Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

16S rRNA Amplicon sıralama tarafından dışkı mikrobiyal karakterizasyonu için rehberli iletişim kuralı

doi: 10.3791/56845 Published: March 19, 2018

Summary

Bu el yazması yüksek üretilen iş 16S rRNA amplicon sıralama, detaylı bir standart protokolünü açıklar. Protokol dışkı örneği koleksiyonu veri analizleri ile başlayarak bir entegre, üniformalı, uygun ve ucuz protokol tanıttı. Bu protokol analiz örnekleri titiz standartları ile çok sayıda ve çeşitli denetimler sağlar.

Abstract

İnsan bağırsak microbiome hücreleri yaralanmalara karşı korumak, enerji ve besin işleme ve dokunulmazlık teşvik merkezi bir rol oynar. Sağlıklı microbiota kompozisyon (dysbiosis) olarak kabul edilir ne gelen sapmalar hayati fonksiyonları için patolojik koşulları önde gelen bozabilen. Son ve devam eden araştırma çabalarının mikrobiyal kompozisyon ve insan sağlığı ve hastalık arasındaki ilişkilendirmeleri karakterizasyonu doğru yönetmen var.

Yüksek işlem hacmi sıralama teknolojileri gelişmeler bağırsak mikrobiyal kompozisyon karakterizasyonu etkinleştirin. Bu yöntemler 16S rRNA amplicon sıralama ve av tüfeği sıralamanın içerir. 16s rRNA amplicon sıralama av tüfeği sıralama gen Öngörüler ve fonksiyonel ek açıklama hakkında ek bilgi sağlarken taxonomical kompozisyon, profil için kullanılır. 16S rRNA gen değişken bölge hedefli sıralama yöntemini kullanarak bir av tüfeği sıralama için karşılaştırıldığında önemli ölçüde daha düşük maliyet avantajdır. 16S rRNA gen farklılıkları sıra mikrobiyal parmak izi kadar tanımlamak ve farklı özellikleri tek tek bir örnek içinde ölçmek için kullanılır.

Büyük uluslararası çabalara 16S rRNA amplicon sıralama için standartlar kayıtlı. Ancak, çeşitli çalışmalarda ortak bir kaynaktan toplu etkisiyle neden varyasyon bildirin. Bu etki, üniformalı protokolleri için örnek koleksiyonu, en aza indirmek için işleme ve sıralamanın uygulanması gerekir. Bu iletişim kuralı veri analizleri için dışkı örneği koleksiyonundan başlayan genel olarak kullanılan protokolleri entegrasyonu öneriyor. Bu iletişim kuralını eşzamanlı kullanım ve DNA ekstraksiyon dışkı örnekleri, PCR güçlendirme V4 bölgesinin yanı sıra çok sayıda sağlar sütun-Alerjik, doğrudan-PCR yaklaşım içerir. Ayrıca, protokol analiz boru hattı açıklar ve QIIME (QIIME 2 yorum 2017.7.0 ve DADA2) en son sürümünü kullanarak bir komut dosyası sağlar. Adım adım bu protokolü ilgilenenler sağlam, üreme, kullanımı kolay ve ayrıntılı bir şekilde 16S rRNA amplicon sıralaması kullanımına başlatılıyor rehberlik etmek hedefleniyor.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Yoğun çabaları microbiome çeşitlilik ve bolluk, fark ve sağlıklı ve patolojik koşullarda bireyler arasındaki benzerlikler yakalamak bir diğer yönü olarak daha iyi anlamak için yapılmıştır. Yaş2,3, coğrafi konum4, yaşam tarzı5,6ve hastalık5 gut microbiome kompozisyon ile ilişkili olduğu gösterilmiştir, ancak birçok koşul ve nüfus henüz tam olarak henüz karakterize. Son zamanlarda microbiome için tedavi uygulamaları7,8,9değiştirilebilir bildirilmiştir. Bu nedenle, çeşitli fizyolojik şartlarda ve mikrobiyal kompozisyon ilişkisi içine ek fikir potansiyel gelecek değişiklikler duruma getirilmesi doğru ilk adımdır.

Geleneksel mikrobiyal kültür yöntemleri düşük verimleri10,11tarafından sınırlı olduğunu ve ikili bir devlet ya da nerede bir bakteri kavramsallaştırma gut ya da mevcut. Yüksek işlem hacmi DNA tabanlı sıralama mikrobiyal ekoloji, mikrobiyal toplumun tüm üyelerinin yakalama etkinleştirme devrim yarattı. Ancak, sıra uzunluğu ve kalite önemli engelleri doğru taksonomi atama12kalır okuyun. Ayrıca, yüksek üretilen iş tabanlı deneyler nerede ölçümleri biyolojik olmayan veya bilimsel olmayan değişkenler13tarafından etkilenen toplu etkileri muzdarip olabilir. Son yıllarda, çeşitli programlar insan microbiome Amerikan Gut proje, Amerika Birleşik Devletleri (ABD) insan Microbiome projesi ve Birleşik Krallık (UK) MetaHIT projesi de dahil olmak üzere, eğitim için kurulmuştur. Bu girişimler tutarlılık onların yaklaşımlar eksikliği nedeniyle kolayca karşılaştırılabilir değildir verileri oluşturmuş. Bazı bu sorunları14 yönelik olarak uluslararası insan Microbiome Konsorsiyumu, uluslararası insan Microbiome Standartları Projesi ve National Institute of Standards ve Technology (NIST) gibi uluslararası projeler çeşitli çalıştı ve geliştirilen güvenilir üreme sonuçlar ulaşılmasına izin vermesi gerekir microbiome ölçümleri için standartları. Burada açıklanan 16S rRNA yüksek üretilen iş (16S-seq) sıralama veri analizleri aracılığıyla dışkı örneği koleksiyonundan başlatmak için birkaç genel olarak kullanılan yöntemlerin15,16 entegre bir protokoldür. Bitki DNA16doğrudan çıkarma için tasarlanan bir sütun ücretsiz PCR yaklaşım, protokolünü açıklar, dışkı çok sayıda eşzamanlı işlemeyi etkinleştirmek IÇIN örnekleri nispeten kısa sürede yüksek kalitede DNA hedef için güçlendirilmiş mikrobiyal değişken V4 bölgenin ortak bir sıralama platformu üzerinde sıralanıyor. Bu iletişim kuralı bilim adamları sağlam, üreme, kullanımı kolay, detaylı bir şekilde 16S rRNA amplicon sıralaması kullanımına başlatılıyor baktılar önemli denetimlerini kullanma kılavuzu amaçlamaktadır. Bir rehber eşliğinde ve detaylı adım-tarafından adım protokolü olan toplu etkisini en aza indirmek ve böylece daha karşılaştırılabilir sıralama sonuçları labs arasında izin verir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Etik onay çalışma için Sheba yerel araştırma Etik Komitesi tarafından kabul edildi ve tüm yöntemleri ilgili kurallara ve düzenlemelere uygun şekilde gerçekleştirilmiştir. İletişim kuralı bir hastanın rızası özel durum alınan yerel etik inceleme kurulu, kullanılan fekal madde beri zaten Mikrobiyoloji çekirdek klinik testleri ve yaş dışında hasta bilgilerinizi olmayan bir parçası olarak sunuldu toplumsal cinsiyet ve mikrobiyal sonuçları. Yazılı, aydınlatılmış onam sağlıklı gönüllülerden elde edildi ve kurumsal inceleme kurulu çalışma onayladı. Bu örnekleri bazıları zaten bir önceki analiz1' dahil ettik.

1. örnek işleme

  1. Toplamak bir yaklaşık 5 mm2 smear (kabaca bir Silgi boyutunu) testinde steril bir bez ile taze bir dışkı örnekten tüp ( Tablo malzemelerigörmek). 24 saat içinde-80 ° C'de dışkı örnekleri içeren tüm temizleme bezi saklayın. Dışkı temizleme bezi daha fazla işleme kadar orada kalabilir.

2. DNA ekstraksiyon

  1. Oda sıcaklığında çıkarma ve seyreltme çözümleri çözülme ( Tablo malzemelerigörmek).
  2. Transferi dışkı çubukla bir boş 2 mL koleksiyonu içine tüp ( Tablo malzemelerigörmek). Pamuklu çubuk sopa boyutu kesim tarafından tüp kapatma minimum Çapraz bulaşma ile etkinleştirmek için temiz bir makas kullanarak ayarlayın. Ayıklama çözüm 250 μL dışkı çubukla ve girdap karışımı içeren her koleksiyon tüp ekleyin.
  3. Örnekleri 10 min kaynar su banyosu için ısı (95-100° C). Seyreltme çözüm 250 μL her örnek ve girdap karışımı ekleyin.
  4. Ayıklanan DNA ve 4 ° C'de çubukla içeren 2 mL tüpler depolamak

3. PCR ve Kütüphane hazırlık

3.1 ve 3.2 adımlar için şablon ve amplicon ücretsiz ortam temiz, sağlayan bir PCR iş istasyonu içinde çalışır.

  1. Astar (Tablo 1) göre onların barkod etiket. Çift Kişilik distile su (DDW) bir 50 mikron konsantrasyon ve mağaza-20 ° C'de her astar sulandırmak
  2. 96-şey plaka PCR reaksiyonları için kullanın. Her plaka 32 farklı dizin astar tarafından etiketlenir 32 farklı örnekler içerebilir. İleri astar ve 32 ters astar oda sıcaklığında erimek ve onları için 5 mikron sulandırmak.
  3. PCR reaksiyon karışımları (her iyi son hacim 20 μl olacaktır) 100 reaksiyonlar için 5 mikron ileri astar, 1 mL 2 X PCR Master mix ve 400 μL DDW 100 μL karıştırarak hazırlayın. Bu PCR karışımı 15 μL her kuyuda (96 kuyu toplam) koymak. Her 5 mikron ters dizin oluşturulmuş astar 1 μL (32 farklı Astar boyaları triplicates verir toplam 96 Wells) 3 farklı wells için ekleyin.
  4. Pre-PCR adanmış bölgesinde reaksiyon karışımları için her ayıklanan DNA örneğinin 4 μL eklemek şablonu ve amplicon ücretsiz, temiz bir Bank anlamı (ayıklanan her DNA örneği nüsha güçlendirilmiş — 32 örnek / 96-şey plaka).
  5. PCR aşağıdaki ayarlarla çalıştırın: ilk denatürasyon 94 ° c 3 dakika; denatürasyon 94 ° C'de 35 döngüleri için 1 dk 1 dk ve uzantısı için 1 dk 72 ° C'de için 55 ° C'de tavlama, ardından; ve 10 dk 72 ° C'de son bir uzantısı.
  6. Bir post-PCR özel bölge olarak tanımlanacağını belirtiyor, farklı bir bankta bir tek birim tüp (örnek başına 60 μL) içine onaylatılacak her PCR reaksiyon birleştirin.
  7. PCR amplicons kalitesini değerlendirmek için üzerinde bir etidyum bromür lekeli % 1'özel jel her kombine-PCR reaksiyon 4 μL çalıştırın. Altında UV dalga boyu 260 nm, pozitif amplicons 375-425 bp beklenen grup boyutunda görüntülenir. Sadece bu amplicons sonraki adımda eklenecektir.
    Not: Her bir örneği her örnek içinde 3 farklı PCR reaksiyonları güçlendirilmiş onaylatılacak, anlamda güçlendirilmiş. Büyütmek değil.

4. Kütüphane miktar ve Temizleme

  1. Bir ekimolar toplama havuzu tüm PCR örnekleri almak için her amplicon bir çift iplikçikli DNA tarafından ölçmek (dsDNA ölçmek reaktif) floresan nükleik asit leke (bkz. Tablo reçetesi) geniş eşzamanlı miktar için uygun örnekleri miktarı.
    Not: amplicon boyutu aralığını belirsiz olduğu için nanogram gerçek tutarı ekimolar bir konsantrasyon yüklemek için kullanılır.
  2. Bir tek, steril tüp içine her örneğinin birleştirmek 500 ng. Girdap karıştırmak için.
  3. Havuza alınan Kütüphanesi 200 μL etidyum bromür lekeli % 1'özel jel üzerinde çalıştırın. Bir jel ekstraksiyon kiti üreticinin talimatlarına göre kullanarak jel 375-425 bp bantları ayıklamak ( Tablo malzemelerigörmek) ve havuza alınan kütüphanede 80 μL DDW elute.
    Not: Havuza alınan Kütüphane boyutu belirsiz amplifikasyon ürünleri ana bilgisayardan DNA azaltmak için seçili olmalıdır.
  4. Son derece hassas bir dsDNA kiti üreticinin talimatlarına göre algılama kullanarak son Kütüphane konsantrasyon ölçmek ( Tablo malzemelerigörmek). Üreticinin yönergelerine göre DNA kitaplıkları için son derece hassas bir ayrılık ve analiz kiti kullanarak doğru kitaplık boyutunu ölçmek ( Tablo malzemelerigörmek).

5. sıralama

  1. 7 de % 20 Denetim Kitaplığı eklenmesi ile havuza alınan kitaplığına seyreltik (bkz. Tablo reçetesi) sıralama makine protokolüne göre.
  2. Sıralama için tasarlanmış kullanımı özel (bkz. Tablo 1) V4 amplifikasyon astar ücretsizdir astar okuyun.
  3. Ek bir barkoda okur kullanım üçüncü özel tasarlanmış sıralama astar (bkz. Tablo 1) döngüsü ve üreticinin belirtimlerine göre her yöne doğru uzunlukta eşleştirilmiş uç okuma 175 üslerinin oluşturur.
  4. Sıralama makine çalıştırabilir ve FASTQ dosyaları üreticinin protokolüne göre elde edilir.

6. veri işleme

  1. Birleştirmek ve QIIME 2 sürüm 2017.7.017uygulanan veri küratörlüğü potansiyel örtüşen eşleştirilmiş uç FASTQ dosyalarında işlem. Örnek belirli barkodlar göre okuma demultiplex.
  2. DADA218 kalite kontrol ve sıra varyant (SVs) algılaması için kullanabilir. Okuma 3' sonundan itibaren 13 üsleri ve 15 üsleri 5' uç, üzerinden atma ile 2'den fazla beklenen hataları okur kesecek. Belirlemek ve uzlaşma yöntemiyle chimeras kaldırmak — chimeras örnekleri ayrı ayrı algılanır ve örnekleri yeterli bir kısmını chimeric bulundu dizileri kaldırılır.
  3. SVs taksonomik sınıflandırma bir Naive Bayes donatılmış Sınıflandırıcısı kullanarak gerçekleştirmek, Ağustos 2013 eğitim % 99 kimliği Greengenes veritabanı6, 175 için uzun ayarla ileri/geri astar ve okur.
  4. 2.146 dizileri derinliği için tüm örneklerini rarefy.
  5. Unweighted UniFrac β-çeşitlilik seyreltilmiş örnekleri (örnek çeşitlilik19,20) arası ölçüm için bir örnek boyutu etkisi önlemek için kullanın.
  6. Bir asıl koordinatları (PCoA) çözümlemesi için elde edilen mesafe matris kullanın.
    Not: Veri işleme komut dosyası ve eşleme dosyaları ek malzeme (ek malzeme 1 ve 2) sağlanır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Şematik Protokolü'nün şekil 1' de gösterilen.

Biz prospektif şüpheli bulaşıcı ishal ile yatan hastalardan dışkı örneği toplanmıştır. Yukarıda açıklanan1olduğu gibi bu örnekleri Sheba Tıp Merkezi Şubat ve Mayıs 2015 yılları arasında Klinik Mikrobiyoloji Lab sunuldu. Dışkı örneği Klinik Mikrobiyoloji laboratuarında gerçekleştirilen geleneksel Mikrobiyolojik kültür ve geniş yüksek üretilen iş 16S-seq paralel tabi tutuldu. Buna ek olarak, sağlıklı yetişkin dışkı örnekleri karşılaştırma için sıralı.

Bu analizde, odak veri ve QIIME217elde edilen çıktının temsilcisi sonuçları göster Kalite kontrol oldu. Başlangıçta, kalite kontrol dahil olmak üzere 6 negatif kontrol örnekleri sıralama sonuçlar incelendi: i) şablonu olmadan PCR, PCR II) çıkarımı ve seyreltme çözüm temiz ve steril temizleme bezi üzerinde ve PCR III) karışık ayıklama ve seyreltme çözümler. Tablo 2 gösterir tüm negatif kontrol örnekleri ortalama toplam gösterdi ≤118 Toplam Okunma (ortalama 29 sıralarının), öncelikle tüm diğer örnekleri analiz ederken Mycoplasma takson vardı okur 10622.57 (±1211.34 standart hata) ve hiçbir Mycoplasma okuma Ana örnekleri kalite kontrolünü geçti.

Her aynı dışkı örneği kökenli ama went-den geçerek farklı kitaplık hazırlık farklı geriye doğru barkodlu astar ile on altı örnekleri olumlu denetimler olarak kullanılmıştır. 16 örnekleri 8 pozitif kültürlerle Campylobacter, Salmonellave Klinik Mikrobiyoloji laboratuarı ve negatif kültürlere sahip olarak rapor edilmiş 8 tarafından rapor edilmiştir Shigella dahil. Bir alan arsa kültürlenebilen düzeyinde Şekil 2' de gösterilmiştir. Çok tutarlı göreli bereket (şömine testi şube düzeyinde taksonomik göreli bereket kopyası arasında aynı dışkı örneği kökenli ama went-den geçerek farklı geriye doğru barkodlu astar hazırlıkla farklı kitaplık örnekleri göster değerleri simüle p-değeri 9999 çoğaltır dayalı 1 x 10-04 =).

Asıl koordinatları analiz (PCoA), dimensionality giriş veri azaltan UniFrac matris üzerinde görsel örnek ayırma ve benzerlik keşfetmek için kullanıldı. Şekil 3Aiçinde aynı özgün dışkı örneği kökenli, ancak farklı kitaplık hazırlama gitti sıralı örnekleri aynı renkte görünür. Nitekim, bu nispeten yakından PCoA mezarlığına bulunur (şömine test yinelemeleri PC1 PC2 arasında değerler simüle p-değeri = 1e-04 9999 çoğaltır dayalı). İki yineleme arasında ortalama mesafe 0.235 buna ek olarak, bu çalışmada örnekleri arasındaki ortalama unweighted unifrac beta çeşitlilik mesafe 0.706, iken (Wilcoxon rank sum testi p-değeri 4.205 10-11x =). İlginçtir, kültür Campylobacter, Salmonella, Shigella veya enteropathogens için olumlu olduğunu örnekler gösterdi önemli ölçüde farklı PC1 değerleri (Wilcoxon rank sum testi p-değeri 0.011 =) örnekleri ile karşılaştırıldığında Kültür sonuçları negatif. Şekil 3B aynı PCoA arsa gösterir ama şimdi örnekleri Proteobakteriler göreli bolluk tarafından renkli. Örnekleri yüksek bakteri bereket ile önemli ölçüde farklı PC1 değerler vardı (Spearman korelasyon r =-0.533, p-değeri = 0.000975). Bu sonuçları nerede hasta yatan derin artar takson Proteobakteriler şube1var önceki bu, veri çözümlemesi ile tutarlıdır. Burada PC1 kültür pozitif örnekleri çoğunlukla PC1 eksen ve kültür negatif örnekler çoğunlukla diğer tarafta, sağlıklı örnekleri ile birlikte kümeleme bir tarafındaki kümeleme ile bakteri bereket ile korelasyon gösterdi.

Figure 1
Resim 1 : Dışkı örneklerinden akış şeması göreli mikrobiyal bereket için. 1) örnek işleme: yaptı, dışkı örnekleri steril Pamuklu çubuk tüpte toplanır. Şu, pamuklu çubuk sopa boyutu 2 ml tüp ve depolama kapatılması etkinleştirmek için kesim tarafından ayarlanır. 2) DNA ekstraksiyon: DNA doğrudan PCR sütunları ücretsiz yaklaşım tarafından ayıklanır. 3) Kütüphane hazırlık: yaptı, ayıklanan DNA'ın 4 μL ileri/geri-dizin astar ile güçlendirilmiş. Her ters astar 12 temel barkod içerir. Her örnek nüsha güçlendirilmiş. 96-şey plaka 32 farklı barkod içerir. Şu, her barkod onaylatılacak tek toplu tüp içine birleştirmek. 96-şey plaka 96 farklı barkod içerir. 4) Kütüphane miktar: üst kapı aynası, olumlu örnekler için amplicons eleme üzerinde etidyum bromür lekeli % 1'özel jel algılandı. Alt paneli, 500 ng amplicon her örnekten ekimolar konsantrasyon tek kitaplık havuza ulaşmak için olumlu amplicons miktar. 5) Kütüphane arıtma: üst kapı aynası, havuza alınan kütüphanesidir boyutu seçimi ve arıtma için çıkarılan jel. Alt paneli, kitaplık tam boyutunu ve konsantrasyonu ölçülür. 6) sıralama: yüksek işlem hacmi sıralama havuza alınan Kütüphanesi. 7) sıralama veri 16S rRNA amplicon mikrobiyal ekoloji için bioinformatic potansiyel tarafından analiz edilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : Aynı dışkı örneği kökenli, ancak farklı kitaplık hazırlama gitti örnekleri arasında tutarlı göreli bereket. Taksonomik göreli bereket şube düzeyinde örnek belirtildiği şekilde gösterilir. Göreli bereket her farklı geriye doğru barkodlu astar ve 3 sağlıklı kontrol farklı kitaplık hazırlama (yinelenen 1 ve 2) gitti şüpheli bulaşıcı ishal ile yatan hastalardan elde edilen 16 dışkı örnekleri için gösterilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 : Filogenetik göstermek aynı dışkı örneği kökenli, ancak farklı kitaplık hazırlama gitti örnekleri için tutarlı sonuçlar. Dimensionality giriş veri azaltır asıl koordinatları analiz (PCoA) UniFrac matris üzerinde görsel örnek ayırma ve benzerlik keşfetmek için kullanıldı. İki örnek arasındaki mesafe onların microbiome kompozisyon farkı temsil eder. (A)Unweighted UniFrac PCoA arsa. Her noktası tek bir sıralı örnek temsil eder. Aynı orijinal dışkı örneği kökenli örnekleri aynı renkte görünür. Hastanede yatan hastalarda Klinik Mikrobiyoloji1 tarafından bildirilen olumlu dışkı kültürü ile örnekleri kareler, kültür negatif üçgenler1ve sağlıklı yetişkinlerden ayrı sıralama çalışma1 ile hastanede yatan hastalar tarafından işaretlenir çevrelerde dolu ile işaretlenir. Şimdi (B) içinde olarak aynı PCoA A ama örnekleri bakteri, onların göreceli bereket tarafından belirtildiği şekilde renklendirilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Astar adı Astar sıra Astar açıklama
İleri astar AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' adaptör serisi - astar pad ileri - ileri astar astar bağlayıcı - ileri
Ters dizin astar CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Tamamlayıcı 3' bağdaştırıcı dizisi - deniyordun barkod - ters astar pad - ters astar bağlayıcı - ters astar ters
Oku 1 sıralama astar TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Astar pad ileri - ileri astar astar bağlayıcı - ileri
Oku 2 sıralama astar AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Astar pad - ters astar bağlayıcı - ters astar ters
Dizin sıra astar ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Ters astar - ters astar bağlayıcı ters tamamlayıcı - ters Kompleman ters astar pad ters tamamlayıcı

Tablo 1: Astar listesi.

Örnek Sayıda defa okundu
ilk kalite kontrol
QIIME
PCR çıkarma ve seyreltme çözüm -1 temiz temizleme bezi üzerinde 118
PCR çıkarma ve seyreltme çözüm -2 temiz temizleme bezi üzerinde 39
Şablon -1 olmadan PCR 0
Şablon -2 olmadan PCR 0
PCR çıkarma ve seyreltme çözümleri Mix - 1 16
PCR çıkarma ve seyreltme çözümleri Mix - 2 0
Örnekleri (ortalama ± standart hata) 10622.57 ± 1211.34

Tablo 2: Okuma negatif denetimleri ve dışkı örnekleri sayısı.

Takıma giren madde 1: veri işleme filmi Bu dosyayı indirmek için buraya tıklayınız.

Takıma giren madde 2: eşleme dosyası. Bu dosyayı indirmek için buraya tıklayınız.

Takıma giren madde 3: astar düzeni. Bu dosyayı indirmek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16s rRNA-amplicon ve metagenomics av tüfeği sıralamanın Klinik Mikrobiyoloji uygulamaları21,22,23popülerlik kazanmıştır. Bu teknikler artan yeteneklerini patojen inoculum ve yeteneklerini daha doğrusu bir polymicrobial bulaşıcı belirlemek için göreli bolluk hakkında veri sağlayan culturable ve culturable takson yakalamak için avantajlı olan 24parmak izi. Microbiome araştırma alanında gelişmeler çeşitli yaklaşımlar tutarlılık eksikliği nedeniyle kolayca karşılaştırılabilir değildir verileri oluşturmuş. Son yıllarda, çeşitli konsorsiyumlar bazı bu sorunları gidermek için çalıştılar. Bu iletişim kuralı dünya microbiome Projesi (EMP) benzer Kütüphane hazırlık izler. Ancak, eklendi bir ayrıntılı adım adım dışkı örnekleri analizleri boru hattı üzerinden DNA çıkarılması için protokoldür.

Daha önce 16S rRNA sıralaması dışkı örnekleri sağlıklı olmayan hastaneye konular ve hasta yatan şüpheli bulaşıcı ishal olan ve geleneksel kültür sonuçlarına mikrobiyal kompozisyon desenlerini tanımlamak için kullanılmıştır. Bu analiz sonuçlarından derin artar hasta yatan takson Proteobakteriler şube1var gösterdi. Burada açıklanan biçimde tasarlanmış doğrudan PCR sütunları ücretsiz yaklaşım bitki DNA16çıkarma için kullanarak 16S rRNA gen amplicon sıralama için genel olarak kullanılan yöntemlerden entegre bir protokoldür. Bu yaklaşım etkili olabilir ve hızlı bir şekilde iyi kalite güçlendirilmiş-DNA kitaplıkları 16S rRNA gen örnekleri yüksek üretilen iş 16S rRNA sıralama için uygun, çok sayıda gelen V4 değişken bölge hedefleme ayıklayın.

Bu DNA tabanlı sıralama yöntemi olduğu için hem aerobes hem de anaerobik mikrobiyal topluluklar içinde bireysel bir dışkı örneği mevcut veriler elde edilir. Protokol V4 bölge 16S rRNA gen karşı ilk olarak tasarlanmış15 yaşından astar kabul etmiştir. Önemlisi, ters amplifikasyon astar her lane15ilâ 2,167 farklı örneklerinin havuzu oluşturma destekler bir on iki temel barkod sıra içerir. İleri amplifikasyon astar dokuz İlave Bazlar eşleştirilmiş uç sıralama sıralama platform25 tarihinde (Tablo 1 ve takıma giren madde 3) destek bağdaştırıcısı bölge içerir. Bu yaklaşım bir kütüphane işleme etkin 10622.57 ± 1211.34 (ortalama ± standart hata) okuma örnek örnek başına ~ 30 dolarlık bir maliyetle başına çalışan derinliği olan bir Lane'de sıralı 250 dışkı örnekleri oluşur.

Kalite kontrol sağlamak için aşağıdaki negatif denetimleri kullanmanızı öneririz; i) PCR DNA şablon, II olmadan) bir temiz Steril bez ve III--dan hulâsa DNA PCR) PCR üzerinde çıkarma ve seyreltme çözüm karışık. Pozitif denetimleri gelince aynı dışkı örneği kökenli, ancak farklı kitaplık hazırlık farklı geriye doğru barkodlu astar ve örnekleri ile önceki ishal--dan iç kalite kontrol went-den geçerek örnekleri de dahil olmak üzere öneririz. Belirtmek gerekirse kullanılmak üzere diğer isteğe bağlı olumlu NIST tarafından sağlanan bu microbiome ölçüm standartları denetimleridir. Ortalama okur kapsama negatif denetimler için gerçek dışkı örneği (Tablo 1) ile karşılaştırıldığında oldukça düşüktür ve öncelikle Mycoplasma takson oluşuyordu. Daha fazla her aynı fekal madde kökenli, ancak bu farklı kitaplık hazırlama (şekil 3) gitti numuneleri kullanılarak elde edilen sıralama sonuçları tutarlılığını gösterdik. Bu sonuç aynı zamanda bizim entegre yöntemini kullanırken, orada olduğunu, hiçbir Çapraz bulaşma örnekleri arasında doğrular.

Bu protokol için çok sayıda örnekleri analiz etmek için entegre bir üniformalı, uygun protokol tanıtmak. Bu iletişim kuralı bilim adamları sağlam, üreme, kullanımı kolay, ucuz, detaylı bir şekilde dışkı toplama veri analizleri, 16S rRNA amplicon sıralaması kullanımına başlatılıyor baktılar önemli denetimlerini kullanma kılavuzu amaçlamaktadır. Bu standart detaylı rehberli protokolünü kullanarak, toplu iş etkileri en aza indirmek ve daha karşılaştırılabilir sıralama sonuçları farklı labs arasında sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Bu eser kısmen (No 41/11 verir)-CORE programı, İsrail Bilim Vakfı (grant No 908/15), Avrupa Crohn ve kolit organizasyon (ECCO) tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
16S rRNA Amplicon sıralama tarafından dışkı mikrobiyal karakterizasyonu için rehberli iletişim kuralı
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter