपुट दोनों काटा और गैर-काटा गया अनुक्रम
      3. क्लिक करें "निष्पादन" ।
    6. एडेप्टर अनुक्रम निकालें
      1. चुनें "NGS: QC और हेरफेर > क्लिप एडेप्टर अनुक्रम" ।
      2. का चयन करें या निंन दर्ज करें:
      3. क्लिप के लिए लाइब्रेरी: चरण 4.2.5 में जेनरेट की गई फ़ाइलों का चयन करें.
      4. न्यूनतम अनुक्रम लंबाई: 15
      5. स्रोत: कस्टम अनुक्रम दर्ज करें
      6. कस्टम क्लिपिंग अनुक्रम दर्ज करें: CGTATGCCGTCTTCTGCTTG
      7. एडाप्टर अनुक्रम और इसे का पालन करें जो x आधार रखने के लिए गैर-शूंय मान दर्ज करें: 0
      8. अज्ञात (N) ठिकानों के साथ अनुक्रम छोड़ें: हां
      9. आउटपुट विकल्प: आउटपुट दोनों काटा और गैर-काटा गया अनुक्रम
      10. क्लिक करें "निष्पादन" ।
    7. उनकी गुणवत्ता के आधार पर फ़िल्टर पढ़ता है
      1. "NGS: QC और हेरफेर > गुणवत्ता के आधार पर फ़िल्टर" का चयन करें ।
        नोट: यह उपकरण गुणवत्ता स्कोर के आधार पर पढ़ता चुनता है ।
      2. निंन का चयन करें:
        फ़िल्टर करने के लिए लायब्रेरी: चरण 4.2.6 में जनरेट की गई फ़ाइलों का चयन करें ।
        गुणवत्ता कट-ऑफ मान: 20
        क्रम में आधारों का प्रतिशत जो गुणवत्ता के बराबर होना चाहिए/उच्च कट-ऑफ मान से
      3. क्लिक करें "निष्पादन" ।
        नोट: इन सेटिंग्स के साथ, 20 न्यूक्लियोटाइड से कम या चक्र के ९५% के लिए 20 या उससे कम के एक गुणवत्ता स्कोर के साथ पढ़ता है छोड़ दिया जाता है । अपने प्रयोग में stringency सेटिंग्स रूपांतरित करें ।
    8. नक्शा पढ़ता है३२
      1. "NGS: मैपिंग > Bowtie2"३२का चयन करें ।
      2. मुख्य विंडो में फ़ील्ड्स में निम्न का चयन करें:
        यह एकल या युग्मित लाइब्रेरी है: एकल-अंत
        FASTQ फ़ाइल: चरण 4.2.7 से गुणवत्ता के लिए फ़िल्टर किए गए लायब्रेरी का चयन करें ।
        लेखन (fastq प्रारूप में) unडिग्रियों को अलग फाइल (ओं) को पढ़ता है: नहीं
        संरेखित लिखें (fastq स्वरूप में) अलग फ़ाइल (ओं) को पढ़ता है: नहीं
        आप अपने इतिहास से एक संदर्भ जीनोम का चयन करें या एक अंतर्निहित सूचकांक का उपयोग करेंगे?: इतिहास से एक जीनोम का उपयोग करें और सूचकांक का निर्माण
        संदर्भ जीनोम का चयन करें: चरण 4.2.2 में अपलोड की गई Leptospira जीनोम. txt फ़ाइल का चयन करें ।
        पढ़ें समूह जानकारी सेट करें?: सेट न करें
        विश्लेषण मोड का चयन करें: 1: केवल डिफ़ॉल्ट सेटिंग
        क्या आप प्रीसेट्स का उपयोग करना चाहते हैं?: नहीं, बस डिफ़ॉल्ट का उपयोग करें
        bowtie2 मानचित्रण आंकड़े को इतिहास में सहेजें: नहीं
        कार्य संसाधन पैरामीटर: डिफ़ॉल्ट कार्य संसाधन पैरामीटर का उपयोग करें
      3. जीनोम के लिए पढ़ता संरेखित करने के लिए "निष्पादित" क्लिक करें ।
    9. फ़ाइलें कनवर्ट करें
      1. का चयन करें "NGS: SAMtools > bam-से-सैम परिवर्तित bam करने के लिए सैम" ।
      2. निंन का चयन करें:
        BAM फ़ाइल कनवर्ट करने के लिए: चरण 4.2.8 से मैप की गई लायब्रेरी का चयन करें ।
        शीर्ष लेख विकल्प: शामिल शीर्ष लेख में SAM आउटपुट (-h)
      3. क्लिक करें "निष्पादन" ।
    10. फ़ाइलें कनवर्ट करें
      1. "NGS: SAMtools > परिवर्तित सैम अंतराल के लिए" का चयन करें ।
      2. निंन का चयन करें:
        कनवर्ट करने के लिए डेटासेट का चयन करें: चरण 4.2.9 में जेनरेट की गई SAM मैप्ड लाइब्रेरी फ़ाइल का चयन करें.
        सभी मुद्रित करें?: हां
      3. क्लिक करें "निष्पादन" ।
    11. सॉर्ट पढ़ता है
      1. "फ़िल्टर और सॉर्ट > आरोही या अवरोही क्रम में डेटा सॉर्ट करें" चुनें.
      2. निंन का चयन करें:
        सॉर्ट dataset: चरण 4.2.10 में जनरेट किया गया अंतराल फ़ाइल का चयन करें ।
        स्तंभ पर: 2
        स्वाद के साथ: संख्यात्मक क्रम
        में सब कुछ: आरोही क्रम
      3. क्लिक करें "निष्पादन" ।
    12. का चयन करें पढ़ता मिलान गुणसूत्र मैं
      1. "फ़िल्टर और सॉर्ट > किसी व्यंजक से मेल खाने वाली पंक्तियों का चयन करें" चुनें.
      2. निंन का चयन करें:
        पंक्तियों का चयन करें: चरण 4.2.11 में जनरेट किए गए सॉर्ट किए गए के साथ फ़ाइल का चयन करें ।
        कि: मिलान
        पैटर्न: गुणसूत्र मैं चरण 4.2.1.3 में निर्धारित के रूप में नाम दर्ज करें (जैसे, "चरी") ।
      3. क्लिक करें "निष्पादन" ।
    13. का चयन करें पढ़ता मिलान गुणसूत्र द्वितीय
      चरण 4.2.12 के बाद आगे बढ़ें ।
    14. समूह मैं गुणसूत्र में सम्मिलन साइटों के अनुसार पढ़ता
      1. "शामिल हों, घटाना और समूह > किसी स्तंभ के अनुसार डेटा समूहीकृत करें और अन्य स्तंभों पर एकीकृत कार्रवाई करने के लिए" चुनें.
      2. निंन का चयन करें:
        डेटा का चयन करें: चरण 4.2.12 से परिणामी फ़ाइल का चयन करें ।
        स्तंभ के अनुसार समूहीकृत: 2
        समूहीकृत करते समय मामले की उपेक्षा करें?: नहीं
        इन वर्णों से प्रारंभ रेखाओं पर ध्यान न दें: Ø
        कार्रवाई > + कार्रवाई संमिलित करें
        प्रकार: गणना
        स्तंभ पर: 2
        निकटतम पूर्णांक के लिए राउंड परिणाम: नहीं
      3. क्लिक करें "निष्पादन" ।
    15. समूह गुणसूत्र द्वितीय में सम्मिलन साइटों के अनुसार पढ़ता है
      चरण 4.2.14 के बाद आगे बढ़ें ।
    16. मैं गुणसूत्र पर क्रमबद्ध सम्मिलन साइटों
      1. "फ़िल्टर और सॉर्ट > आरोही या अवरोही क्रम में डेटा सॉर्ट करें" चुनें.
      2. निंन का चयन करें:
        सॉर्ट Dataset: चरण 4.2.14 से फ़ाइल का चयन करें ।
        कॉलम: 1
        स्वाद के साथ: संख्यात्मक क्रम
        में सब कुछ: आरोही क्रम
      3. क्लिक करें "निष्पादन" ।
    17. गुणसूत्र द्वितीय पर क्रमबद्ध सम्मिलन साइटें
      चरण 4.2.16 के बाद आगे बढ़ें ।
  3. सांख्यिकीय विश्लेषण
    1. 4.2.16 चरणों से दो स्तंभों की प्रतिलिपि बनाकर और चिपकाने के द्वारा आकाशगंगा डेटा को स्प्रेडशीट फ़ाइलों में स्थानांतरित करें. और 4.2.17 । किसी Excel फ़ाइल में ।
      नोट: प्रथम स्तंभ transposon सम्मिलन साइट का न्यूक्लियोटाइड निर्देशांक है, और दूसरा स्तंभ प्रत्येक प्रविष्टि साइट पर पढ़ता है की संख्या है ।
    2. तालिका में प्रदान की न्यूक्लियोटाइड निर्देशांक का उपयोग कर transposon बंदरगाह जीन की पहचान.
      नोट: उदाहरण के लिए, एक transposon गुणसूत्र के न्यूक्लियोटाइड #30718 में डाला मैं LIC10024 जीन है, जो गुणसूत्र में न्यूक्लियोटाइड 29263-31539 spans में स्थित है मैं ।
    3. रिश्तेदार आवृत्तियों () प्रत्येक के लिए एक ऊतक में प्रत्येक उत्परिवर्ती और नीचे समीकरण निंनलिखित इनपुट पूल में गणना:
      Equation 4
    4. प्रत्येक उत्परिवर्ती और नीचे समीकरण का उपयोग कर ऊतक के लिए उत्पादन/इनपुट अनुपात (नि.) की गणना:
      Equation 5
    5. Wilcoxon साइन-रैंक टेस्ट
      1. १.० करने के लिए प्रत्येक पशु में प्रत्येक ऊतक के लिए औसत अनुपात की स्थापना करके सभी उत्पादन/इनपुट अनुपात को सामान्य. १.० का अनुपात तटस्थ है, > 1.0 लाभप्रद है, और < 1.0 लाभप्रद३३है ।
      2. P मान के साथ Wilcoxon रैंक परीक्षण का उपयोग करके आउटपुट/इनपुट अनुपात १.० (तटस्थ रखरखाव) की तुलना करें < 0.05 सांख्यिकीय रूप से महत्वपूर्ण माना जाता है ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

विकार द्वारा एल interrogans में transposon म्यूटेंट के एक पुस्तकालय का निर्माण एक निस्पंदन इकाई की आवश्यकता है, जैसा कि चित्रा 1में दिखाया गया है । हमने प्रत्येक सहवास से 100-200 transconjugants बरामद किए.

transposon प्रविष्टि साइट प्रत्येक उत्परिवर्ती में transposon और आसंन मेजबान अनुक्रम के अंत लक्ष्य है कि अर्द्ध यादृच्छिक पीसीआर द्वारा उत्पन्न पीसीआर उत्पाद sequencing द्वारा की पहचान की है15 (चित्रा 2a) । सेमी-रैंडम पीसीआर के परिणामों का एक उदाहरण चित्रा bमें दिखाया गया है । ज्यादातर मामलों में एक प्रमुख amplicon जब Deg1 और Tnk1 प्राइमरों पीसीआर के पहले दौर और दूसरे दौर के लिए टैग और TnkN1 के लिए इस्तेमाल किया जाता है मनाया जाएगा । हालांकि, pentameric अनुक्रम की कम विशिष्टता के कारण (... N10गटात-3 ') Deg1 प्राइमर के 3 ' अंत में, इस किताब leptospiral जीनोम भर में कई स्थानों पर एनएन होगा । यदि इन साइटों transposon अंत के पास मौजूद हैं, कई पीसीआर उत्पादों प्राप्त किया जा सकता है । जब एकाधिक amplicons उत्पन्न होते हैं, तो उन्हें पीसीआर मिक्स से एक साथ शुद्ध किया जा सकता है और सीधे अनुक्रम; जेल शुद्धि प्रत्येक amplicon आवश्यक नहीं है क्योंकि वे सभी जहां TnkN1 प्राइमरी anneals की एक ही अनुक्रम बहाव होते हैं । दूसरी ओर, पीसीआर अगर Deg1 प्राइमर द्वारा लक्षित अनुक्रम के निकटतम प्रतिलिपि transposon अंत से एक महान दूरी पर स्थित है विफल हो सकता है । यदि कोई पीसीआर उत्पादों का पता चला रहे हैं, अर्द्ध यादृच्छिक पीसीआर के पहले दौर Deg1 प्राइमर और Tnk2 प्राइमर, जो transposon के विपरीत अंत लक्ष्य के साथ दोहराया जा सकता है । इस मामले में TnkN2 और टैग दूसरे दौर के लिए इस्तेमाल किया जाएगा; amplicon TnkN2 प्राइमर (चित्रा बी) के साथ अनुक्रम किया जाएगा । वैकल्पिक रूप से, पीसीआर के पहले दौर Deg2 प्राइमर, जिसका 3 ' अंत के साथ किया जा सकता है (.. । N10TCTT-3 ') एक चार के बजाय एक पांच न्यूक्लियोटाइड अनुक्रम लक्ष्य । प्राइमरी के चार विभिन्न सेट पीसीआर (पीसीआर #1): Tnk1 + Deg1, Tnk1 + Deg2, Tnk2 + Deg1, Tnk2 + Deg2 के पहले राउंड के लिए इस्तेमाल किया जा सकता है । जब प्राइमरों के एक सेट काम नहीं करता है, एक और सेट का उपयोग करें । यदि यह दूसरा सेट भी विफल रहता है, एक और एक और इतने पर का उपयोग करें । सहज कनमीसिन प्रतिरोधी म्यूटेंट बहुत दुर्लभ हैं, और < 10-10 ३४की आवृत्ति पर उठता है ।

जीनोमिक पुस्तकालयों की तैयारी (चित्रा 4) के दौरान, कदम के एक जोड़े को सत्यापित किया जा सकता है । sonication द्वारा डीएनए बाल काटना एक agarose जेल में एक aliquot के ट्रो द्वारा पुष्टि की जानी चाहिए (चित्रा 5) । जब डीएनए सही ढंग से कतरनी है, डीएनए २०० से ६०० बीपी को लेकर टुकड़े एक 2% agarose जेल में एक धब्बा बनेगी । उच्च प्रवाह अनुक्रमण के लिए पुस्तकालयों भेजने से पहले, नेस्टेड पीसीआर प्रतिक्रियाओं द्वारा पीसीआर उत्पादों की पीढ़ी agarose जेल ट्रो (चित्रा 6) द्वारा पुष्टि की जानी चाहिए ।

यहां वर्णित प्रोटोकॉल (धारा ४.२.) के बाद sequencing संसाधित करने के बाद, प्रत्येक उत्परिवर्ती की आवृत्ति इनपुट पूल में और सभी ऊतकों में खंड 4.3.3 में समीकरण का उपयोग करके निर्धारित की जाती है । एक ऊतक में प्रत्येक उत्परिवर्ती के लिए उत्पादन/इनपुट अनुपात खंड 4.3.4 में समीकरण के साथ गणना की है । चित्रा 7 तमिलनाडु-Seq दृष्टिकोण के साथ प्राप्त परिणामों का एक उदाहरण से पता चलता है. वैकल्पिक रूप से, रानी उपकरण sequencing डेटा 31को संसाधित और विश्लेषित करने के लिए उपयोग किया जा सकता है । सांख्यिकीय रूप से काफी कम और बढ़ी हुई फिटनेस के साथ म्यूटेंट की पहचान की गई. ज्ञात leptospiral डाह जीन में उत्परिवर्तनों कम फिटनेस का कारण बना, तमिलनाडु-Seq दृष्टिकोण मांय ।

Figure 1
चित्रा 1: निस्पंदन इकाई विकार के लिए इस्तेमाल किया । निस्पंदन इकाई एक पक्ष हाथ Erlenmeyer कुप्पी में फिल्टर समर्थन के डाट डालने के द्वारा इकट्ठा किया जाता है, बाँझ संदंश के साथ आधार पर एसीटेट-फाइबर फिल्टर स्थिति, तो आधार पर कीप रखने, और एक क्लैंप के साथ प्रणाली को सुरक्षित करने . निस्पंदन यूनिट तो वैक्यूम प्रणाली से जुड़ा हुआ है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2: transposon सम्मिलन साइटों की पहचान. () अर्द्ध रैंडम पीसीआर प्राइमरों की एनीलिंग साइटों दिखा योजना. Tnk1 और Tnk2 प्राइमरों transposon (तमिलनाडु) के विपरीत छोर के करीब ऐनी । Deg1 एक ३५-न्यूक्लियोटाइड प्राइमर है कि ' 3 अंत में अनुक्रम गटात द्वारा पीछा 10 पतित न्यूक्लियोटाइड के एक खिंचाव शामिल है । पीसीआर (पीसीआर #1) का पहला दौर Deg1 और Tnk1 के साथ या Deg1 और Tnk2 के साथ आयोजित किया जाता है । TnkN1 और TnkN2 प्राइमरों, पीसीआर #2 के लिए प्रयुक्त, ऐनी के बीच transposon समाप्त होता है और Tnk1 और Tnk2, क्रमशः । टैग प्राइमर के अनुक्रम Deg1 प्राइमर के ' 5 अंत की है कि समान है । () 14 transposon म्यूटेंट (गलियाँ 1 से 14) के साथ पीसीआर के दूसरे दौर के बाद प्राप्त agarose जेल का उदाहरण । पीसीआर के पहले राउंड में Deg1 और Tnk1 के साथ प्रदर्शन किया गया; दूसरा राउंड टैग और TnkN1 के साथ किया गया । सकारात्मक पीसीआर "+" और एक नकारात्मक पीसीआर द्वारा प्रतिनिधित्व कर रहा है "-" । "किमीआर" कनमीसिन प्रतिरोध कैसेट का प्रतिनिधित्व करता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3: आउटपुट पूल प्राप्त करने के लिए प्रवाह चार्ट. चुनौती के दिन (0 दिन), प्रत्येक leptospiral उत्परिवर्ती darkfield माइक्रोस्कोपी द्वारा गिना जाता है, एक ही घनत्व को पतला, और इनपुट पूल (धारा २.१ में प्रदान की विवरण) के रूप में संयुक्त । हंसटर इनपुट पूल के साथ intraperitoneally को चुनौती दी है । इसके अलावा, तीन संस्कृतियों इनपुट पूल के साथ शुरू किया गया था । टीका के दिन (0 दिन) और जब संस्कृतियों ≈ 108/mL, इनपुट पूल और संस्कृतियों के एक घनत्व तक पहुंचने के केंद्रापसारक द्वारा एकत्र और छर्रों के रूप में संग्रहित कर रहे है-८० ° c उपयोग तक (२.३ अनुभाग देखें) । समापन बिंदु दिन (जानवरों को समाप्त करने के लिए चुना दिन, जैसे, चैलेंज के बाद 4 दिन), जानवरों euthanized हैं; रक्त, गुर्दे और जिगर और एकत्र कर रहे है पर संग्रहीत-८० ° c उपयोग तक (धारा २.४ देखें) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: जीनोमिक पुस्तकालय की तैयारी का प्रवाह चार्ट. () डीएनए, धारा ३.१ में वर्णित प्रोटोकॉल के बाद रक्त, ऊतकों या संस्कृतियों से निकाला जाता है. लाल बॉक्स transposon (तमिलनाडु) का प्रतिनिधित्व करता है । () डीएनए sonication द्वारा २०० और ६०० बीपी के बीच टुकड़ों में कतरनी है । आगे का ब्यौरा धारा ३.२ में दिया गया है । () c-पुच्छ (पीला बक्से) टर्मिनल deoxynucleotidyl ट्रांस्फ़्रेज़ (TdT) के साथ सभी डीएनए अंशों में जोड़े जाते है जैसा कि खंड ३.३ और तालिका 4 में वर्णित है । जीनोमिक पुस्तकालय नेस्टेड पीसीआर (डी-ई) द्वारा अनुक्रमण के लिए तैयार है । पीसीआर का पहला दौर क्रमशः transposon और सी-टेल के लिए विशिष्ट TnkN3 और olj376 प्राइमरों के साथ किया जाता है । तालिका 3 और 5 देखें । transposon समाप्त होता है (लाल बॉक्स) युक्त केवल टुकड़े परिलक्षित होते हैं । नोट: TnkN3 की तुलना में 3 गुना अधिक olj376 प्राइमर का प्रयोग करें क्योंकि सभी डीएनए टुकड़े सी पूंछ है । पीसीआर के दूसरे दौर pMargent2 के साथ आयोजित किया जाता है, transposon अंत के लिए विशिष्ट है, और एक अनुक्रमण प्राइमर, एक छह आधार जोड़ी बारकोड अनुक्रम युक्त (गुलाबी में) सभी नमूनों की अनुमति एक एकल अनुक्रमण लेन में मल्टीप्लेक्स हो । तालिका 3 और 6 देखें । दोनों प्राइमरों Illumina अनुक्रमण के दौरान प्रवाह सेल बाध्यकारी (हरे और बैंगनी बॉक्स) के लिए आवश्यक अनुक्रम होते हैं । () परिणामी पीसीआर उत्पादों को साफ किया जाता है, और फिर उनकी एकाग्रता को खंड ३.६ में वर्णित के रूप में मापा जाता है । (G) सभी जीनोमिक लायब्रेरीज़ एक साथ परित की गई हैं; प्रत्येक लायब्रेरी में एक भिन्न बारकोड है और (H) पूल sequencing प्लेटफ़ॉर्म के लिए भेजा गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्र 5: Sonication के डीएनए. डीएनए आठ संक्रमित हंसटर (गलियाँ 1 से 8), sonicated के जिगर से शुद्ध किया गया था, और एक 2% agarose जेल में ट्रो द्वारा जांच की । कतरनी डीएनए एक धब्बा है जिसमें सबसे टुकड़े के आकार २०० और ६०० बीपी के बीच है की विशेषता है । इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

Figure 6
चित्र 6: उच्च-प्रवाह अनुक्रमण के लिए जीनोमिक लायब्रेरीज़. जीनोमिक पुस्तकालयों आठ संक्रमित हंसटर (गलियाँ 1 से 8) के रक्त से डीएनए के साथ और एक 2% agarose जेल में ट्रो द्वारा जांच के द्वारा तैयार थे । पीसीआर के ज्यादातर प्रॉडक्ट्स का साइज २०० और 600bp के बीच है । नेगेटिव कंट्रोल (पीसीआर में नहीं TnkN3 प्राइमरी #1 मिक्स, देखें तालिका 5) कोई प्रवर्धन नहीं दिखाता है (नहीं दिखाया गया है) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 7
चित्रा 7: तमिलनाडु से म्यूटेंट की फिटनेस-Seq प्रयोग । है हंसटर गुर्दे में म्यूटेंट के एक पूल की फिटनेस 4 चैलेंज के बाद दिन (है Lourdault अध्ययन17से अनुकूलित) । सभी ४२ म्यूटेंट के उत्पादन/इनपुट अनुपात प्रत्येक जानवर के लिए निर्धारित किया गया था । प्रत्येक उत्परिवर्ती जीन (एलआईसी) या intergenic क्षेत्र (अंतर) transposon में डाला जाता है या आमतौर पर साहित्य में इस्तेमाल नाम से नाम है । प्रत्येक अनुपात एक काले हीरे का प्रतिनिधित्व किया है । अनुपात का औसत (लाल रेखा) प्रत्येक उत्परिवर्ती के लिए निर्धारित किया गया था और १.० की तुलना में Wilcoxon रैंक परीक्षण का उपयोग कर । बिंदीदार रेखा १.० की फिटनेस का प्रतिनिधित्व करता है, जो तटस्थ फिटनेस के अनुरूप है । म्यूटेंट जिनकी फ़िटनेस काफी प्रभावित है तारांकन चिह्न द्वारा चिह्नित हैं: * P < 0.05; * * P < 0.01. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

अभिकर्मकों एक प्रतिक्रिया के लिए मात्रा
मास्टर मिश्रण 2x १२.५ µ l
प्राइमरी 1, 10 एमएम (TnK1 या TnK2) * १.२ µ l
प्राइमरी 2, 10 एमएम (Deg1 या Deg2) * १.२ µ l
पानी ८.८ µ l
टेंपलेट (कक्ष lysate या डीएनए) १.३ µ l
अंतिम मात्रा 25 µ l
* तालिका 3 में प्राइमर अनुक्रम ।

तालिका 1: transposon बिंद स्थल, सेमी रैंडम पीसीआर #1 मिक्स की पहचान ।

अभिकर्मकों एक प्रतिक्रिया के लिए मात्रा
मास्टर मिश्रण 2x १२.५ µ l
प्राइमरी 1, १०० mM (TnKN1 or TnKN2) * ०.२ µ l
प्राइमरी 2, १०० एमएम (टैग) * ०.२ µ l
पानी १०.१ µ l
पीसीआर के उत्पाद # 1 ०.८ µ l
अंतिम मात्रा 25 µ l
* तालिका 3 में प्राइमर अनुक्रम ।

तालिका 2: transposon बिंद स्थल, सेमी रैंडम पीसीआर #2 मिक्स की पहचान ।

नाम अनुक्रम (5 '-3 ') संदर्भ
प्राइमरी के लिए करते थे सेमी रैंडम पीसीआर
Tnk1 CTTGTCATCGTCATCCTTG 15
Tnk2 GTGGCTTTATTGATCTTGGG
Deg1 GGCCACGCGTCGACTAGTACNNNNNNNNNNगटात
Deg2 GGCCACGCGTCGACTAGTACNNNNNNNNNNTCTT
TnkN1 CGTCATGGTCTTTGTAGTCTATGG
TnKN2 TGGGGATCAAGCCTGATTGGG
टैग GGCCACGCGTCGACTAGTAC
Illumina अनुक्रमण के लिए इस्तेमाल प्राइमर
TnkN3 CGGGGAAGAACAGTATGTCGAGCTATTTTTTGACTTACTGGGGATCAAGCCTGATTGGG 17
olj376 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGGGGGGGGGGGGGG 6
pMargent2 AATGATACGGCGACCACCGAGATCTACACTCTTTCCGGGGACTTATCAGCCAACCTGTTA
आईपी 1 CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT Illumina अनुक्रमण (बोल्ड में बारकोड)
आईपी 2 CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 3 CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 4 CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 5 CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 6 CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 7 CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 8 CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 9 CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 10 CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 11 CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 12 CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 13 CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 14 CAAGCAGAAGACGGCATACGAGATGGAACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 15 CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 16 CAAGCAGAAGACGGCATACGAGATGGACGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 17 CAAGCAGAAGACGGCATACGAGATCTCTACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 18 CAAGCAGAAGACGGCATACGAGATGCGGACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 19 CAAGCAGAAGACGGCATACGAGATTTTCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 20 CAAGCAGAAGACGGCATACGAGATGGCCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 21 CAAGCAGAAGACGGCATACGAGATCGAAACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 22 CAAGCAGAAGACGGCATACGAGATCGTACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 23 CAAGCAGAAGACGGCATACGAGATCCACTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 24 CAAGCAGAAGACGGCATACGAGATGCTACCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 25 CAAGCAGAAGACGGCATACGAGATATCAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 26 CAAGCAGAAGACGGCATACGAGATGCTCATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 27 CAAGCAGAAGACGGCATACGAGATAGGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 28 CAAGCAGAAGACGGCATACGAGATCTTTTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी 29 CAAGCAGAAGACGGCATACGAGATTAGTTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
आईपी seq GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
pMargent3 ACACTCTTTCCGGGGACTTATCAGCCAACCTGTTA 6

तालिका 3: प्राइमरी जुगाड़ ।

अभिकर्मकों एक प्रतिक्रिया के लिए मात्रा
कतरनी डीएनए ५०० एनजी (3.3.2 में समीकरण देखें.)
पानी १४.५ तक µ l
5x TdT बफर 4 µ l
(९.५ mm dCTP + ०.५ mm ddCTP) मिक्स * 1 µ l
TdT (30 यू/µ एल) ०.५ µ l
अंतिम मात्रा 20 µ l
* मिश्रण 3 µ lof 10 mM ddCTP, ५.७ µ l की १०० mM dCTP और ५१.३ µ l of water

तालिका 4: टर्मिनल deoxynucleotidyl ट्रांस्फ़्रेज़ (TdT) के साथ सी-टेल रिएक्शन ।

अभिकर्मकों एक प्रतिक्रिया के लिए मात्रा
लायब्रेरी प्रतिक्रिया नियंत्रण प्रतिक्रिया
मास्टर मिश्रण 2x १२.५ µ l १२.५ µ l
प्राइमरी 1, 30 µ मी (TnkN3) * ०.५ µ l -
प्राइमरी 2, 30 µ मी (olj376) * १.५ µ l १.५
पानी ७.५ µ l 8 µ l
सी-टेल डीएनए 3 µ l 3 µ l
अंतिम मात्रा 25 µ l 25 µ l
* तालिका 3 में प्राइमर अनुक्रम ।

तालिका 5: जीनोमिक लाइब्रेरी का निर्माण, पीसीआर #1 मिक्स ।

अभिकर्मकों एक प्रतिक्रिया के लिए मात्रा
लायब्रेरी प्रतिक्रिया नियंत्रण प्रतिक्रिया
मास्टर मिश्रण 2x 25 µ l १२.५ µ l
प्राइमरी 1, 30 µ मी (pMargent2) * ०.५ µ l ०.२५ µ l
प्राइमरी 2, 30 µ मी (अनुक्रमण प्राइमर) * ०.५ µ l ०.२५ µ l
पानी 23 µ l ११.५ µ l
पीसीआर के उत्पाद # 1 1 µ l ०.५ µ l
अंतिम मात्रा ५० µ l 25 µ l
* तालिका 3 में प्राइमर अनुक्रम ।

तालिका 6: जीनोमिक लाइब्रेरी का निर्माण, पीसीआर #2 मिक्स ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हालांकि हंसटर के लिए हमारे पायलट प्रयोग से ४२ एल interrogans म्यूटेंट के साथ intraperitoneally चुनौती दी17प्रस्तुत कर रहे हैं, हम उंमीद है कि म्यूटेंट के बड़े पूल तमिलनाडु द्वारा जांच की जा सकती है-Seq । क्योंकि transconjugants की आवृत्ति कम है (100-200 transconjugants/संभोग), कई संभोग के लिए बड़े तमिलनाडु-Seq प्रयोगों के लिए म्यूटेंट की एक पर्याप्त संख्या उत्पंन करने के लिए आवश्यक हैं । तरल संस्कृतियों में म्यूटेंट की एक बड़ी संख्या को बनाए रखने सैंय चुनौतियों है कि संबोधित किया जाना चाहिए प्रस्तुत करता है । संस्कृतियों गहरी ९६-अच्छी तरह से प्लेटों में मशीन किया जा सकता है । संस्कृति घनत्व ४२० एनएम के लिए सेट एक spectrophotometer में ऑप्टिकल घनत्व रीडिंग द्वारा निगरानी की जा सकती है । उपयोग करने के लिए जानवरों की संख्या का निर्धारण इनपुट पूल के आकार पर भाग में निर्भर करता है और शक्ति विश्लेषण द्वारा निर्धारित किया जाना चाहिए । बड़े पैमाने पर प्रयोग के लिए, हम अनुशंसा करते है कि बिजली विश्लेषण एक biostatistician के साथ परामर्श में किया जाएगा ।

अड़चनों उत्पादन पूल से यादृच्छिक म्यूटेंट की वसूली को प्रभावित कर सकते हैं । हालांकि गंभीर अड़चनों हमारे पायलट अध्ययन में नहीं देखा गया17 (चित्रा 7), बड़े पैमाने पर प्रयोग म्यूटेंट के यादृच्छिक नुकसान से प्रभावित हो सकता है । उत्परिवर्ती प्रति इनपुट पूल में कोशिकाओं की संख्या में वृद्धि से चुनौती खुराक में वृद्धि अड़चनों की संभावना को कम करेगा३५। नव प्रकाशित आकाशगंगा टूल रानी31बाधाओं और फिटनेस का आकलन करने के लिए आवश्यक उपकरण प्रदान करता है ।

तमिलनाडु-Seq संक्रमण का एक वैकल्पिक मार्ग के लिए योजना बनाई प्रयोगों, अन्य Leptospira उपभेदों, या अन्य कुतर मॉडल अतिरिक्त विचार की आवश्यकता होती है । यदि मेजबान प्रजातियों में संक्रमण की कैनेटीक्स ज्ञात नहीं है या प्रत्येक ऊतक के भीतर संक्रमण के दौरान लगातार घातीय नहीं है की जांच की जाए, डीएनए ऊतकों के बजाय सीधे ऊतकों से संवर्धन से प्राप्त किया जाना चाहिए । इस अतिरिक्त कदम मृत spirochetes से डीएनए का पता लगाने के लिए कारण उत्परिवर्ती फिटनेस के आंक को कम करेगा । यदि उत्पादन पूल संवर्धन ऊतकों से प्राप्त की है, इनपुट पूल के लिए इन विट्रो वृद्धि का पता प्रभाव को प्रसंस्कृत किया जाना चाहिए । हम यह भी तय करने के लिए म्यूटेंट की एक छोटी संख्या के साथ एक पायलट प्रयोग की सिफारिश है कि क्या अड़चनों एक चिंता का विषय होगा और बड़े पैमाने पर प्रयोगों के लिए बिजली विश्लेषण सहायता ।

तमिलनाडु द्वारा निर्धारित के रूप में बदल फिटनेस की पुष्टि-Seq पशु मॉडल में व्यक्तिगत म्यूटेंट के परीक्षण की आवश्यकता होगी । वर्तमान में, प्रत्येक उत्परिवर्ती व्यक्तिगत रूप से तमिलनाडु से पहले अनुक्रम-Seq के लिए ब्याज की जीन में सम्मिलन ले जाने के उत्परिवर्ती की पहचान करना चाहिए । हालांकि, अगर रोगजनक Leptospira में एलील प्रतिस्थापन आसान हो जाता है, व्यक्तिगत म्यूटेंट के sequencing अब आवश्यक हो जाएगा । वैकल्पिक रूप से, प्रतिलेखन उत्प्रेरक की तरह प्रभाव सफलतापूर्वक एल interrogans३६में एलआईजी जीन अभिव्यक्ति कम करने के लिए इस्तेमाल किया गया है । इस तकनीक को नीचे करने के लिए इस्तेमाल किया जा सकता है बदल तमिलनाडु-Seq द्वारा की पहचान की फिटनेस के साथ म्यूटेंट में बाधित जीन विनियमित ।

जब तमिलनाडु-Seq डेटा की व्याख्या, जीवाणुओं के बीच बातचीत को ध्यान में रखा जाना चाहिए । यह सैद्धांतिक रूप से संभव है कि फिटनेस में कमी म्यूटेंट के बीच प्रतिस्पर्धा के बजाय transposon प्रविष्टि के प्रत्यक्ष प्रभाव के कारण हो सकता है । इसके अतिरिक्त, एक पूल में एक उत्परिवर्ती के रखरखाव में vivo में परिवर्तन की अनुपस्थिति म्यूटेंट के बीच सहयोग के कारण हो सकता है । उदाहरण के लिए, एक उत्परिवर्ती है कि एक आवश्यक कारक का उत्पादन करने में विफल रहता है पूल में अंय म्यूटेंट द्वारा कारक के उत्पादन के द्वारा सेलुलर पूरक किया जा सकता है । हम कई म्यूटेंट है, जो अब synthesizing प्रोटीन है कि विकास के लिए आवश्यक नहीं है की कम चयापचय बोझ का परिणाम हो सकता है के लिए फिटनेस में वृद्धि देखी, के रूप में साल्मोनेला enterica३७के लिए दिखाया गया है ।

इस प्रोटोकॉल के लिए इन विट्रो ३८,३९में तनावपूर्ण परिस्थितियों में चयापचय या अस्तित्व में शामिल जीन की पहचान करने के लिए इस्तेमाल किया जा सकता है । उदाहरण के लिए, उच्च सोडियम क्लोराइड एकाग्रता, सीमित लोहा, और अम्लीय पीएच जैसे विभिन्न स्थितियों में बढ़ती Leptospira अम्लीय अस्तित्व या तनाव प्रतिरोध के लिए जिंमेदार जीन की पहचान कर सकता है । इन विट्रो प्रयोगों में भी saprophytic उपभेदों के साथ प्रदर्शन किया जा सकता है जैसे एल biflexa तनाव Patoc मैं क्योंकि इस तमिलनाडु-Seq विधि सभी अनुक्रम Leptospira उपभेदों के लिए लागू किया जा सकता है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

यह काम एक दिग्गजों मामलों मेरिट पुरस्कार (D.A.H. के लिए) और स्वास्थ्य अनुदान R01 ऐ ०३४४३१ (D.A.H.) के एक राष्ट्रीय संस्थान द्वारा समर्थित किया गया था ।

Materials

Name Company Catalog Number Comments
Kanamycin sulfate from Streptomyces kanamyceticus Sigma-Aldrich K4000
2,6-diaminopimelic acid Sigma-Aldrich D1377
Spectinomycin dihydrochloride pentahydrate Sigma-Aldrich S4014
Axio Lab A1 microscope with a darkfieldcondenser Zeiss 490950-001-000
DNeasy blood and tissue kit Qiagen 69504/69506
MinElute PCR Purification Qiagen 28004/28006
QIAquick PCR purification kit Qiagen 28104/28106
Model 505 Sonic Dismembrator Fisher Scientific FB-505
2.5" Cup horn Fisher Scientific FB-4625
Bead Ruptor 24 Omni International 19-010 Step 3.1.2.4
Terminal deoxynucleotidyl transferase Promega M828C
Master mix Phusion Thermo Scientific F531 Preparation of genomic libraries, step 3.4.
DreamTaq Master Mix Thermo Scientific K9011/K9012 Identification of the transposon insertion site, step 1.2.
dCTP Thermo Scientific R0151
ddCTP Affymetrix/ USBProducts 77112
T100 Thermal cycler BioRad 1861096
Qubit 2.0 fluorometer Invitrogen Q32866 step 3.6.
Qubit dsDNA HS assay kit Invitrogen Q32851/Q32854 step 3.6.
Qubit assay tubes life technologies Q32856 step 3.6.
PBS pH 7.2 (1X) Gibco 20012-027 20012-050
Disposable scalpel No10 Feather 2975#10
Plastic K2 EDTA 2 ml tubes BD vacutainer 367841
syringe U-100 with 26G x ½” needle BD vacutainer 329652 IP challenge, step 2.2.1.
3 mL Luer-Lok tip syringe BD vacutainer 309657 Cardiac puncture, step 2.4.2.
25G X 5/8” needle BD vacutainer 305901 Cardiac puncture, step 2.4.2.
25 mm fritted glass base with stopper EMD Millipore XX1002502 Filtration unit system, step 1.1.7.
25 mm aluminum spring clamp EMD Millipore XX1002503 Filtration unit system, step 1.1.7.
15 ml borosilcate glass funnel EMD Millipore XX1002514 Filtration unit system, step 1.1.7.
125 ml side-arm Erlenmeyer flask EMD Millipore XX1002505 Filtration unit system, step 1.1.7.
Acetate-cellulose filter VVPP (pore size 0.1 mm; diameter 25 mm) EMD Millipore VVLP02500

DOWNLOAD MATERIALS LIST

References

  1. Murray, G. L., et al. Genome-wide transposon mutagenesis in pathogenic Leptospira species. Infect Immun. 77, (2), 810-816 (2009).
  2. Adler, B., Lo, M., Seemann, T., Murray, G. L. Pathogenesis of leptospirosis: the influence of genomics. Vet Microbiol. 153, (1-2), 73-81 (2011).
  3. Marcsisin, R. A., et al. Use of a high-throughput screen to identify Leptospira mutants unable to colonize the carrier host or cause disease in the acute model of infection. J Med Microbiol. 62, 1601-1608 (2013).
  4. van Opijnen, T., Bodi, K. L., Camilli, A. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat Methods. 6, (10), 767-772 (2009).
  5. van Opijnen, T., Lazinski, D. W., Camilli, A. Genome-wide fitness and genetic interactions determined by Tn-seq, a high-throughput massively parallel sequencing method for microorganisms. Curr Protoc Microbiol. 36, 1E.3.1-1E.3.24 (2015).
  6. Troy, E. B., et al. Understanding barriers to Borrelia burgdorferi dissemination during infection using massively parallel sequencing. Infect Immun. 81, (7), 2347-2357 (2013).
  7. Wunder, E. A. Jr, et al. Real-time PCR reveals rapid dissemination of Leptospira interrogans after intraperitoneal and conjunctival inoculation of hamsters. Infect Immun. 84, (7), 2105-2115 (2016).
  8. Lourdault, K., Aviat, F., Picardeau, M. Use of quantitative real-time PCR for studying the dissemination of Leptospira interrogans in the guinea pig infection model of leptospirosis. J Med Microbiol. 58, 648-655 (2009).
  9. Coutinho, M. L., et al. Kinetics of Leptospira interrogans infection in hamsters after intradermal and subcutaneous challenge. PLoS Negl Trop Dis. 8, (11), e3307 (2014).
  10. Athanazio, D. A., et al. Rattus norvegicus as a model for persistent renal colonization by pathogenic Leptospira interrogans. Acta Trop. 105, (2), 176-180 (2008).
  11. Ratet, G., et al. Live imaging of bioluminescent Leptospira interrogans in mice reveals renal colonization as a stealth escape from the blood defenses and antibiotics. PLoS Negl Trop Dis. 8, (12), e3359 (2014).
  12. Gutierrez, M. G., Yoder-Himes, D. R., Warawa, J. M. Comprehensive identification of virulence factors required for respiratory melioidosis using Tn-seq mutagenesis. Front Cell Infect Microbiol. 5, (78), (2015).
  13. Gawronski, J. D., Wong, S. M., Giannoukos, G., Ward, D. V., Akerley, B. J. Tracking insertion mutants within libraries by deep sequencing and a genome-wide screen for Haemophilus genes required in the lung. Proc Natl Acad Sci U S A. 106, (38), 16422-16427 (2009).
  14. Gallagher, L. A., Shendure, J., Manoil, C. Genome-scale identification of resistance functions in Pseudomonas aeruginosa using Tn-seq. MBio. 2, (1), (2011).
  15. Slamti, L., Picardeau, M. Construction of a library of random mutants in the spirochete Leptospira biflexa using a mariner transposon. Methods Mol Biol. 859, (2012).
  16. Picardeau, M. Conjugative transfer between Escherichia coli and Leptospira spp. as a new genetic tool. Appl Environ Microbiol. 74, (1), 319-322 (2008).
  17. Lourdault, K., Matsunaga, J., Haake, D. A. High-throughput parallel sequencing to measure fitness of Leptospira interrogans transposon insertion mutants during acute infection. PLoS Negl Trop Dis. 10, (11), e0005117 (2016).
  18. Ellinghausen, H. C., McCullough, W. G. Nutrition of Leptospirapomona and growth of 13 other serotypes: Fractionation of oleic albumin complex and a medium of bovine albumin and polysorbate 80. Am J Vet Res. 26, 45-51 (1965).
  19. Johnson, R. C., Harris, V. G. Differentiation of pathogenic and saprophytic letospires. I. Growth at low temperatures. J Bacteriol. 94, (1), 27-31 (1967).
  20. Demarre, G., et al. A new family of mobilizable suicide plasmids based on broad host range R388 plasmid (IncW) and RP4 plasmid (IncPa) conjugative machineries and their cognate Escherichia coli host strains. Res Microbiol. 156, (2), 245-255 (2005).
  21. Vallenet, D., et al. MicroScope: a platform for microbial genome annotation and comparative genomics. Database (Oxford). bap021 (2009).
  22. Goodman, A. L., Wu, M., Gordon, J. I. Identifying microbial fitness determinants by insertion sequencing using genome-wide transposon mutant libraries. Nat. Protocols. 6, (12), 1969-1980 (2011).
  23. Miller, J. Spirochetes in body fluids and tissues manual of investigative methods. 22-23 (1971).
  24. Ristow, P., et al. The OmpA-like protein Loa22 is essential for leptospiral virulence. PLoS Pathog. 3, (7), (2007).
  25. Croda, J., et al. Targeted mutagenesis in pathogenic Leptospira species: disruption of the LigB gene does not affect virulence in animal models of leptospirosis. Infect Immun. 76, (12), 5826-5833 (2008).
  26. Haake, D. A. Hamster model of leptospirosis. Curr Protoc Microbiol. 12, 2 (2006).
  27. Giardine, B., et al. Galaxy: a platform for interactive large-scale genome analysis. Genome Res. 15, (10), 1451-1455 (2005).
  28. Goecks, J., Nekrutenko, A., Taylor, J., Galaxy, T. Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Genome Biol. 11, (8), R86 (2010).
  29. Blankenberg, D., et al. Galaxy: a web-based genome analysis tool for experimentalists. Curr Protoc Mol Biol. (Chapter 19), 11-21 (2010).
  30. Afgan, E., et al. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2016 update. Nucleic Acids Res. 8, (44), (2016).
  31. McCoy, K. M., Antonio, M. L., van Opijnen, T. MAGenTA; a Galaxy implemented tool for complete Tn-Seq analysis and data visualization. Bioinformatics. 1367 (2017).
  32. Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, (3), R25 (2009).
  33. Kamp, H. D., Patimalla-Dipali, B., Lazinski, D. W., Wallace-Gadsden, F., Camilli, A. Gene fitness landscapes of Vibrio cholerae at important stages of its life cycle. PLoS Pathog. 9, (12), e1003800 (2013).
  34. Poggi, D., Oliveira de Giuseppe, P., Picardeau, M. Antibiotic resistance markers for genetic manipulations of Leptospira spp. Appl Environ Microbiol. 76, (14), 4882-4885 (2010).
  35. van Opijnen, T., Camilli, A. Transposon insertion sequencing: a new tool for systems-level analysis of microorganisms. Nat Rev Microbiol. 11, (7), 435-442 (2013).
  36. Pappas, C. J., Picardeau, M. Control of gene expression in Leptospira spp. by Transcription activator-like effectors demonstrates a potential role for LigA and LigB in Leptospira interrogans virulence. Appl Environ Microbiol. 81, (22), 7888-7892 (2015).
  37. Koskiniemi, S., Sun, S., Berg, O. G., Andersson, D. I. Selection-driven gene loss in bacteria. PLoS Genet. 8, (6), e1002787 (2012).
  38. Troy, E. B., et al. Global Tn-seq analysis of carbohydrate utilization and vertebrate infectivity of Borrelia burgdorferi. Mol Microbiol. 101, (6), 1003-1023 (2016).
  39. Ramsey, M. E., et al. A high-throughput genetic screen identifies previously uncharacterized Borrelia burgdorferi genes important for resistance against reactive oxygen and nitrogen species. PLoS Negl Trop Dis. 13, (2), e1006225 (2017).
गोल्डन सीरियाई हंसटर संक्रमण के दौरान <em>Leptospira interrogans</em> Transposon प्रविष्टि म्यूटेंट की फिटनेस को मापने के लिए उच्च प्रवाह समानांतर अनुक्रमण
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Lourdault, K., Matsunaga, J., Evangelista, K. V., Haake, D. A. High-throughput Parallel Sequencing to Measure Fitness of Leptospira interrogans Transposon Insertion Mutants During Golden Syrian Hamster Infection. J. Vis. Exp. (130), e56442, doi:10.3791/56442 (2017).More

Lourdault, K., Matsunaga, J., Evangelista, K. V., Haake, D. A. High-throughput Parallel Sequencing to Measure Fitness of Leptospira interrogans Transposon Insertion Mutants During Golden Syrian Hamster Infection. J. Vis. Exp. (130), e56442, doi:10.3791/56442 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter