Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Руководствуясь протокол для фекальных микробиологических характеристик путем Sequencing 16S рРНК ампликонами

doi: 10.3791/56845 Published: March 19, 2018

Summary

Эта рукопись описывает подробный стандартизированный протокол высок объём 16S рРНК ампликонами последовательности. Протокол вводит комплексной, униформе, осуществимым и недорогой протокол, начиная от фекальных проб путем анализа данных. Этот протокол позволяет анализ большого числа проб с жестким стандартам и несколько элементов управления.

Abstract

Человека кишечная микрофлора играет центральную роль в защите клеток от повреждения, в обработке энергии и питательных веществ и в содействии иммунитета. Отклонения от того, что считается здоровой микробиоты композиция (дисбактериоз) могут ухудшить жизненно важных функций, приводит к патологическим условий. Недавние и текущие исследовательские усилия были направлены на квалификацию ассоциаций между микробный состав и здоровье человека и болезни.

Достижения в технологии высокопроизводительного секвенирования позволяют характеристика микробный состав кишки. Эти методы включают в себя 16S рРНК ампликонами последовательность и последовательность ружье. 16S рРНК ампликонами последовательности используется для профилирования Таксономический состав, в то время как дробовик виртуализации предоставляет дополнительные сведения о Джин предсказания и функциональной заметки. Преимущество в использовании целевых последовательности метода переменной региона гена 16S рРНК является его значительно более низкой стоимости, по сравнению с ружьем последовательности. Различия последовательности гена 16S рРНК используются как микробных отпечатков пальцев для идентификации и количественной оценки различных таксонов в индивидуальный образец.

Крупные международные усилия привлекаются стандартов для 16S рРНК ампликонами последовательности. Однако несколько исследований сообщают общий источник изменения, вызванные пакетного эффектом. Чтобы свести к минимуму этот эффект, силовых протоколы для сбора, обработки и последовательности должен быть реализован. Этот протокол предлагает интеграцию широко используемых протоколов, начиная от фекальных проб для анализа данных. Этот протокол включает в себя столбец бесплатно, прямой ПЦР подход, который позволяет одновременной обработки и экстракции ДНК большого количества фекальных проб, наряду с амплификации PCR V4 региона. Кроме того протокол описывает анализ конвейера и предоставляет сценарий, используя последнюю версию QIIME (QIIME 2 версия 2017.7.0 и DADA2). Этот шаг за шагом протокол предназначен для тех, кто заинтересован в инициировании использование 16S рРНК ампликонами последовательности в устойчивый, репродуктивной, простой в использовании, подробное руководство.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Концентрированные усилия лучше понять разнообразие микрофлора и изобилия, как еще один аспект захвата различия и сходства между людьми в условиях здоровой и патологические. Возраст2,3, география4, образ жизни5,6, болезни5 были продемонстрированы и ассоциироваться с составом микрофлора кишечника, но многие условия и население еще не были полностью характеризуется. Недавно сообщалось, что микрофлора может быть изменено для терапевтического применения7,8,9. Таким образом дополнительные понять связь между различными физиологическими условиями и микробный состав является первым шагом на пути оптимизации потенциальных будущих изменений.

Методы традиционной микробные культуры ограничены низкой урожайности на10,11и задумана как двоичные государства, где бактерии либо представить в кишечнике или нет. Высокой пропускной способностью на основе ДНК последовательности революционизировало микробной экологии, позволяя захват всех членов сообщества микроорганизмов. Однако последовательности чтения длины и качества сохраняются значительные барьеры для точной таксономии назначения12. Кроме того высокой пропускной способностью на основе экспериментов могут страдать от последствий партии, где измерения подвержены переменных небиологических или научно-13. В последние годы были созданы несколько программ для изучения человеческого микрофлора, включая американский кишки проекта, проект человека микрофлора Соединенные Штаты (США) и Соединенное Королевство (Великобритания) MetaHIT проект. Эти инициативы породили огромное количество данных, которые не являются легко сопоставимы ввиду отсутствия согласованности в их подходах. Целый ряд международных проектов, таких как международного консорциума по микрофлора человека, стандарты микрофлора человека международного проекта и Национальный институт стандартов и технологий США (NIST) пытался решить некоторые из этих вопросов14 и разработал стандарты для измерения микрофлора, которые должны позволить достижение надежного репродуктивного результатов. Описанные здесь — это интегрированный протокол несколько широко используются методы,1516 для 16S рРНК высокопроизводительного секвенирования (16S-seq) начиная от фекальных проб через анализ данных. Протокол описывает столбец бесплатно ПЦР подход, первоначально предназначенные для прямого извлечения завода ДНК16, возможность одновременной обработки большого количества фекальных проб в относительно короткие сроки с высоким качеством усиленный ДНК для целевых секвенирование микробной переменной региона V4 на общей платформе виртуализации. Этот протокол направлен на руководство ученых, заинтересованных в инициировании использование 16S рРНК ампликонами последовательности образом надежные, репродуктивной, простой в использовании, подробную, используя важных элементов управления. С гидом и подробно шаг за шагом протокол может свести к минимуму эффект партии и таким образом позволит более сопоставимые результаты секвенирования между лабораториями.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Этические утверждения для изучения местного комитета по этике Шеба исследований и все методы были исполнены в соответствии с соответствующих руководящих принципов и правил. Протокол получил исключение согласия пациента от местных этические Наблюдательный Совет, с фекалии, которые были использованы были уже представлены в микробиологии основной в рамках клинических реакционной и без личной информации пациента кроме возраста, Пол и микробиологических результатов. Автор, информированное согласие было получено от здоровых добровольцев и институциональных Наблюдательный Совет одобрил исследование. Некоторые из этих образцов уже были включены в предыдущий анализ1.

1. Пример обработки

  1. Собрать примерно 5 мазка2 мм (примерно размер карандашной резинки) из свежих фекальных образца стерильным тампоном в тесте трубки (см. Таблицу материалы). Храните все мазки, содержащие фекальных проб-80 ° c в течение 24 ч. Фекальный тампоны могут оставаться там до дальнейшей обработки.

2. ДНК добыча

  1. Оттепель добычи и разбавления решения при комнатной температуре (см. Таблицу материалы).
  2. Передача, фекальные тампоном в коллекцию пустого 2 мл трубки (см. Таблицу материалы). Отрегулируйте размер палку тампоном, резки его с помощью чистой ножницы для включения закрытия трубу с минимальным перекрестное загрязнение. Добавьте 250 мкл раствора извлечения каждой коллекции трубка, содержащая фекальных тампоном и вихревой смешивать.
  3. Образцы для 10 мин на кипящей водяной бане нагреть (95 – 100° C). Добавьте 250 мкл раствора разбавления каждого образца и вихревой смешивать.
  4. Хранить 2 мл пробирки, содержащие ДНК и тампоном на 4 ° C.

3. ПЦР и подготовка библиотеки

Для шагов 3.1 и 3.2 работают в ПЦР рабочую станцию, которая обеспечивает чистый, шаблон и amplicon свободной среде.

  1. Грунтовки (Таблица 1) согласно их штрих-кода ярлык. Разбавить каждый грунт в двойной дистиллированной воде (DDW) до 50 мкм концентрации и хранить при-20 ° C.
  2. Используйте 96-луночных пластины для реакций PCR. Каждая пластина может содержать 32 различных образцов, которые помечены на 32 разных индекс грунтовки. Оттепель вперед грунтовка и 32 обратный грунты при комнатной температуре и их разбавляют до 5 мкм.
  3. Подготовка смеси реакции PCR для 100 реакций (окончательный объем в каждой скважине будет 20 мкл) путем смешивания 100 мкл 5 мкм вперед грунт, 1 мл 2 X ПЦР Мастер микс и 400 мкл DDW. Положите 15 мкл этой смеси ПЦР в каждой скважине (в общей сложности 96 скважин). Добавьте 1 мкл каждого обратного индексированных праймер 5 мкм до 3 различных скважин (32 различные грунтовки в triplicates дает в общей сложности 96 скважин).
  4. В pre ПЦР выделенную зону, означает чистый скамейке, шаблон и amplicon бесплатно, добавить 4 мкл каждого извлеченного образца ДНК реакция смеси (каждой извлеченной образец ДНК усиливается в трех экземплярах — 32 выборок на 96-луночных пластины).
  5. Запуск ПЦР со следующими параметрами: первоначальный денатурации 94 ° C 3 мин; После 35 циклов денатурации на 94 ° C за 1 мин, отжиг при температуре 55 ° C за 1 мин и расширение в 72 ° C в течение 1 мин; и окончательное расширение при 72 ° C для 10 мин.
  6. На лавочке другой, который будет определен как пост ПЦР выделенную зону, объединить каждого тройные реакции PCR в одном томе трубку (60 мкл на сэмпл).
  7. Чтобы оценить качество PCR ампликонами, запустите 4 мкл каждого комбинированные PCR реакции на ethidium окрашенных бромида 1% агарозном геле. При длине волны УФ 260 Нм, позитивные ампликонов появятся в размер ожидаемого диапазона 375 – 425 ВР. Только эти ампликонов будут включены в последующие шаги.
    Примечание: Каждый образец усиливается в трех экземплярах, означает, что каждый образец усиливается в 3 различных реакциях PCR. Не масштабировать до.

4. Библиотека количественной и очистка

  1. Для того чтобы получить пул эквимолярных концентрации всех образцов ПЦР, количественно каждый ампликон двойной мель ДНК (dsDNA количественно реагент) флуоресцентных нуклеиновых кислот пятна (см. Таблицу материалы), подходит для одновременного количественного определения большой количество образцов.
    Примечание: Поскольку диапазон размеров amplicon двусмысленно, фактический объем в нг используется для загрузки эквимолярных концентрации.
  2. Комбинат 500 нг каждого образца в единый, стерильных трубку. Вихрь смешивать.
  3. Запуск 200 мкл пуле библиотеки на геле агарозы 1% бромид Ethidium-витражи. Извлечение 375 – 425 bp полос из геля, используя набор извлечения геля согласно инструкциям производителя (см. Таблицу материалы) и элюировать Объединенные библиотеки в 80 мкл DDW.
    Примечание: Объединенные библиотеки должен быть размер выбранного уменьшить усиление неспецифической продуктов от хоста ДНК.
  4. Измерять концентрацию окончательный Библиотека, с помощью высокочувствительных dsDNA обнаружения комплект согласно инструкциям производителя (см. Таблицу материалы). Измерить размер Точная библиотеки с помощью высокочувствительных разделения и анализа kit для библиотек ДНК согласно инструкциям производителя (см. Таблицу материалы).

5. последовательность

  1. Разбавить Объединенные библиотеки до 7 вечера с добавлением 20% управления библиотеки (см. Таблицу материалы), согласно протоколу машины виртуализации.
  2. Для виртуализации, использование специально читать грунты, которые являются бесплатными для праймеров амплификации V4 (см. таблицу 1).
  3. Использование третьего пользовательских разработана последовательность грунт, который считывает штрих-код в дополнительный цикл (см. таблицу 1) и генерирует паре конец читает 175 баз в длину в каждом направлении, в соответствии со спецификациями изготовителя.
  4. Запустите машину секвенирования и получить файлы FASTQ по данным производителя протокол.

6. обработка данных

  1. Сшить и обработки перекрывающихся паре конец FASTQ файлов в конвейере курирование данных реализовано на QIIME 2 версия 2017.7.017. Демультиплексирования читает согласно образца конкретных штрих-кодов.
  2. Использование DADA218 для контроля качества и последовательности обнаружения вариант (СВС). Усечение читает на 13 баз из 3' конца и 15 баз от 5' конца, отменить читает с более чем 2 ожидаемые ошибки. Выявлять и устранять химер, используя метод консенсуса — химер обнаружены в пробах индивидуально, и последовательности, нашли химерных в достаточной доли образцы удаляются.
  3. Выполнять СВС таксономической классификации с использованием классификатора Байеса установлены, обучение на Август 2013 99% личность Greengenes базы данных6, 175 долго читает и реверса грунтовка набор.
  4. Разредить все образцы глубину 2146 последовательностей.
  5. Использование невзвешенных UniFrac для измерения β-разнообразия (между образца разнообразия19,20) на разреженной пробы, чтобы избежать эффекта размер выборки.
  6. Использование результирующей матрицы расстояние для выполнения анализа главных координаты (PCoA).
    Примечание: Файлы скрипта и сопоставления обработки данных предоставляются как дополнительный материал (дополнительный материал 1 и 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

На рисунке 1показано схематическое изображение протокола.

Проспективно мы собрали образцы стула от госпитализированных больных с подозрением инфекционной диарее. Эти образцы были представлены клинической лаборатории микробиологии в медицинский центр Шиба период с февраля по май 2015 года, как было описано выше1. Образцы стула были подвергнуты обычной Микробиологические культуры, выполнена в лаборатории клинической микробиологии и широкий диапазон высокопроизводительного 16S-seq параллельно. Кроме того образцы стула от здоровых взрослых были последовательности для сравнения.

В этом анализе основное внимание уделялось контролю качества данных и представитель результаты вывода, полученные от QIIME217. Первоначально, были рассмотрены последовательности результаты, достигнутые в 6 отрицательных контрольных образцов для контроля качества включая: i) ПЦР без шаблона, ii) ПЦР на чистой и стерильных тампонов в решении добыча и разрежения и iii) ПЦР на смешанные добычи и разбавления решения. Таблица 2 показывает, что все образцы отрицательный контроль ≤118 всего читает (в среднем 29 последовательностей), главным образом от микоплазмы таксонов, во время всех проанализированных проб показал среднее общее читает 10622.57 (±1211.34 стандартная ошибка) и не читать микоплазмы прошли контроль качества основных образцов.

Шестнадцать проб, что каждый возникла из того же образца стула, но прошел через различные библиотеки подготовки с различными обратный перепутываются грунтовки были использованы в качестве позитивных элементов. Эти 16 образцов включены 8 с позитивным культур для Campylobacter, сальмонелламиили шигеллезом , сообщили в лаборатории клинической микробиологии и 8, которые были указаны как имеющие негативные культур. Площадь участка на уровне типов показан на рисунке 2. Образцы, которые возникли от того же образца стула, но прошел через различные библиотеки подготовки с различными обратный перепутываются грунтовки показывают очень последователен относительное изобилие (каминные тест между дубликатами тип уровня таксономических относительного изобилия смоделированные значения p значение = 1 х 10-04 на основе 9999 реплицирует).

Основные координаты анализа (PCoA), который уменьшает размерность входных данных, был использован на матрице UniFrac визуально изучить пример разделения и подобия. В рисунке 3Aвиртуализированного образцы, которые возникли с же оригинального образца стула, но прошел через различные библиотеки подготовка окрашены то же самое. Действительно, те расположены сравнительно близко в PCoA заговоре (каминные тест между дубликатами PC1 PC2 значений имитируемых p значение = 1e-04, основанные на 9999 реплицирует). Кроме того, средняя невзвешенный unifrac бета разнообразия расстояние между образцов в этом исследовании является 0,706, в то время как среднее расстояние между двух дубликатов является 0.235 (Вилкоксон ранга сумма тест p значение = 4.205 x 10-11). Интересно, что образцы, которые были культуры позитивного для Campylobacter, сальмонелламиили Shigella enteropathogens показали значительно разные значения PC1 (Вилкоксон ранга сумма тест p значение = 0,011) по сравнению с образцами с отрицательные результаты культуры. Рисунок 3B показывает же PCoA сюжет, но теперь образцы окрашены относительное обилие бактерии по алфавиту. Образцы с высоким обилием бактерии по алфавиту имели существенно разные значения PC1 (ранговой корреляции r =-0.533, p значение = 0.000975). Эти результаты согласуются с предыдущим анализом данных, где госпитализированных пациентов имеют глубокие увеличивается в таксона от бактерии по алфавиту тип1. Здесь мы показали, что PC1 коррелирует с обилием бактерии по алфавиту, с положительных образцов культуры кластеризации главным образом на одной стороне образцов PC1 оси и культуре негативные кластеризации главным образом на другой стороне, вместе с здоровый образцы.

Figure 1
Рисунок 1 : Схема фекальных пробах для относительного изобилия микробной. 1) пробами: слева, фекальные образцы собраны в трубу стерильным тампоном. Справа размер палку тампоном корректируется путем разрезания его возможность закрытия 2-мл пробирку и хранения. 2) экстракции ДНК: ДНК добывается путем прямого ПЦР столбцы-подхода. 3) библиотека подготовка: слева, 4 мкл ДНК усиливается с праймерами вперед и реверс индекса. Каждый обратный Грунтовка содержит 12 базовых штрих. Каждый образец усиливается в трех экземплярах. 96-луночных табличка содержит 32 различных штрих-кодов. Справа объедините каждый штрих тройные трубка одного тома. 96-луночных табличка содержит 96 различных штрих-кодов. 4) библиотека количественной оценки: Верхняя панель, скрининг для положительных образцов, ампликонов были обнаружены на геле агарозы 1% бромид Ethidium-витражи. Нижняя панель, количественная оценка позитивных ампликонов достичь эквимолярных концентрацию 500 нг ампликон из каждого образца в одной библиотеке бассейн. 5) очистки библиотека: Верхняя панель, обобщённые библиотека является гель извлекается для выбора размера и очистки. Нижней панели, точный размер библиотеки и концентрация измеряется. 6) последовательности: высокопроизводительного секвенирования пуле библиотеки. 7) последовательности данных анализируется на конвейере bioinformatic 16S рРНК ампликонами микробной экологии. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : Последовательное относительное изобилие между образцами, которые возникли от того же образца стула, но прошел через различные библиотеки подготовка. Таксономический относительное изобилие на уровне Фила показана на сэмпл, как указано. Относительное обилие показан для 16 фекальных проб, полученных из госпитализированных больных с подозрением инфекционной диарее, каждый пошел через различные библиотеки подготовки (ксерокопия 1 и 2), с различными обратный перепутываются грунты и 3 здорового контроля. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 : Филогенетическом разнообразии показать согласованные результаты для образцов, которые возникли от того же образца стула, но прошел через различные библиотеки подготовка. Основные координаты анализ (PCoA), который уменьшает размерность входных данных был использован на матрице UniFrac визуально изучить пример разделения и подобия. Расстояние между двух образцов представляет собой разницу в их составе микрофлора. (A) невзвешенный UniFrac PCoA участок. Каждая точка представляет один последовательный образец. Образцы, возникла с же оригинального образца стула окрашены в то же самое. Образцы из госпитализированных больных положительные Табурет культуры сообщил клинической микробиологии1 помечены квадраты, госпитализированных больных с культурой отрицательным в треугольники1и здоровых взрослых с отдельной последовательности запуска1 , отмеченные, заполнены в кругах. (B) же PCoA как в A, но образцы теперь окрашены по их относительное обилие бактерии по алфавиту, как указано. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Грунтовка имя Грунтовка последовательность Грунтовка описание
Форвард грунтовка AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' адаптер последовательности - вперед грунтовка pad - вперед компоновщика грунт - вперед грунтовка
Обратный индекс грунт CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Отменить дополнения 3' адаптер последовательности - Голея штрих - обратный грунтовка pad - обратный грунтовка компоновщик - обратный грунтовка
Читать 1 Последовательность праймера TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Вперед грунтовка pad - вперед компоновщика грунт - вперед грунтовка
Читать 2 Последовательность праймера AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Обратный грунтовка pad - обратный грунтовка компоновщик - обратный грунтовка
Индекс последовательность праймера ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Отменить дополнения обратный грунт - обратный дополнения обратный грунтовка компоновщика - обратный дополнения обратный грунтовка колодки

Таблица 1: Список грунт.

Пример Количество читает пост
первоначальный контроль качества в
QIIME
PCR на чистой тампоны в добыче и разбавления раствора -1 118
PCR на чистой тампоны в решении добыча и разбавления -2 39
PCR без шаблона -1 0
PCR без шаблона -2 0
PCR на добыче и разбавления решения микс - 1 16
PCR на добычу и разбавления решения смесь - 2 0
Образцы (среднее ± стандартная ошибка) 10622.57 ± 1211.34

Таблица 2: Число операций чтения для отрицательных элементов управления и фекальных проб.

Дополнительный материал 1: script. обработки данных Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Дополнительный материал 2: сопоставление файла. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Дополнительный материал 3: схема грунтовка. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16S рРНК ампликонами и метагеномики ружье последовательности завоевали популярность в клинической микробиологии приложения21,22,23. Эти методы являются выгодным в их повышенная способность захватить culturable и не culturable таксонов, предоставление данных о относительное обилие болезнетворных посевным материалом и их способность определить более точно полимикробная инфекционных отпечатков пальцев24. Достижения в области исследований микрофлора породили огромное количество данных, которые не являются легко сопоставимы ввиду отсутствия согласованности в рамках различных подходов. В последние годы несколько консорциумов пытались решить некоторые из этих вопросов. Этот протокол следующим аналогичные библиотеки подготовка проекта микрофлора земли (EMP). Однако добавил является подробный пошаговый протокол для экстракции ДНК от фекальных проб через конвейер анализы.

Ранее 16S рРНК последовательности был использован для характеристики моделей микробного состава фекальных пробах из здоровых субъектов не госпитализирован и госпитализированных больных с подозрением инфекционной диарее и результаты традиционной культуры. Результаты этого анализа показали, что госпитализированных пациентов имеют глубокие увеличивается в таксона от бактерии по алфавиту тип1. Описанные здесь — это интегрированный протокол широко используемых методов для 16S рРНК гена ампликон виртуализации с помощью прямого ПЦР столбцы свободный подход, который был первоначально разработан для извлечения завода ДНК16. Этот подход может эффективно и быстро извлекать хорошего качества усиливается ДНК библиотеки, предназначенные для переменной региона V4 гена 16S рРНК от большого числа образцов, подходящих для виртуализации высок объём 16S рРНК.

Как это метод секвенирования ДНК, получены данные о аэробов и анаэробов микробных сообществ в индивидуальный образец фекальных. Грунты, которые были первоначально разработаны15 против регионе V4 гена 16S рРНК приняла протокол. Важно отметить, что обратный амплификации грунт содержат двенадцать базовых штрих последовательность, которая поддерживает объединение до 2167 различных образцов в каждом Лейн15. Грунтовка вперед усилители включает девять дополнительных баз в регионе адаптер, которые поддерживают паре конец последовательности на платформе виртуализации25 (Таблица 1 и 3 дополнительных материалов). Этот подход включена обработка библиотека состоит из 250 фекальных образцов, которые были упорядочены на одной полосе с Рабочая глубина 10622.57 ± 1211.34 (среднее ± стандартная ошибка) чтений на сэмпл стоимостью ~ 30 долларов за образец.

Для обеспечения контроля качества, мы рекомендуем использовать следующие негативные элементы управления; i) ПЦР без шаблона дна, ii) ПЦР на ДНК, извлеченные из чистой стерильным тампоном и iii) ПЦР на смешанные добыча и разбавления раствора. Что касается положительных элементов мы рекомендуем, включая образцы, которые возникли от того же образца стула, но прошел через различные библиотеки подготовки с различными обратный перепутываются грунты и образцы из предыдущих запусков как внутреннего контроля качества. Следует отметить другие необязательные положительные элементы для использования являются эти стандарты измерения микрофлора, предоставляемый NIST. Средний читает освещение для отрицательных элементов управления Замечательн ниже по сравнению с фактической табурет образцы (Таблица 1) и состояла главным образом из микоплазмы таксонов. Далее мы показали соответствие последовательности результатов, полученных с помощью образцов, которые каждый возникла из того же фекального материала, но которая прошла через различные библиотеки подготовки (рис. 3). Этот результат также подтверждает, что, при использовании нашего комплексного метода, нет никакого загрязнения между образцами.

В этом протоколе мы представляем интегрированной форме, возможно протокол для анализа большого числа проб. Этот протокол направлен на руководство ученых, заинтересованных в инициировании использование 16S рРНК ампликонами последовательности в надежной, репродуктивного, простой в использовании, Недорогие, подробный путь от фекальных коллекции для анализа данных, используя важных элементов управления. Используя этот стандартизированный протокол детальной экскурсии, может свести к минимуму последствия партии и позволяют более сопоставимые результаты секвенирования между различными лабораториями.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Эта работа частично поддержали программу-CORE (гранты № 41/11), Израиль научный фонд (Грант № 908/15) и Европейской крона и колит Организации (ЕСОП).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
Руководствуясь протокол для фекальных микробиологических характеристик путем Sequencing 16S рРНК ампликонами
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter