Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Guidet protokoll for Fecal mikrobiell karakterisering av 16S rRNA-Amplicon sekvenser

doi: 10.3791/56845 Published: March 19, 2018

Summary

Dette manuskriptet beskriver detaljert standardisert protokollen høy gjennomstrømming 16S rRNA-amplicon sekvenser. Protokollen introduserer en integrert, uniformerte, mulig og rimelig-protokoll fra fecal eksemplar samlingen gjennom data analyser. Denne protokollen aktiverer analyse av store antall prøver med strenge standarder og flere kontroller.

Abstract

Den menneskelige tarmen microbiome spiller en sentral rolle i å beskytte celler fra skade, energi og næringsstoffer og fremme immunitet. Avvik fra det som regnes som en sunn bakterieflora komposisjon (dysbiosis) kan forringe vitale funksjoner fører til patologisk forhold. De senere og pågående forskningen har vært rettet mot karakterisering av assosiasjoner mellom mikrobiell komposisjon og helse og sykdom.

Fremskritt i høy gjennomstrømming sekvensering teknologi aktiverer karakteristikk av tarmen mikrobiell sammensetningen. Disse metodene omfatter 16S rRNA-amplicon sekvensering og hagle sekvensering. 16S rRNA-amplicon sekvensering brukes til profil taxonomical komposisjon, mens hagle sekvensering inneholder tilleggsinformasjon om genet spådommer og funksjonelle merknader. En fordel i bruke en målrettet sekvensering 16S rRNA genet variable regionen er vesentlig lavere kostnadene sammenlignet med hagle sekvensering. Sekvensen forskjeller i 16S rRNA genet brukes som et mikrobiell fingeravtrykk til å identifisere og telle ulike taxa i en enkelt prøve.

Store internasjonale arbeidet har engasjert standarder for 16S rRNA-amplicon sekvenser. Imidlertid rapporterer flere studier en vanlig kilde av variasjonen skyldes satsvise effekt. For å redusere denne effekten, uniformerte protokoller for eksempel innsamling, må behandling og sekvensering implementeres. Denne protokollen foreslår integrering av bredt brukt protokoller fra fecal eksemplar innsamling til data analyser. Denne protokollen inneholder en kolonne-fri, direkte PCR-tilnærming som gjør at samtidige håndtering og DNA utvinning av store antall fecal eksempler sammen med PCR forsterkning av regionen V4. I tillegg protokollen beskriver rørledningen analyse og gir et skript med den nyeste versjonen av QIIME (QIIME 2 versjon 2017.7.0 og DADA2). Denne trinnvise protokollen er rettet til å veilede dem som er interessert i å initiere bruken av 16S rRNA-amplicon sekvenser i en robust, reproduktive, brukervennlig, detaljert måte.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Konsentrert innsats har blitt gjort for bedre å forstå microbiome mangfold og overflod, som en del av fange forskjellen og likhetene mellom individer i sunn og patologiske forhold. Age2,3, geografi4, livsstil5,6og sykdom5 ble vist å være knyttet til sammensetningen av tarmen microbiome, men mange betingelser og populasjoner har ennå ikke fullt preget. Nylig har det blitt rapportert at microbiome kan endres i terapeutiske programmer7,8,9. Derfor er ekstra innsikt i forholdet mellom ulike fysiologiske forhold og mikrobiell sammensetningen første skritt mot optimalisering av potensielle modifikasjoner.

Tradisjonelle mikrobiell kultur metoder er begrenset av lav avkastning10,11, og er definert som en binær stat der en bakterier er tilstede i tarmen eller ikke. Høy gjennomstrømming DNA-baserte sekvensering har revolusjonert microbial ecology, slik at erobringen av alle medlemmer av mikrobielle samfunnet. Imidlertid lese sekvens lengde og kvalitet er fortsatt utfordringer til nøyaktig taksonomi tildeling12. Videre kan høy gjennomstrømming basert eksperimenter lide av satsvise effekter, der målinger påvirkes ikke-biologiske eller ikke-vitenskapelige variabler13. De siste årene, er flere programmer etablert for å studere den menneskelige microbiome, inkludert amerikanske Gut prosjektet, USA (US) Human Microbiome Project og Storbritannia (UK) MetaHIT prosjektet. Disse initiativene har generert store mengder data som ikke er lett sammenlignbare skyldes manglende samsvar i deres tilnærminger. En rekke internasjonale prosjekter som International Human Microbiome konsortiet, International Human Microbiome standarder prosjektet, og National Institute of Standards and Technology (NIST) forsøkte å løse noen av disse problemene14 , og utviklet standarder for microbiome målinger som bør aktivere oppnåelse av pålitelige reproduktive resultater. Beskrevet her er en integrert protokoll flere bredt brukte metodene15,16 for 16S rRNA høy gjennomstrømming sekvensering (16S-seq) starter fra fecal eksemplar samlingen gjennom data analyser. Protokollen beskriver en kolonne uten PCR tilnærming, opprinnelig designet for direkte ekstraksjon av DNA16, for å aktivere samtidig håndtering av store mengder fecal eksempler på relativt kort tid med høy kvalitet forsterket DNA for mål sekvensering av mikrobielle variable V4 regionen på en felles sekvensering plattform. Denne protokollen som mål å lede forskere interessert i å initiere bruken av 16S rRNA-amplicon sekvenser i en robust, reproduktive, brukervennlig, detaljert måte, viktige kontroller. Har en guidet og detaljert steg-for-trinn protokollen kan minimere satsvise effekt og dermed tillater mer sammenlignbart sekvensering resultater mellom laboratorier.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Etiske godkjenning for studien ble gitt av etikk for Sheba lokale forskning og alle metodene ble utført i henhold til relevante retningslinjer og regler. Protokollen mottok en tålmodig samtykke unntak fra den lokale Ethical Review Board, siden det fecal materialet som ble brukt var allerede sendt til mikrobiologi kjernen som en del av klinisk workup og uten pasienten opplysninger enn alder, kjønn og mikrobiell resultater. Skrevet, samtykke ble innhentet fra friske frivillige og institusjonelle anmeldelsen bord godkjent studien. Noen av eksemplene er allerede implementert i en tidligere analyse1.

1. sample håndtering

  1. Samle en ca 5 mm2 smøre (omtrent størrelsen på en blyantviskelær) fra en fersk fecal eksemplar med et sterilt vattpinnen i en test rør (se Tabell for materiale). Lagre alle vattpinner inneholder fecal samples ved-80 ° C innen 24 timer. Av fecal vattpinner kan forbli der før videre behandling.

2. DNA utvinning

  1. Tine utvinning og fortynning løsningene ved romtemperatur (se Tabell for materiale).
  2. Overføring av fecal vattpinnen i en tom 2 mL samling rør (se Tabell for materiale). Justere vattpinne pinne størrelsen ved å kutte den med en ren saks for å aktivere tube avslutning med minimum kryssforurensning. Legge til 250 μL utvinning løsning hver samling rør som inneholder fecal vattpinne og vortex å blande.
  3. Varme prøvene i 10 minutter i kokende vann badekar (95-100° C). Legge 250 μL fortynning løsning til hver prøve og vortex å blande.
  4. Lagre 2 mL rør som inneholder de utpakkede DNA og vattpinnen på 4 ° C.

3. PCR og biblioteket forberedelse

Hva 3.1 og 3.2, innarbeide en PCR-arbeidsstasjon som gir rene, mal og amplicon miljø.

  1. Etiketten primerne (tabell 1) ifølge deres strekkode. Fortynn hver primer i dobbel destillert vann (DDW) til en 50 μM konsentrasjon og butikk på 20 ° C.
  2. Bruke en 96-brønns plate for PCR reaksjoner. Hver plate kan inneholde 32 forskjellige prøver, som er kodet av 32 forskjellige indeks primere. Tine frem primer og 32 omvendt primerne ved romtemperatur og fortynne dem til 5 μM.
  3. Forberede PCR reaksjon mikser 100 reaksjoner (siste volum i hver brønn blir 20 µL) ved å blande 100 μL 5 μM frem primer, 1 mL 2 X PCR Master mix og 400 μL DDW. Sett 15 μL denne PCR blandingen i hver brønn (totalt 96). Tilsett 1 μL av hver 5 μM omvendt indekserte primer 3 forskjellige brønner (32 forskjellige primere i triplicates gir totalt 96).
  4. I en pre-PCR dedikert sone, betyr en ren benk mal og amplicon gratis, tilsett 4 μL av hver utdraget DNA-prøve reaksjon blandinger (hver utdraget DNA-prøve forsterkes i tre eksemplarer-32 samplinger 96-brønns plate).
  5. Kjøre PCR med følgende innstillinger: første denaturering av 94 ° C i 3 min; etterfulgt av 35 sykluser av rødsprit 94 ° c for 1 min, annealing ved 55 ° C for 1 min, og forlengelsen ved 72 ° C i 1 min; og en siste utvidelse ved 72 ° C i 10 min.
  6. En annen benk, som vil bli definert som en post-PCR dedikert sone, kombinere hver tre eksemplarer PCR-reaksjon inn i et enkelt volum rør (60 μL per prøve).
  7. For å vurdere kvaliteten på PCR amplicons, kjøre 4 μL av hver kombinert PCR reaksjon på en ethidium bromide-farget 1% agarose gel. Under UV bølgelengden til 260 nm, den positive amplicons vises i en forventet bandet størrelsen på 375-425 bp. Bare disse amplicons vil bli inkludert i de påfølgende trinnene.
    Merk: Hver prøve forsterkes i tre eksemplarer, betyr at hvert utvalg forsterkes i 3 forskjellige PCR reaksjoner. Ikke skalere opp.

4. biblioteket kvantifisering og rengjøring

  1. For å få en ekvimolare konsentrasjon pool av alle PCR prøver, kvantifisere hver amplicon av en double-strandet DNA (dsDNA kvantifisere reagens) fluorescerende nukleinsyre flekker (se Tabell for materiale), egnet for de samtidige kvantifiseringen av en stor mengden prøver.
    Merk: Siden størrelsen på amplicon er tvetydig, brukes det faktiske beløpet i nanograms laste en ekvimolare konsentrasjon.
  2. Kombiner 500 ng av hvert utvalg i et enkelt, sterile rør. Vortex å blande.
  3. Kjøre 200 μL av grupperte biblioteket på en Ethidium Bromide-farget 1% agarose gel. 375-425 bp bandene ekstraktet gel med en gel utvinning utstyr i henhold til produsentens instruksjoner (se Tabell for materiale) og elute gruppert biblioteket i 80 μL DDW.
    Merk: Gruppert biblioteket skal størrelse valgt å redusere ikke-spesifikk forsterkning produkter fra verten DNA.
  4. Måle siste biblioteket konsentrasjonen med en svært sensitive dsDNA oppdager kit i henhold til produsentens instruksjoner (se Tabell for materiale). Måle nøyaktig biblioteket størrelse ved hjelp av en svært følsom separasjon og analyse utstyr for DNA biblioteker i henhold til produsentens instruksjoner (se Tabell for materiale).

5. sekvensering

  1. Fortynne gruppert biblioteket 7 pm med tillegg av 20% kontroll biblioteket (se Tabell for materiale), i henhold til sekvensering maskin protokollen.
  2. Sekvensering lese bruk spesialdesignet primer som er gratis for V4 forsterkning primerne (se tabell 1).
  3. Bruk en tredje tilpasset designet sekvensering primer som leser strekkode i en syklus (se tabell 1) og genererer sammen-end leser 175 baser i lengde i hver retning, i henhold til produsentens spesifikasjoner.
  4. Kjøre sekvensering maskinen og få FASTQ filer i henhold til produsentens protokollen.

6. databehandling

  1. Sy sammen og overlappende sammen-end FASTQ filene i en data konservering rørledning implementert i QIIME 2 versjon 2017.7.017. Demultiplex leser etter eksempel bestemt strekkoder.
  2. Bruk DADA218 for kvalitetskontroll og rekkefølgen variant (SVs) oppdagelsen. AVKORT leser på 13 baser fra 3 slutten og 15 baser fra 5 til slutt Forkast leser med mer enn 2 forventet feil. Identifisere og fjerne chimeras med metoden konsensus-chimeras oppdages i prøver individuelt og sekvenser funnet chimeric på en tilstrekkelig brøkdel av prøvene er fjernet.
  3. Utføre SVs taksonomisk klassifikasjon ved hjelp av en Naive Bayes utstyrt klassifiserer, trent på August 2013 99% identitet Greengenes database6, for 175 lenge leser og forover/bakover primer sett.
  4. Rarefy alle prøver til dyp 2,146 sekvenser.
  5. Bruk Unweighted UniFrac for måling av β-mangfold (mellom eksempel mangfold19,20) på rarefied prøvene, for å unngå en sample størrelse effekt.
  6. Bruke resulterende avstand matrix utføre en rektor koordinater analyse (PCoA).
    Merk: Databehandling skript og kartlegging filene leveres som supplerende materiale (supplerende materiale 1 og 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En skjematisk illustrasjon av protokollen er vist i figur 1.

Prospektivt har vi samlet avføringsprøver fra hospitaliserte pasienter med mistenkt smittsomme diaré. Disse prøvene ble sendt til klinisk mikrobiologi laboratoriet ved Sheba Medical Center mellom februar og mai 2015, som ble beskrevet tidligere1. Avføringsprøver ble utsatt til konvensjonelle mikrobiologisk kultur utført ved klinisk mikrobiologi Lab og bredt spekter høy gjennomstrømming 16S-seq parallelt. I tillegg var avføringsprøver fra friske voksne rekkefølge for sammenligning.

I denne analysen var var fokus på kvalitetskontroll av data og Vis representant resultatene av utdataene fra QIIME217. I utgangspunktet sekvensering resultater i 6 negativ kontroll prøver ble gjennomgått for kvalitetskontroll inkludert: i) PCR uten mal, ii) PCR på ren og sterile vattpinner i utvinning og fortynning løsning og iii) PCR på blandet utvinning og fortynning løsninger. Tabell 2 viser at alle negativ kontroll prøver hadde ≤118 totale leser (gjennomsnitt av 29 sekvenser), hovedsakelig fra Mycoplasma taxa, mens alle andre analyserte prøver viste betyr total leser 10622.57 (±1211.34 standardfeilen) og ingen Mycoplasma Les bestått kvalitetssikringen av de viktigste eksemplene.

Seksten prøver at hver stammer fra den samme avføringsprøve men gikk gjennom annet bibliotek forberedelse med forskjellige omvendt barcoded primere ble brukt som positive kontroller. 16 eksemplene inkludert 8 med positiv kulturer for Campylobacter, Salmonellaeller Shigella som ble rapportert av klinisk mikrobiologi lab og 8 som ble rapportert å ha negative kulturer. En området tomten på stamtreet nivå er vist i figur 2. Prøver som stammer fra den samme avføringsprøve men gikk gjennom annet bibliotek forberedelse med forskjellige omvendt barcoded primere Vis veldig konsekvente relative overflod (Mantel test mellom duplikater av rekke nivå taksonomisk relative overflod verdier simulert p-verdien = 1 x 10-04 basert på 9999 gjentak).

Viktigste koordinater analyse (PCoA), noe som reduserer dimensionality inndataene, ble brukt på UniFrac matrix å visuelt utforske eksempel separasjon og likheten. I figur 3A, sekvensert prøver som stammer fra den samme opprinnelige avføringsprøve men gikk gjennom annet bibliotek forberedelse, vises det samme. De er faktisk ligger relativt tett i PCoA plottet (Mantel test mellom duplikater PC1 PC2 verdier simulert p-verdien = 1e-04 basert på 9999 gjentak). I tillegg gjennomsnittlig unweighted unifrac beta mangfold avstanden mellom eksemplene i denne studien er 0.706, mens den gjennomsnittlige avstanden mellom to duplikater er 0,235 (Diversified rang summen teste p-verdien = 4.205 x 10-11). Interessant, prøver som ble kultur positivt for Campylobacter, Salmonellaeller Shigella enteropathogens viste signifikant forskjellig PC1 verdier (Diversified rang summen teste p-verdien = 0,011) i forhold til utvalg negative kultur resultater. Figur 3B viser samme PCoA tomten men nå prøver er farget av den relative overfloden av Proteobacteria. Prøver med høye Proteobacteria overflod hadde signifikant forskjellig PC1 verdier (Spearman korrelasjon r =-0.533, p-verdien = 0.000975). Disse resultatene er konsistente med tidligere analyse av disse dataene, der pasienter på sykehus har grundig økninger i taxa fra Proteobacteria rekke1. Her viste vi at PC1 er korrelert med Proteobacteria overflod, med kultur positiv prøver klynging hovedsakelig på den ene siden av PC1 akse og kultur negative prøvene klynging hovedsakelig på den andre siden, sammen med sunn prøvene.

Figure 1
Figur 1 : Flytskjema fra fecal prøver til relative mikrobiell overflod. 1) eksempel håndtering: venstre, fecal prøver er samlet i et sterilt vattpinne rør. Vattpinne pinne størrelsen justeres riktig, ved å klippe det for å aktivere nedleggelsen av 2ml tube og lagring. 2) DNA utvinning: DNA trekkes direkte PCR kolonner-fri tilnærming. 3) biblioteket forberedelse: venstre, 4 μL utdraget DNA forsterkes med forover/revers-indeks primere. Hver omvendt primer inneholder en 12 base strekkode. Hvert utvalg forsterkes i tre eksemplarer. En 96-brønns plate inneholder 32 forskjellige strekkoder. Høyre, kombinere hver strekkode tre eksemplarer i et enkelt volum rør. En 96-brønns plate inneholder 96 forskjellige strekkoder. 4) biblioteket kvantifisering: øvre panel, screening for positiv prøver, amplicons ble funnet på Ethidium Bromide-farget 1% agarose gel. Nedre panel, kvantifisering av den positive amplicons å nå ekvimolare konsentrasjon av 500 ng amplicon fra hver prøve i et enkelt bibliotek basseng. 5) biblioteket rensing: øvre panel, gruppert biblioteket er gel utdraget for størrelse og rensing. Nedre panel, biblioteket nøyaktig størrelse og konsentrasjon måles. 6) sekvensering: høy gjennomstrømming sekvensering av grupperte biblioteket. 7) sekvensering dataene analyseres av bioinformatic pipeline for 16S rRNA-amplicon mikrobiell økologi. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Konsekvent relative overflod mellom eksempler som stammer fra den samme avføringsprøve men gikk gjennom annet bibliotek forberedelse. Taksonomisk relative overflod på rekke nivå vises per prøve som angitt. Relative overflod vises for 16 fecal prøver innhentet fra hospitaliserte pasienter med mistenkt smittsomme diaré at hver gikk gjennom annet bibliotek forberedelse (duplisere 1 og 2) med forskjellige omvendt barcoded primere og 3 sunn kontroller. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Phylogenetic mangfold vise konsekvent resultater for prøver som stammer fra den samme avføringsprøve men gikk gjennom annet bibliotek forberedelse. Viktigste koordinater analyse (PCoA) som reduserer dimensionality inndataene ble brukt på UniFrac matrix å visuelt utforske eksempel separasjon og likheten. Avstanden mellom to utvalgene representerer forskjellen i microbiome sammensetningen. (A) Unweighted UniFrac PCoA tegn. Hvert punkt representerer en enkelt sekvensert prøve. Prøver stammer fra den samme opprinnelige avføringsprøve er farget samme. Prøver fra hospitaliserte pasienter med positiv krakk kultur rapportert av klinisk mikrobiologi1 er preget av torg, hospitaliserte pasienter med kultur negative trekanter1og friske voksne fra en separat sekvensering kjøre1 er merket med utfylt sirkler. (B) samme PCoA som i A, men prøver er nå farget av deres relative overflod av Proteobacteria, som angitt. Klikk her for å se en større versjon av dette tallet.

Primer navn Primer sekvens Primer beskrivelse
Fremover primer AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' kort sekvens - videresende primer pad - videresende primer linker - fremover primer
Omvendt indeks primer CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Omvendt bemanning av 3 kort sekvens - Golay strekkode - omvendt primer pad - omvendt primer linker - omvendt primer
Les 1 sekvensering primer TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Videresend primer pad - videresende primer linker - fremover primer
Les 2 sekvensering primer AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Omvendt primer pad - omvendt primer linker - omvendt primer
Indeks sekvens primer ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Omvendt supplement omvendt primer - omvendt antall omvendt primer linker - omvendt supplement av omvendt primer pad

Tabell 1: Primer liste.

Eksempel Flere leser innlegg
første kvalitetskontroll i
QIIME
PCR på ren vattpinner i utvinning og fortynning løsning -1 118
PCR på ren vattpinner i utvinning og fortynning løsning -2 39
PCR uten mal -1 0
PCR uten mal -2 0
PCR på utvinning og fortynning løsninger mix - 1 16
PCR på utvinning og fortynning løsninger mix - 2 0
Eksempler (gjennomsnittlig ± standardfeilen) 10622.57 ± 1211.34

Tabell 2: Antall leseoperasjoner for negative kontroller og fecal prøver.

Supplerende materiale 1: databehandling scriptet Klikk her for å laste ned denne filen.

Supplerende materiale 2: Tilordningsfilen. Klikk her for å laste ned denne filen.

Supplerende materiale 3: Primer ordningen. Klikk her for å laste ned denne filen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16S rRNA-amplicon og metagenomics hagle sekvensering har vunnet popularitet i klinisk mikrobiologi programmer21,22,23. Disse teknikkene er fordelaktig i økt å fange culturable og ikke-culturable taxa, gir data om den relative overfloden av sykdomsfremkallende inoculum og deres evne til å identifisere mer presist en polymicrobial smittsomme fingeravtrykk24. Fremskritt innen microbiome forskning har generert store mengder data som ikke er lett sammenlignbare på grunn av konsistens i de ulike tilnærmingene. De siste årene har flere konsortier forsøkte å løse noen av disse problemene. Denne protokollen følger lignende biblioteket forberedelse som jorden microbiome prosjektet (EMP). Imidlertid er lagt en detaljert trinnvise protokoll for DNA utvinning fra fecal prøver gjennom analyser rørledning.

Tidligere har 16S rRNA sekvensering blitt brukt som karakteriserer mikrobiell komposisjon mønstre av fecal prøver fra friske ikke-innlagt fag og hospitaliserte pasienter med mistenkt smittsomme diaré og tradisjonelle kultur resultater. Resultatene fra at analyse viste at pasienter på sykehus har grundig økninger i taxa fra Proteobacteria rekke1. Beskrevet her er en integrert protokoll bredt brukt metoder for 16S rRNA genet amplicon sekvensering med direkte PCR kolonner-fri tilnærming som opprinnelig ble utviklet for utvinning av DNA16. Denne tilnærmingen kan effektivt og ekstra raskt god kvalitet forsterket-DNA biblioteker målretting V4 variable regionen av 16S rRNA genet fra et stort antall prøver egnet for høy gjennomstrømming 16S rRNA sekvensering.

Dette er en DNA-baserte sekvensering metode, hentes data på både aerobes og anaerobes mikrobielle samfunn i en individuell fecal eksemplar. Protokollen vedtatt primerne som var opprinnelig designet15 mot V4 regionen 16S rRNA genet. Viktigere, omvendt forsterkning primer inneholder en tolv base strekkode sekvens som støtter av opptil 2,167 forskjellige prøver hver lane15. Fremover forsterkning primer inneholder ni ekstra baser i regionen kort som støtter sammen-end sekvensering på sekvensering plattform25 (tabell 1 og supplerende materiale 3). Denne tilnærmingen aktivert håndtere et bibliotek består av 250 fecal prøver som ble sekvensert på ett kjørefelt med en kjører dybde på 10622.57 ± 1211.34 (gjennomsnittlig ± standardfeilen) leser per eksempel til en kostnad av ~ 30 dollar per prøve.

For å sikre kvalitetskontroll, foreslår vi at du bruker følgende negative kontroller; i) PCR uten DNA mal, ii) PCR på DNA Hentet fra en ren sterilt vattpinne og iii) PCR på blandet utvinning og fortynning løsning. Som for positiv kontroller anbefaler vi inkludert som stammer fra den samme avføringsprøve men gikk gjennom annet bibliotek forberedelser med forskjellige omvendt barcoded primere og eksempler fra forrige løp som interne kvalitetskontroll. Av notatet er andre valgfrie positiv kontroller brukes de microbiome måling standardene fra NIST. Gjennomsnittet leser dekning av negative kontrollene er bemerkelsesverdig lavere i forhold til de faktiske avføringsprøver (tabell 1) og besto hovedsakelig fra Mycoplasma taxa. Vi viste videre konsistensen av sekvensering resultatene utvalg som hver stammer fra det samme fecal materialet, men som gikk gjennom annet bibliotek forberedelse (Figur 3). Dette resultatet bekrefter også at når du bruker vår integrert metode, det er ingen krysskontaminering mellom eksempler.

I denne protokollen innføre vi en integrert uniformerte, mulig protokoll for å analysere mange eksempler. Denne protokollen som mål å lede forskere interessert i å initiere bruken av 16S rRNA-amplicon sekvenser i en robust, reproduktive, brukervennlig, rimelig, detaljert måte fra fecal samling å data analyser, viktige kontroller. Bruker denne standardisert detaljert guidede protokollen, kan minimere satsvise effekter og tillate mer sammenlignbart sekvensering resultater mellom forskjellige labs.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Dette arbeidet var støttes delvis av programmet-CORE (gir nei 41/11), Israel Science Foundation (grant nr 908/15) og europeiske Crohns og kolitt organisasjon (ECCO).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
Guidet protokoll for Fecal mikrobiell karakterisering av 16S rRNA-Amplicon sekvenser
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter