Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Guidede protokol for fækal mikrobielle karakterisering af 16S rRNA-amplikon sekventering

doi: 10.3791/56845 Published: March 19, 2018

Summary

Dette manuskript beskriver en detaljeret standardiseret protokol af høj overførselshastighed 16S rRNA-amplikon sekvensering. Protokollen introducerer en integreret, uniformerede, gennemførlige og billig protokol fra fecal prøvetagning gennem data analyser. Denne protokol giver mulighed for analyse af store mængder prøver med strenge standarder og flere kontrolelementer.

Abstract

Den menneskelige intestinal microbiome spiller en central rolle beskytte celler mod skader, behandling af energi og næringsstoffer, og at fremme immunitet. Afvigelser fra hvad der betragtes som en sund mikrobiota sammensætning (dysbiosis) kan forringe vitale funktioner fører til patologiske betingelser. De seneste og igangværende forskningsindsats har været rettet mod karakterisering af tilknytninger mellem mikrobielle sammensætning og menneskers sundhed og sygdom.

Fremskridt i høj overførselshastighed sekventering teknologier aktiverer karakterisering af gut mikrobielle sammensætning. Disse metoder omfatter 16S rRNA-amplikon sekvensering og shotgun sekventering. 16S rRNA-amplikon sekventering bruges til at profilere taksonomisk sammensætning, mens shotgun sekventering giver yderligere oplysninger om gen forudsigelser og funktionelle anmærkning. En fordel i at anvende en målrettet sekventering metode af 16S rRNA gen variable region er dens betydeligt lavere omkostninger sammenlignet med shotgun sekvensering. Sekvens forskelle i 16S rRNA gen bruges som en mikrobiel fingeraftryk til at identificere og kvantificere forskellige taxa i en individuel prøve.

Store internationale bestræbelser har hyret standarder til 16S rRNA-amplikon sekvensering. Men, flere undersøgelser rapport en fælles kilde til variation forårsaget af batch effekt. For at minimere denne effekt, uniformerede protokoller for prøvetagning, skal forarbejdning og sekventering gennemføres. Denne protokol foreslår integration af bredt anvendte protokoller fra fecal prøvetagning til dataanalyse. Denne protokol indeholder en kolonne-fri, direkte-PCR tilgang, der muliggør samtidige håndtering og DNA-ekstraktion af store mængder fækal prøver, sammen med PCR-amplifikation af V4-regionen. Derudover protokollen beskriver analyse rørledningen og indeholder et script ved hjælp af den nyeste version af QIIME (QIIME 2 version 2017.7.0 og DADA2). Denne trinvise protokollen har til formål at guide dem interesseret i at indlede brugen af 16S rRNA-amplikon sekventering i en robust, reproduktive, nem at bruge, detaljeret måde.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Har gjort koncentreret indsats for bedre at forstå microbiome diversiteten og tætheden, som et andet aspekt af fanger forskel og ligheder mellem personer i sund og patologiske betingelser. Alder2,3, geografi4, livsstil5,6, og sygdom5 viste sig at være forbundet med sammensætningen af gut microbiome, men mange betingelser og befolkninger har endnu ikke fuldt karakteriseret. For nylig er blevet rapporteret, at microbiome kan ændres til terapeutisk anvendelse7,8,9. Derfor, yderligere indsigt i forholdet mellem forskellige fysiologiske forhold og den mikrobielle sammensætning er det første skridt mod en optimering af mulige fremtidige ændringer.

Metoderne traditionelle mikrobielle kultur begrænses af lave udbytter10,11, og er udtænkt som en binær tilstand, hvor en bakterie er enten til stede i tarmen eller ej. Høj overførselshastighed DNA-baserede sekventering har revolutioneret mikrobiel økologi, gør det muligt for erobringen af alle medlemmer af mikrobielle samfund. Dog læse rækkefølge, længde og kvalitet er fortsat betydelige hindringer for nøjagtig taksonomi tildeling12. Høj overførselshastighed baseret eksperimenter kan desuden lider batch effekter, hvor målinger påvirkes af ikke-biologiske eller ikke-videnskabelige variabler13. I de seneste år, er der etableret flere programmer til at studere den human microbiome, herunder projektets amerikansk Gut, USA (US) Human Microbiome Project og Det Forenede Kongerige (UK) MetaHIT projekt. Disse initiativer har genereret enorme mængder af data, der ikke er let sammenlignelige på grund af en mangel på sammenhæng i deres strategier. En række internationale projekter såsom International Human Microbiome Consortium, projektets International Human Microbiome standarder og National Institute of Standards and Technology (NIST) forsøgte at løse nogle af disse spørgsmål14 , og udviklet standarder for microbiome målinger, som skal sætte opnåelsen af pålidelige reproduktive resultater. Beskrevet her er en integreret protokol af flere bredt anvendte metoder15,16 for 16S rRNA høj overførselshastighed sekventering (16S-seq) startende fra fecal prøvetagning igennem data analyser. Protokollen beskriver en kolonne-fri PCR metode, oprindeligt udviklet til direkte udtræk af planten DNA16, for at aktivere den samtidige håndtering af store mængder af fækal prøver i en forholdsvis kort tid med høj kvalitet amplificeret DNA for målrettet sekventering af mikrobielle variable V4 regionen på en fælles platform, sekventering. Denne protokol har til formål at guide forskere interesseret i at indlede brugen af 16S rRNA-amplikon sekventering i en robust, reproduktive, nem at bruge, detaljeret måde, ved hjælp af vigtige kontrol. At have en guidet og detaljerede trin-for trin protokol kan minimere batch effekt og således vil give mere sammenlignelige sekventering resultater mellem labs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Etisk godkendelse for studiet af Sheba lokale forskning etiske komité og alle metoder blev udført i overensstemmelse med de relevante retningslinjer og forordninger. Protokollen modtog en patientsamtykke undtagelse fra den lokale etiske Review Board, siden den fecal materiale, der blev brugt var allerede indsendt til mikrobiologi kernen som en del af klinisk workup og uden identificerbare patientinformation end alder, køn og mikrobielle resultater. Skrevet, blev indhentet informeret samtykke fra raske frivillige og den institutionelle Review Board godkendt undersøgelsen. Nogle af disse prøver er allerede medtaget i en tidligere analyse1.

1. sample håndtering

  1. Indsamle en cirka 5 mm2 smøre (omtrent på størrelse med en blyant viskelæder) fra en frisk fækal prøve med en steril vatpind i en test tube (Se Tabel af materialer). Gemme alle podninger indeholder fækal prøver på-80 ° C inden for 24 timer. Fækal podninger kan forblive der indtil videre forarbejdning.

2. DNA-ekstraktion

  1. Optø udtræk og fortynding løsningerne ved stuetemperatur (Se Tabel af materialer).
  2. Overførsel fækal podepinden ind i et tomt 2 mL collection tube (Se Tabel af materialer). Justere vatpind stick størrelse ved at skære det ved hjælp af en ren saks til at aktivere tube lukning med minimum krydskontaminering. Tilføje 250 μL af ekstraktionsopløsningen til hver indsamling rør indeholdende fækal svaber og vortex at blande.
  3. Varme prøver i 10 minutter i et vandbad med kogende (95-100° C). Tilsæt 250 μL af fortynding løsning til hver prøve og vortex at blande.
  4. Gemme 2 mL rør, der indeholder det ekstraherede DNA og svaber ved 4 ° C.

3. PCR og bibliotek forberedelse

For trin 3.1 og 3.2, arbejde i en PCR-arbejdsstation, der leverer ren, skabelon og amplikon frit miljø.

  1. Label primere (tabel 1) ifølge deres stregkode. Fortynd hver primer i dobbelt destilleret vand (DDW) til en 50 μM koncentration og opbevares ved-20 ° C.
  2. Bruge en 96-brønd plade til PCR reaktioner. Hver plade kan indeholde 32 forskellige prøver, som er mærket af 32 forskellige index primere. Optø den fremskudte primer og de 32 omvendt primere ved stuetemperatur og fortyndes dem til 5 μM.
  3. Forberede PCR reaktion blander for 100 reaktioner (endelige mængden i hver brønd vil være 20 μl) ved blanding af 100 μL af 5 μM fremad primer, 1 mL 2 X PCR Master mix og 400 μL DDW. Sætte 15 μl af denne PCR mix i hver brønd (alt 96 brønde). Tilføje 1 μL af hver 5 μM omvendt indekserede primer til 3 forskellige brønde (32 forskellige primere i tre giver 96 brønde i alt).
  4. I en pre-PCR dedikeret zone, hvilket betyder en ren bænk, der er skabelon og amplikon gratis, tilføje 4 μL af hver ekstraherede DNA-prøve at reaktion blandinger (hver ekstraherede DNA prøve forstærkes i tre eksemplarer — 32 prøver pr. 96-brønd plade).
  5. Køre PCR med følgende indstillinger: indledende denaturering 94 ° c i 3 min. efterfulgt af 35 cyklusser af denaturering på 94 ° C i 1 min., udglødning ved 55 ° C i 1 min og udvidelse ved 72 ° C i 1 min; og en sidste udvidelse ved 72 ° C i 10 min.
  6. På en anden bænk, der vil blive defineret som en post-PCR dedikeret zone, kombinere hver tredobbelt PCR reaktion i en enkelt enhed tube (60 μl pr. prøve).
  7. For at vurdere kvaliteten af PCR-amplikoner, køre 4 μL af hver kombineret PCR reaktion på en ethidium bromid-farvede 1% agarosegel. Under UV bølgelængde på 260 nm, den positive amplikoner vil fremgå en forventet band størrelse på 375-425 bp. Kun disse amplikoner vil indgå i de efterfølgende trin.
    Bemærk: Hver prøve er forstærket i tredobbelt, hvilket betyder at hver prøve forstærkes i 3 forskellige PCR reaktioner. Ikke skalere.

4. biblioteket kvantificering og rengøring

  1. For at få en equimolar koncentration pulje af alle PCR prøver, kvantificere hver amplikon af en dobbelt strandede DNA (dsDNA kvantificere reagens) fluorescerende nukleinsyre pletten (Se Tabel af materialer), egnet til den samtidige kvantificering af en stor antal prøver.
    Bemærk: Da størrelsesområde for amplikonen er tvetydige, er det faktiske beløb i nanogram bruges til at indlæse en equimolar koncentration.
  2. Kombiner 500 ng af hver prøve ind i et enkelt, sterile rør. Vortex at blande.
  3. Køre 200 μl af poolede biblioteket på en ethidiumbromid-farvede 1% agarosegel. Extract 375-425 bp bånd fra gel ved hjælp af en gel udvinding kit ifølge producentens anvisninger (Se Tabel af materialer) og elueres poolede biblioteket i 80 μl DDW.
    Bemærk: Poolede biblioteket skal være størrelse valgt at reducere ikke-specifikke forstærkning produkter fra værten DNA.
  4. Måle den endelige bibliotek koncentration ved hjælp af en yderst følsom dsDNA afsløre kit ifølge producentens anvisninger (Se Tabel af materialer). Måle den nøjagtige bibliotek størrelse ved hjælp af en yderst følsom adskillelse og analyse kit for DNA biblioteker ifølge producentens anvisninger (Se Tabel af materialer).

5. sekventering

  1. Fortyndes de poolede bibliotek til 7 pM med tilsætning af 20% kontrol bibliotek (Se Tabel af materialer), i henhold til sekventering maskine protokollen.
  2. Til sekvensering Læs Brug custom designet primere, der er gratis for V4 forstærkning primere (Se tabel 1).
  3. Brug en tredje brugerdefinerede designet sekventering primer, der læser stregkoder i et yderligere cyklus (Se tabel 1) og genererer parret ende læser i 175 baser i længde i hver retning, ifølge producentens specifikationer.
  4. Køre sekventering maskine og få FASTQ filer efter producentens protokol.

6. databehandling

  1. Sy sammen og behandle de overlappende parret-end FASTQ filer i en data datasikring pipeline implementeret i QIIME 2 version 2017.7.017. Afmultiplekse læser efter prøven specifikke stregkoder.
  2. Brug DADA218 til kvalitetskontrol og sekvens variant (SVs). Afkort læsninger på 13 baser fra 3'-enden og 15 baser fra 5' ende, kassere læser med mere end 2 forventet fejl. Identificere og fjerne kimærer ved hjælp af metoden konsensus — kimærer er fundet i prøver individuelt, og sekvenser fundet kimære i en tilstrækkelig brøkdel af prøver er fjernet.
  3. Udføre SVs taksonomiske klassifikation ved hjælp af en Naive Bayes monteret klassificering, uddannet på August 2013 99% identitet Greengenes database6, for 175 længe læsninger og frem/tilbage primer sæt.
  4. Rarefy alle prøver til dybden af 2,146 sekvenser.
  5. Bruge oejeblikkelige UniFrac til måling af β-mangfoldighed (mellem prøve mangfoldighed19,20) på de forfinede prøver for at undgå en stikprøve størrelse effekt.
  6. Du kan bruge matrixen resulterende afstand til at udføre en principal koordinater analyse (PCoA).
    Bemærk: Databehandling script og kortlægning filer leveres som supplerende materiale (supplerende materiale 1 og 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En skematisk illustration af protokollen er vist i figur 1.

Fremadrettet har vi samlet afføringsprøver fra indlagte patienter med mistænkt infektiøs diarré. Disse prøver blev indsendt til klinisk Mikrobiologi Lab på Sheba Medical Center mellem februar og maj 2015, som var tidligere beskrevet1. Afføringsprøver blev udsat for konventionel mikrobiologiske kultur udført klinisk Mikrobiologi laboratorium og bred vifte høj overførselshastighed 16S-seq parallelt. Derudover blev afføringsprøver fra raske voksne sekventeret for sammenligning.

I denne analyse var fokus på kvalitetskontrol af data, og Vis repræsentative resultater af outputtet fra QIIME217. I første omgang, sekventering resultater opnået i 6 negative kontrolprøver blev gennemgået for kvalitetskontrol herunder: i) PCR uden skabelon, ii) PCR på ren og steril svaberprøver i udvinding og fortynding løsning og iii) PCR på blandet udvinding og fortynding løsninger. Tabel 2 viser at alle negative kontrolprøver havde ≤118 total læser (gennemsnit af 29 sekvenser), primært fra Mycoplasma taxa, mens alle andre prøver analyseret viste betyder samlede læser af 10622.57 (±1211.34 standardafvigelse) og ingen Mycoplasma Læs bestået kvalitetskontrol af de vigtigste prøver.

Seksten prøver at hver stammer fra den samme afføringsprøve men gik gennem forskellige bibliotek forberedelse med forskellige omvendt barcoded primere blev anvendt som positiv kontrol. Disse 16 prøver indeholdt 8 med positive kulturer for Campylobacter, Salmonellaeller Shigella , der blev rapporteret af klinisk Mikrobiologi laboratorium, og 8, der blev rapporteret som havende en negativ kulturer. Et område plot på niveauet phyla er vist i figur 2. Prøver, der stammer fra den samme afføringsprøve men gik gennem forskellige bibliotek forberedelse med forskellige omvendt barcoded primere viser meget konsekvent relativ overflod (Mantel test mellem dubletter af phylum niveau taksonomiske relativ overflod værdier simuleret p-værdi = 1 x 10-04 baseret på 9999 replikater).

Vigtigste koordinater analyse (PCoA), hvilket reducerer dimensionalitet af input-data, blev brugt på UniFrac matrix til visuelt udforske prøve adskillelse og lighed. I figur 3A, er sekventeret prøver, der stammer fra den samme oprindelige afføringsprøve men gik gennem forskellige bibliotek forberedelse farvet det samme. Ja, dem er beliggende relativt tæt i PCoA plot (Mantel test mellem dubletter PC1 PC2 værdier simulerede p-værdi = 1e-04 baseret på 9999 replikater). Den gennemsnitlige oejeblikkelige unifrac beta mangfoldighed afstand mellem prøver i denne undersøgelse er desuden 0.706, mens den gennemsnitlige afstand mellem to dubletter er 0.235 (Wilcoxon rang summen test p-værdi = 4.205 x 10-11). Interessant, prøver, der var kultur positive for Campylobacter, Salmonellaeller Shigella enteropatogener viste signifikant forskellig PC1 værdier (Wilcoxon rang summen test p-værdi = 0.011) i forhold til prøver med negative kultur resultater. Figur 3B viser den samme PCoA plot, men nu prøver er farvet af den relative forekomst af proteobakterier. Prøver med høje proteobakterier overflod havde væsentligt anderledes PC1 værdier (Spearman korrelation r =-0.533, p-værdi = 0.000975). Disse resultater er konsistente med tidligere analyse af disse data, hvor indlagte patienter har dyb stigninger i taxa fra proteobakterier phylum1. Her viste vi, at PC1 er korreleret med proteobakterier overflod, med kultur positive prøver klyngedannelse for det meste på den ene side af PC1 akse og kultur negative prøver klyngedannelse for det meste på anden siden, sammen med de sunde prøver.

Figure 1
Figur 1 : Flowdiagram fra fecal prøver til relative mikrobielle overflod. 1) prøve håndtering: venstre, fækal prøverne er indsamlet i en steril vatpind tube. Vatpind stick størrelse er højrejusteret ved at skære det for at aktivere lukning af 2ml tube, og opbevaring. 2) DNA-ekstraktion: DNA er ekstraheret af direkte PCR kolonner-fri tilgang. 3) bibliotek forberedelse: venstre, 4 μL af ekstraherede DNA forstærkes med Forward/Reverse-indeks primere. Hver reverse primer indeholder en 12 base stregkode. Hver prøve er forstærket i tre eksemplarer. En 96-brønd plade indeholder 32 forskellige stregkoder. Højre, kombinere hver tredobbelt stregkode i et enkelt bind rør. En 96-brønd plade indeholder 96 forskellige stregkoder. 4) bibliotek kvantificering: øverste panel, screening for positive prøver, amplikoner blev opdaget på ethidiumbromid-farvede 1% agarosegel. Nederste panel, kvantificering af de positive amplikoner at nå equimolar koncentration af 500 ng amplikon fra hver prøve i et enkelt bibliotek pool. 5) bibliotek rensning: øverste panel, poolede biblioteket er gel udvindes for valg af størrelse og rensning. Nederste panel, bibliotek nøjagtige størrelse og koncentration måles. 6) sekventering: høj overførselshastighed sekventering af poolede biblioteket. 7) sequencing data er analyseret af en bioinformatic pipeline til 16S rRNA-amplikon mikrobiel økologi. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Konsekvent relativ overflod mellem prøver, der stammer fra den samme afføringsprøve men gik gennem forskellige bibliotek forberedelse. Taksonomiske relativ overflod på niveauet phylum er vist pr. sample som angivet. Relativ overflod er vist 16 fækal prøver fra indlagte patienter med mistænkt infektiøs diarré at hver gik gennem forskellige bibliotek forberedelse (Duplicate 1 og 2) med forskellige omvendt barcoded primere og 3 raske kontrolpersoner. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Fylogenetiske mangfoldighed viser konsistente resultater for prøver, der stammer fra den samme afføringsprøve men gik gennem forskellige bibliotek forberedelse. Vigtigste koordinater analyse (PCoA), der reducerer dimensionalitet af input-data blev brugt på UniFrac matrix til visuelt udforske prøve adskillelse og lighed. Afstanden mellem to stikprøver repræsenterer forskellen i deres microbiome sammensætning. (A) oejeblikkelige UniFrac PCoA plot. Hvert punkt repræsenterer en enkelt sekventeret stikprøve. Prøverne stammer fra den samme oprindelige afføringsprøve er farvet det samme. Prøver fra indlagte patienter med positiv skammel kultur rapporteret af klinisk Mikrobiologi1 er præget af kvadrater, Indlagte patienter med kultur negative i trekanter1og raske voksne fra en separat sekventering køre1 er markeret med fyldt i cirkler. (B) samme PCoA som i A, men prøver er nu farvet af deres relative forekomst af proteobakterier som angivet. Venligst klik her for at se en større version af dette tal.

Primer navn Primer sekvens Primer beskrivelse
Fremad primer AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' adapter sekvens - videresende primer pad - videresende primer linker - Forward primer
Omvendt indeks primer CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Vende supplement af 3' adapter sekvens - Golay stregkode - Reverse primer pad - Reverse primer linker - Reverse primer
Læs 1 sekventering primer TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Videresende primer pad - videresende primer linker - Forward primer
Læs 2 sekventering primer AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Vende primer pad - Reverse primer linker - Reverse primer
Indeks sekvens primer ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Omvendt supplement af reverse primer - Reverse supplement af reverse primer linker - Reverse supplement af reverse primer pad

Tabel 1: Primer liste.

Stikprøve Antallet af læser post
indledende kvalitetskontrol i
QIIME
PCR på ren svaberprøver i udvinding og fortynding løsning -1 118
PCR på ren svaberprøver i udvinding og fortynding løsning -2 39
PCR uden skabelon -1 0
PCR uden skabelon -2 0
PCR på udvinding og fortynding løsninger mix - 1 16
PCR på udvinding og fortynding løsninger mix - 2 0
Prøver (gennemsnit ± standardafvigelse) 10622.57 ± 1211.34

Tabel 2: Antal læsninger til negative kontroller og for fækal prøver.

Supplerende materiale 1: databehandling script. Venligst klik her for at downloade denne fil.

Supplerende materiale 2: tilknytningsfil. Venligst klik her for at downloade denne fil.

Supplerende materiale 3: Primer ordningen. Venligst klik her for at downloade denne fil.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16S rRNA-amplikon og metagenomics shotgun sekventering har vundet popularitet i klinisk Mikrobiologi programmer21,22,23. Disse teknikker er fordelagtige i deres øget evne til at fange bestemmelse og ikke-bestemmelse taxa, leverer data om den relative forekomst af patogene inokulum, og deres evne til at identificere flere netop en polymicrobial smitsomme fingerprint24. Fremskridt inden for microbiome forskning har genereret enorme mængder af data, der ikke er let sammenlignelige på grund af en mangel på sammenhæng i de forskellige tilgange. I de seneste år, har flere konsortier forsøgt at løse nogle af disse spørgsmål. Denne protokol følger lignende bibliotek forberedelse som jorden microbiome projekt (EMP). Tilføjet er imidlertid en detaljeret trinvis protokol til DNA-ekstraktion fra fecal prøver gennem analyser pipeline.

Tidligere, 16S rRNA sekventering er blevet brugt til at karakterisere de mikrobielle sammensætning mønstre af fækal prøver fra raske ikke indlagt forsøgspersoner og indlagte patienter med mistænkt infektiøs diarré og traditionelle kultur resultater. Resultaterne fra denne analyse viste, at indlagte patienter har dyb stigninger i taxa fra proteobakterier phylum1. Beskrevet her er en integreret protokol af bredt anvendte metoder til 16S rRNA gen-amplikon sekvensering bruger direkte PCR kolonner-fri tilgang, der var oprindeligt designet til udtrækning af plante DNA16. Denne tilgang kan effektivt og udtrække hurtigt god kvalitet amplificeret DNA biblioteker målretning V4 variable region af 16S rRNA gen fra et stort antal prøver egnet til høj overførselshastighed 16S rRNA sekvensering.

Da dette er en DNA-baseret sekventering metode, opnås data om både aerobe og anaerober mikrobielle samfund til stede i en individuel fækal prøve. Protokollen vedtaget de primere, der var oprindeligt designet15 mod regionen V4 af 16S rRNA-genet. Vigtigere, reverse forstærkning primer indeholder en tolv base stregkode sekvens, der understøtter pooling af op til 2,167 forskellige prøver i hver lane15. Den forreste forstærkning primer omfatter ni ekstra baser i regionen netværkskort, der understøtter parret ende sekventering sekventering platform25 (tabel 1 og supplerende materiale 3). Denne tilgang aktiveret håndtering af et bibliotek består af 250 fækal prøver, der blev sekventeret på én vognbane med en kørende dybde af 10622.57 ± 1211.34 (gennemsnit ± standardafvigelse) læser pr. prøve til en pris af ~ 30 dollars pr. prøve.

For at sikre kvalitetskontrol, foreslår vi at bruge følgende negative kontroller; i) PCR uden DNA skabelon, ii) PCR på DNA ekstraheret fra en ren steril vatpind, og iii) PCR på blandet udvinding og fortynding løsning. Vi anbefaler som positive kontroller, herunder prøver, der stammer fra den samme afføringsprøve men gik gennem forskellige bibliotek forberedelse med forskellige omvendt barcoded primere og prøver fra tidligere kører som intern kvalitetskontrol. At bemærke er andre valgfrie positiv kontrol anvendes disse microbiome måling standarder fastsat af NIST. Gennemsnitlige læser dækning for den negative kontrol er bemærkelsesværdigt lavere i forhold til de faktiske afføringsprøver (tabel 1) og bestod primært af Mycoplasma taxa. Vi viste yderligere konsekvens af sekventering resultaterne ved hjælp af prøver, der alle stammer fra den samme fecal materiale, men der gik gennem forskellige bibliotek forberedelse (figur 3). Dette resultat bekræfter også, at når du bruger vores integreret metode, der er ingen krydskontaminering mellem prøver.

I denne protokol indfører vi en integreret uniformerede, gennemførlige protokol for at analysere store mængder prøver. Denne protokol har til formål at guide forskere interesseret i at indlede brugen af 16S rRNA-amplikon sekventering i en robust, reproduktive, nem at bruge, billig, detaljerede vej fra fecal samling til dataanalyse, ved hjælp af vigtige kontrol. Bruger denne standardiserede detaljerede guidede protokol, kan minimere batch effekter og tillade mere sammenlignelige sekventering resultater mellem forskellige laboratorier.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Dette arbejde blev støttet i en del af programmet KERNEN (tilskud nr. 41/11), Israel Science Foundation (grant No. 908/15), og europæiske Crohns og Colitis organisation (ECCO).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
Guidede protokol for fækal mikrobielle karakterisering af 16S rRNA-amplikon sekventering
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter