Summary
Here, we present a detailed protocol to differentiate human pluripotent stem cells (hPSCs) into pancreas/duodenum homeobox protein 1+ (PDX1+) cells for the generation of pancreatic lineages based on the non-colony type monolayer growth of dissociated single cells. This method is suitable for producing homogenous hPSC-derived cells, genetic manipulation and screening.
Abstract
Human pluripotent stem cell (hPSC)-derived pancreatic cells are a promising cell source for regenerative medicine and a platform to study human developmental processes. Stepwise directed differentiation that recapitulates developmental processes is one of the major ways to generate pancreatic cells including pancreas/duodenum homeobox protein 1+ (PDX1+) pancreatic progenitor cells. Conventional protocols initiate the differentiation with small colonies shortly after the passage. However, in the state of colonies or aggregates, cells are prone to heterogeneities, which might hamper the differentiation to PDX1+ cells. Here, we present a detailed protocol to differentiate hPSCs into PDX1+ cells. The protocol consists of four steps and initiates the differentiation by seeding dissociated single cells. The induction of SOX17+ definitive endoderm cells was followed by the expression of two primitive gut tube markers, HNF1β and HNF4α, and eventual differentiation into PDX1+ cells. The present protocol provides easy handling and may improve and stabilize the differentiation efficiency of some hPSC lines that were previously found to differentiate inefficiently into endodermal lineages or PDX1+ cells.
Introduction
The pancreas mainly consists of exocrine and endocrine cells, and its dysfunction or overload causes several diseases, such as pancreatitis, diabetes and pancreatic cancer. To elucidate the pathogeny of pancreatopathy, it is necessary to analyze the developmental process and function of pancreatic cells. In addition, a stable cell supply with robust quality is required to establish cell/tissue supplementation therapy. Human pluripotent stem cell (hPSC)-derived pancreatic cells are a promising cell source for these purposes, and the differentiation protocol toward pancreatic cells has been intensively studied1,2,3,4. Recent advances in the in vitro generation of pancreatic β cells mimic the generation of β cells in adult human, and these cells show therapeutic efficacy upon implantation into diabetic model mice2,3. In addition, the analysis of β cells generated from the induced pluripotent stem cells (iPSCs) of healthy and type 1 diabetes patient donors revealed no functional differences including when under stress5. Moreover, disease phenotypes have been partially reproduced in induced pancreatic cells with patient-derived iPSCs or hPSCs harboring genetic mutations in the same site as the patients6,7.
To generate pancreatic cells from hPSCs, stepwise directed differentiation that recapitulates developmental processes is used. The pancreas is derived from the endoderm layer of the early embryo, which expresses sex determining region Y-box 17 (SOX17) and forkhead box A2 (FOXA2)8. Based on the mouse studies, the endodermal layer forms the primitive gut tube, which is marked by the expression of hepatocyte nuclear factor 1-beta (Hnf1β) and hepatocyte nuclear factor 4-alpha (Hnf4α). The primitive gut tube elongates and develops into the respiratory apparatus, digestive tract, and organs. After elongation, the posterior foregut area becomes the presumptive pancreatic region, as marked by the expression of the transcriptional factor pancreas/duodenum homeobox protein 1 (PDX1)8,9,10. The dorsal and ventral parts of the PDX1+ gut tube thicken to form pancreatic buds, which are marked by the co-expression of pancreas transcription factor 1 subunit alpha (PTF1A) and NK6 homeobox 1 (NKX6.1)8,11. This expression marks the morphological start of pancreatic organogenesis. Pancreatic endoderm cells, which are components of the pancreatic buds, form a branched tubular network of epithelial structures12 and eventually differentiate into exocrine and endocrine cells, including insulin-secreting β-cells and glucagon-secreting α-cells. Expression of PDX1 is detected first at the presumptive pancreatic region, which is then observed throughout the entire pancreatic development, and shows localization to β- and δ-cells9,13,14. Although the Pdx1+ cell area that does not express Ptf1a or Nkx6.1 differentiates into the gastric antrum, duodenum, extrahepatic bile duct and some intestinal cells at the middle to late stage of development in mice9, PDX1+ cells are considered the progenitors of the pancreas at the early developmental stage in humans.
Here, we present a detailed protocol to differentiate hPSCs into PDX1+ cells for the generation of pancreatic lineages. The protocol initiates differentiation by seeding dissociated single cells15,16,17. Generally, undifferentiated hPSCs are maintained as colonies or cell aggregates in suspension or in adhesion. As a result, most protocols initiate the differentiation shortly after passaging. However, in the state of colonies or aggregates, cells are prone to spatial and transcriptional heterogeneities18,19,20,21,22, which might hamper the first differentiation step toward definitive endoderm followed by inefficient differentiation to PDX1+ cells. The present protocol may offer easy handling to improve and stabilize the differentiation efficiency of some hPSC lines that were previously found to differentiate inefficiently to endodermal lineages and PDX1+ cells23,24,25.
Subscription Required. Please recommend JoVE to your librarian.
Protocol
Experiments using hPSCs were approved by the ethics committee of the Department of Medicine and Graduate School of Medicine, Kyoto University.
1. Preparation of Materials
NOTE: Prepare all media and reagents for cell culture in a sterile environment. Warm up base culture media to room temperature (RT) before use. Medium for differentiation is used within 6 h at RT. Details of the reagents are listed in Table of Materials.
- Differentiation (Figure 1A)
- Stage 1A medium: Transfer RPMI 1640 medium into a tube using a pipette. Add the serum-free supplement, activin A, CHIR99021, and Y-27632 to a concentration of 1x, 100 ng/mL, 3 μM and 10 μM, respectively.
- Stage 1B medium: Transfer RPMI 1640 medium into a tube using a pipette. Add the serum-free supplement, activin A and CHIR99021 to a concentration of 1x, 100 ng/mL, ≤1 μM, respectively.
NOTE: The concentration of CHIR99021 should be lower than in Stage 1A medium, and addition is not necessary, but it increases the cell number. - Stage 2 medium: Transfer Improved MEM (iMEM) medium into a tube using a pipette. Add the serum-free supplement and keratinocyte growth factor (KGF) to a concentration of 0.5x and 50 ng/mL, respectively.
- Stage 3 medium: Transfer iMEM medium into a tube using a pipette. Add the serum-free supplement, KGF, NOGGIN, 3-Keto-N-aminoethyl-N’-aminocaproyldihydrocinnamoyl cyclopamine (CYC) and 4-[(E)-2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]-benzoic acid (TTNPB) by pipette to concentrations of 0.5x, 50 ng/mL, 100 ng/mL, 0.5 μM and 10 nM, respectively.
- Flow cytometry (FCM)
- 1x Permeabilization/Wash buffer: Transfer water into a tube by a pipette. Add Permeabilization/Wash buffer by a pipette to a concentration of 1x.
- FCM blocking solution: Transfer 1x Permeabilization/Wash buffer into a tube by a pipette. Add donkey serum by a pipette to a concentration of 2% (vol/vol).
- Immunostaining
- Blocking solution: Transfer Dulbecco's Phosphate-Buffered Saline (DPBS) into a tube by a pipette. Add donkey serum and Triton X by pipette to concentrations of 5% (vol/vol) and 0.4% (vol/vol), respectively.
2. hPSC Differentiation to Posterior Foregut Cells/Pancreatic Progenitors (PDX1+ Cells)
NOTE: Conduct all procedures using sterile techniques. hPSCs are maintained on 6-well plates coated by a synthetic surface material for hPSCs with hPSC maintenance medium according to the manufacturer's instructions17,26. When cells reach 50-80% confluency (Stage 0) use them for differentiation.
- Prepare basement membrane matrix-coated plates.
- Transfer 6 mL of RPMI 1640 (4 °C) into a tube cooled to 4 °C on ice. Add 2 mg of basement membrane matrix (4 °C) with cooled 1 mL-pipette tips and mix well by gentle pipetting to make 0.33 mg/mL basement membrane matrix.
- Transfer 2 mL of diluted basement membrane matrix to each well of 6-well cell culture plates by a pipette. Place the plates at 37 °C for 60-90 min in an incubator. Afterward, keep the plates at RT until use (within 3 h).
- Seed the hPSCs and initiate differentiation to definitive endoderm (Stage 1A).
- Aspirate the used medium and add 2 mL of 0.5 mM ethylenediaminetetraacetic acid (EDTA) (RT) per well by pipette to wash the hPSCs cultured in the 6-well plates.
- Aspirate 0.5 mM EDTA and add 2 mL of 0.5 mM EDTA per well by pipette. Incubate the plates at 37 °C for 5 min.
- Aspirate 0.5 mM EDTA and add 1 mL of hPSC maintenance medium at RT supplemented with 10 μM Y-27632 per well by pipette. Pipette gently but quickly to blow off attached cells on the plates and to dissociate clumped cells into single cells. Do not bubble the cell suspension during pipetting.
- Transfer the cell suspension in a 50 mL centrifuge tube containing 4 mL of hPSC maintenance medium at RT supplemented with 10 μM Y-27632. Gently pipette the cell suspension.
- Count the cell number in the cell suspension using the Trypan Blue stain exclusion procedure.
- Mix 15 μL of cell suspension and 15 μL of Trypan Blue in a tube.
- Transfer 10 μL of the cell suspension diluted with Trypan Blue onto cell counting slides in duplicate by a 10 μL pipette.
- Count the cell number with an automatic cell counter and calculate the cell density in the cell suspension. Viability is usually >98%.
- Aliquot the cell suspension in a 50 mL centrifuge tube at 1-1.5 x 106 cells per well of 6-well plates (1-1.5 x 105 cells/cm2).
- Centrifuge the 50 mL tube at 200 x g at RT for 5 min.
- Aspirate the supernatant using a pipette and resuspend the cells with 1 mL of Stage 1A medium (RT) per well. Gently pipette the cell suspension and add another 1 mL of Stage 1A medium (total, 2 mL per well).
- Aspirate the diluted basement membrane matrix in the wells of the cell culture plates prepared in step 2.1.2 by a 1,000 μL pipette. Proceed to the next step immediately.
- Gently pipette the cell suspension in step 2.2.8 again. Immediately after mixing, transfer the cell suspension (2 mL) into each well of a 6-well plate. Cover the plate with an aluminum foil to protect the plate from light. Place the plate in the clean bench at RT for 10-15 min.
NOTE: Do not move the plate after seeding. - Gently place the plate into a 37 °C, 5% CO2 incubator (humidified atmosphere) and culture for 24 h.
NOTE: Do not shake the plate after seeding.
- Induce the differentiation into definitive endoderm (Stage 1B).
- Aspirate the used medium and add 2 mL of DPBS to the wells by pipette. Repeat the aspiration and addition of DPBS one time.
NOTE: To remove any dead cells from the monolayer, gently shake the plate before each aspiration. - Aspirate the used DPBS by a pipette and add 4 mL of Stage 1B medium (37 °C) per well. Gently place the plate into the 37 °C incubator (humidified atmosphere of 5% CO2) and culture for 48 h.
- Aspirate the used medium and add 2 mL of DPBS to the well by pipette. Repeat the aspiration and addition of DPBS one time.
NOTE: Remove the dead cells from the monolayer by gentle shaking before each aspiration. - Aspirate the used DPBS by pipette and add 4 mL of Stage 1B medium (37 °C) per well. Gently place the plate into the incubator (37 °C, humidified atmosphere of 5% CO2) and culture for 24 h.
- Aspirate the used medium and add 2 mL of DPBS to the wells by pipette. Repeat the aspiration and addition of DPBS one time.
- Induce the differentiation into the primitive gut tube (Stage 2).
- Aspirate the used medium and add 2 mL of DPBS to the well by pipette.
NOTE: Remove the dead cells from the monolayer by gentle shaking before each aspiration. - Aspirate the used DPBS by pipette and add 4 mL of Stage 2 medium (37 °C) per well. Place the plate into the incubator (37 °C, humidified atmosphere of 5% CO2) and culture for 4 days.
- Aspirate the used medium and add 2 mL of DPBS to the well by pipette.
- Induce the differentiation into PDX1+ cells (Stage 3).
- Aspirate the used medium and add 2 mL of DPBS to the well by pipette. Repeat the aspiration and addition of DPBS one time.
- Aspirate the used DPBS by pipette and add 4 mL of Stage 3 medium (37 °C) per well. Place the plate into the incubator (37 °C, humidified atmosphere of 5% CO2) and culture for 3 days.
- Induce the differentiation into pancreatic endocrine cells.
- Perform NKX6.1+ cell induction (Stage 4, for 8 days) followed by endocrine cell induction (Stage 5, for 12 days) with previously described protocols3,16,26. Characterize and validate the endocrine cell differentiation by immunostaining and quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) analysis.
NOTE: Refer to Toyoda et al.16 and Kimura et al.26 for detailed experimental procedures. Refer Table 1 for primer sequences used for qRT-PCR analysis.
- Perform NKX6.1+ cell induction (Stage 4, for 8 days) followed by endocrine cell induction (Stage 5, for 12 days) with previously described protocols3,16,26. Characterize and validate the endocrine cell differentiation by immunostaining and quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) analysis.
3. Flow Cytometry (FCM)
- Aspirate the used medium and add 2 mL of 0.5 mM EDTA to the well by pipette. Repeat the aspiration and addition of 0.5 mM EDTA one time.
NOTE: Shake the plate gently to remove any dead cells from the monolayer cells before each aspiration. - To dissociate the cells (approximately 3-6 × 106 cells per well), add 2 mL of 0.25% Trypsin containing 0.5 mM EDTA per well. Incubate the plates at 37 °C for 5-10 min.
- Pipette gently but quickly to dissociate clumped cells into single cells. Do not bubble the cell suspension during pipetting.
- Add 8-10 mL of base medium (RPMI 1640 or iMEM, RT) containing 0.5x serum-free supplement and 10 μM Y-27632 per well and mix the cell suspension. Transfer the cell suspension into a centrifuge tube.
- Centrifuge the tube at 300 x g at RT for 5 min.
- Aspirate the supernatant and resuspend the cells with 2 mL of 0.5 mM EDTA (RT). Gently pipette the cell suspension.
- Centrifuge the tube at 300 x g at RT for 5 min.
- Aspirate the supernatant and resuspend the cells with 100 μL of fixation and permeabilization buffer per 106 cells under a hood. Gently pipette the cell suspension under a hood. Keep the tube at RT for 30 min.
- Centrifuge the tube at 400 x g at RT for 5 min.
- Aspirate the supernatant under a hood and resuspend the cells with 500 μL FCM Blocking solution per 106 cells. Gently pipette the cell suspension. Keep the tube at RT for 30 min.
- Transfer 50 μL of the cell suspension to a tube (approximately 1 x 105 cells). Centrifuge the tube at 400 x g at RT for 5 min. Remove the supernatant and resuspend the cells with 100 μL of diluted primary antibody (see Table of Materials) in FCM blocking solution and incubate at 4 °C for >16 h.
- Centrifuge the tube at 400 x g at RT for 5 min. Remove the supernatant and resuspend the cells with 180 μL of 1x Perm/Wash buffer.
- Centrifuge the tube at 400 x g at RT for 5 min. Remove the supernatant and resuspend the cells with 100 μL of diluted secondary antibody (see Table of Materials) in FCM blocking solution. Incubate the cells at RT for 60 min or at 4 °C for >16 h with protection from light.
- Centrifuge the tube at 400 x g at RT for 5 min. Remove the supernatant and resuspend the cells with 180 μL of 1x Perm/Wash buffer.
- Centrifuge the tube at 400 x g at RT for 5 min. Remove the supernatant and resuspend the cells with 180 μL of 2% donkey serum in DPBS.
- Filter the cell suspension by transferring on a 5 mL round bottom polystyrene tube with a cell strainer (35 µm nylon mesh) and keep at 4 °C with protection from light until the analysis.
- Analyze a proportion of positively stained cells by a flow cytometer27.
4. Immunostaining
- Aspirate the used medium and add 2 mL of DPBS to the well by pipette. Repeat the aspiration and addition of DPBS one time.
NOTE: Gently shake the plate to remove any dead cells from the monolayer cells before each aspiration. - Add 2 mL of 4% paraformaldehyde (PFA) (4 °C) per well by pipette under a hood. Keep the plate at 4 °C for 20 min.
- Remove the PFA by pipette under a hood. Add 2 mL of DPBS at RT to the well by pipette under a hood. Repeat the aspiration and addition of DPBS one time.
- Add 2 mL of blocking solution per well and keep the plate at RT for 30 min.
- Aspirate the used solution and add 1 mL of primary antibody (see Table of Materials) in blocking solution per well. Incubate at RT for 60 min or at 4 °C for >16 h.
- Aspirate the used solution, add 2 mL of DPBS containing 0.4% Triton X-100 and incubate at RT for 10 min. Repeat the aspiration, addition of solution and incubation one time.
- Aspirate the used solution and add 1 mL of secondary antibody (see Table of Materials) in blocking solution per well. Incubate at RT for 60 min with protection from light.
- Aspirate the used solution, add 2 mL of DPBS containing 0.4% Triton X-100 (RT) and incubate at RT for 5 min with protection from light. Repeat the aspiration, addition of solution and incubation two times.
- Take micrographs to examine the differentiation efficiency under a fluorescence microscope28.
Subscription Required. Please recommend JoVE to your librarian.
Representative Results
Propagating hiPSCs (585A129,30) are condensed and form a homogenous monolayer (Figure 1B) that is suitable for differentiation. Undifferentiated hiPSCs (Stage 0) are dissociated and re-seeded as single cells at low cell densities (1-1.5 x 105 cells/cm2). Within 1 h, the cells are attached to the plate and start to show protrusion. On day 1, the cells are proliferated and well distributed to cover 80-90% of the surface area. During Stage 1B, the media appear cloudy due to dead cells. The removal of dead cells is critical for highly efficient differentiation since dead cells likely disturb the survival and differentiation of cells lying underneath. On days 3-4, cells form a homogenous monolayer sheet that can be described as a cobblestone appearance. At this point, most cells stop expressing sex determining region Y-box 2 (SOX2), a marker for undifferentiated cells, and instead express a definitive endoderm marker, SOX17, at more than 90% (Figure 2A and B). Most SOX17+ cells express FOXA2 (Figure 2A). Starting the differentiation with an inappropriate cell density compromises the differentiation efficiency at this step (Figure 3). At Stages 2 and 3, cell death relaxes, and the used medium is not as cloudy as it is in Stage 1B. Cells express the primitive gut tube markers HNF1β and HNF4α (Figure 2C) and eventually express a posterior foregut/pancreatic progenitor marker, PDX1, at more than 90% (Figure 2D and E). The PDX1+ cell induction is reproducible in another hiPSC line, 1231A3 31, and an hESC line, KhES-3 32 (Figure 4). qRT-PCR results of the mRNA expression of stage markers were consistent with immunostaining (Figure 5A). The mRNA expression of PDX1 is evident at Stage 3 and substantially increases afterword.
PDX1+ cells at early developmental stages have the potential to differentiate into not only pancreatic cells but also gastric antrum, duodenum, extrahepatic bile duct and a part of the intestine 9. The differentiation potential of in vitro generated PDX1+ cells to pancreatic cells can be assessed by extended culture with reported protocols for pancreatic endoderm and pancreatic endocrine cells3,16,26. The expressions of a pancreatic endoderm marker, NKX6.1, and two pancreatic endocrine markers, INSULIN, and GLUCAGON, were observed on days 19 (Stage 4) and 31 (Stage 5), respectively (Figure 5).
Figure 1: Representative appearance of cells under stepwise differentiation. (A) A scheme of directed differentiation from hPSCs to pancreatic lineages. Numbers in parentheses indicate concentrations (units are written below). (B) Representative bright field micrographs of hiPSCs at key steps of the differentiation culture. 585A1 hiPSCs were dissociated as single cells and induced to differentiate into definitive endoderm, primitive gut tube and posterior foregut/pancreatic progenitor. The lower panels are enlarged views of the upper panels. RPMI, RPMI 1640; AA, activin A (ng/mL); CH, CHIR99021 (μM); KGF (ng/mL); NOG, NOGGIN (ng/mL); CYC, 3-Keto-N-aminoethyl-N’-aminocaproyldihydrocinnamoyl cyclopamine (μM); TTNPB, 4-[(E)-2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]-benzoic acid (nM). Scale bars = 300 μm. Please click here to view a larger version of this figure.
Figure 2: Representative induction toward pancreatic lineages from hiPSCs. (A) The proportion of SOX2-SOX17+ cells analyzed by flow cytometry before differentiation (Stage 0) and on day 4 (Stage 1B). Undifferentiated hiPSCs (SOX2+SOX17-) were differentiated into definitive endoderm (SOX2-SOX17+). Most SOX17+ cells co-expressed FOXA2. (B) Representative immunofluorescent micrographs on day 4 (Stage 1B). The fixed cells were stained for SOX17 (green), SOX2 (red), and nuclei (blue). (C) Representative immunofluorescent micrographs on days 4 (Stage 1B) and 8 (Stage 2). The fixed cells were stained for HNF1β (green), HNF4α (red) and nuclei (blue). (D) The proportion of cells positive for PDX1, as analyzed by flow cytometry on days 4 (Stage 1B) and 11 (Stage 3). (E) Representative immunofluorescent micrographs of PDX1 (green) and nuclei (blue) on day 11 (Stage 3). Scale bars = 100 μm. Please click here to view a larger version of this figure.
Figure 3: Representative induction toward definitive endoderm initiated from different cell densities. (A) Representative bright field micrographs of cells 1 h after differentiation. hiPSCs were dissociated as single cells and induced to differentiate into definitive endoderm at different cell densities (1-50 x 104/cm2). The lower panels are enlarged views of the upper panels. (B) The proportion of SOX2-SOX17+ cells analyzed by flow cytometry before differentiation (Stage 0) and on day 4 (Stage 1B). (C) The proportion of PDX1+ cells analyzed by flow cytometry on days 8 (Stage 2) and 11 (Stage 3). Scale bars = 300 μm. Please click here to view a larger version of this figure.
Figure 4: Representative induction toward PDX1+ cells in hiPCSs and hESCs. An hiPSC line, 1231A3 (A), and an hESC line, KhES-3 (B), were differentiated to definitive endoderm and PDX1+ cells. The cell composition was analyzed by flow cytometry. The proportion of SOX2-SOX17+ cells was analyzed before differentiation (Stage 0) and on day 4 (Stage 1B). The proportion of PDX1+ cells was analyzed on days 8 (Stage 2) and 11 (Stage 3). Please click here to view a larger version of this figure.
Figure 5: Representative induction toward pancreatic endoderm and endocrine cells. hiPSCs (585A1) were differentiated into PDX1+ cells. The cells were further differentiated into pancreatic endoderm and pancreatic endocrine cells with reported protocols3,16,26. (A) mRNA expressions of stage markers were measured by quantitative real-time polymerase chain reaction (qRT-PCR). The data were normalized to GAPDH expression and presented as the fold-change in gene expression relative to the peak value. Note that PDX1 expression was increased at >20-fold from days 8 (Stage 2) to 11 (Stage 3) and at >100-fold from days 11 (Stage 3) to 19 (Stage 4). The expression in the adult human pancreas is shown as Panc. SOX2, black; SOX17, purple; HNF1β, brown; HNF4α, orange; PDX1, light green; NKX6.1, green; INSULIN, blue; GLUCAGON, red. (B) Representative immunofluorescent micrographs of a pancreatic endoderm marker, NKX6.1 (red), on days 11 (Stage 3) and 19 (Stage 4). PDX1 (green) and nuclei (blue) were co-stained. (C) Representative immunofluorescent micrographs of two pancreatic endocrine makers, insulin (INS, green) and glucagon (GCG, red), on days 19 (Stage 4) and 31 (Stage 5). Nuclei (blue) were co-stained. Please click here to view a larger version of this figure.
| Gene name | Gene symbol | Forward primer | Reverse primer |
| glyceraldehyde-3-phospha te dehydrogenase |
GAPDH | GAAGGTGAAGGTCGGAGTC | GAAGATGGTGATGGGATTTC |
| SRY-box 2 | SOX2 | AGTCTCCAAGCGACGAAAAA | TTTCACGTTTGCAACTGTCC |
| SRY-box 17 | SOX17 | CGCACGGAATTTGAACAGTA | TTAGCTCCTCCAGGAAGTGTG |
| HNF1 homeobox B | HNF1β | CCTCTCCTCCAAACAAGCTG | TGTTGCCATGGTGACTGATT |
| hepatocyte nuclear factor 4 alpha | HNF4α | GAGCTGCAGATCGATGACAA | TACTGGCGGTCGTTGATGTA |
| pancreatic and duodenal homeobox 1 | PDX1 | AGCAGTGCAAGAGTCCCTGT | CACAGCCTCTACCTCGGAAC |
| NK6 homeobox 1 | NKX6.1 | ATTCGTTGGGGATGACAGAG | TGGGATCCAGAGGCTTATTG |
| glucagon | GCG | GAATTCATTGCTTGGCTGGT | CGGCCAAGTTCTTCAACAAT |
| insulin | INS | CTACCTAGTGTGCGGGGAAC | GCTGGTAGAGGGAGCAGATG |
Table 1: Primers for qPCR.
Subscription Required. Please recommend JoVE to your librarian.
Discussion
The generation of PDX1+ cells is comprised of multiple steps; therefore, it is critical to treat cells at the appropriate time. Among the steps, the induction efficiency of definitive endoderm largely affects the final induction efficiency, possibly by interference from other contaminating lineage cells (i.e., mesoderm and ectoderm), which may proliferate and/or secrete factors that disrupt specific differentiation. If the proportion of SOX17+ cells is lower than 80% on day 4 (Stage 1B), an efficient induction to PDX1+ cells is likely to be compromised.
Undifferentiated states of hPSCs are maintained as colonies or aggregates of compacted cells. However, methods that start the differentiation from colonies or aggregates may suffer from heterogeneity, because of different cell adhesion and density in the colony, such as in the center and periphery22, and because cells are at different stages in the cell cycle25. On the other hand, our method starts with dissociated single cells, which enables a relatively homogenous state of cell adhesion of single cells or cell density in every single cell. In terms of homogenous handling for each cell, our methods might be easier than others that start with colony or aggregation cultures.
Although our protocol can be used to induce PDX1+ cells from multiple hPSC lines, the differentiation could still be inefficient. In such cases, differences in adhesion state right after seeding among the hPSC lines could be the cause, and modification of the seeding density could be a solution33. Indeed, Figure 3 shows that inappropriate seeding cell density compromises differentiation into definitive endoderm and PDX1+ cells. Interestingly, the optimal cell density for PDX1+ cell induction was different among the cell populations that achieved >90% definitive endoderm. Another possibility for inefficient differentiation is the poor maintenance condition of the undifferentiated hPSCs, which compromises the quality of pluripotency despite the expression of markers for the undifferentiated state. In this case, the hPSC expansion culture should be recommenced from early passage frozen stocks or sub cloning should be performed to obtain hPSCs in suitable conditions. In the case of inefficient differentiation on days 8 (Stage 2) or 11 (Stage 3), the duration of these steps should be optimized. Supporting this idea, the duration of Stage 3 has been shown critical for acquiring later stage cell characteristics and is cell line-dependent in pancreatic lineage34.
The generation of PDX1+ cells is crucial for the in vitro generation of pancreatic cells. PDX1 is functionally essential for pancreatic development based on knowledge from Pdx1 null mice, which are apancreatic35. Consistently, in vitro and in vivo implantation studies showed hPSC-derived PDX1+ cells have the potential to develop into all pancreatic components, including exocrine and endocrine cells such as pancreatic β cells3,16,36,37. Thus, the efficient generation of PDX1+ cells from hPSCs leads to a stable pancreatic cell supply for the establishment of β cell therapy against diabetes and the understanding of human pancreas development and pancreatic diseases.
The limitations of this method are related to the two-dimensional (2D) monolayer culture format, which is not suitable for some cell types and cell processing. In recent years, three-dimensional (3D) cultures have been shown to promote the generation of mature cells and tissues, possibly due to mimicking the in vivo microenvironment. For example, β cells generated in 3D cultures but not 2D monolayer cultures could attain the ability to secrete insulin in response to extracellular glucose levels38.
To use PDX1+ cells for the generation of developmentally later cell types, it is important to shift to 3D cultures, such as suspension cultures of aggregates embedded in an extracellular matrix and aggregate cultures on an air-liquid interface3,16,37. In addition, 2D monolayer cultures require more surface area for culturing than suspension cultures, limiting scalability. The processing of large amounts of cells for commercial use requires modifications such as the use of microbeads. At the same time, the present method is suitable for the screening of differentiation-inducing factors and the exploration of molecular mechanisms by gene transfer.
Subscription Required. Please recommend JoVE to your librarian.
Disclosures
The authors have nothing to disclose.
Acknowledgments
This work was supported in part by funding from the Japan Society for the Promotion of Science (JSPS) through Scientific Research (C) (JSPS KAKENHI Grant Number15K09385 and 18K08510) to T.T., and Grant-in-Aid for JSPS Research Fellows (JSPS KAKENHI Grant Number 17J07622) to A.K., and the Japan Agency for Medical Research and Development (AMED) through its research grant “Core Center for iPS Cell Research, Research Center Network for Realization of Regenerative Medicine” to K.O. The authors thank Dr. Peter Karagiannis for reading the manuscript.
Materials
| Name | Company | Catalog Number | Comments |
| 3-Keto-N-aminoethyl-N′-aminocaproyldihydrocinnamoyl cyclopamine | Toronto Research Chemicals | K171000 | CYC |
| 4-[(E)-2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]-benzoic acid | Santa Cruz Biotechnology | SC-203303 | TTNPB |
| 50 mL Conical Sterile Polypropylene Centrifuge Tubes | Thermo Fisher Scientific | 339652 | |
| Anti-CDX2 antibody [EPR2764Y] | Abcam | Ab76541 | Anti-CDX2, × 1/1000 dilution |
| B-27 Supplement (50 ×) | Thermo Fisher Scientific | 17504-044 | Serum-free supplement |
| BD FACSAria II Cell Sorter | BD Biosciences | For flow cytometry | |
| Biomedical freezer | SANYO | MDF-U538 | For -30 °C storing |
| Cell Counting Slides for TC10/TC20 Cell Counter, Dual-Chamber | BIO-RAD | 1450011 | Counting slide glass |
| CELL CULTURE MULTIWELL PLATE, 6 WELL, PS, CLEAR | Greiner bio-one | 657165 | For differentiation culture/6-well plate |
| Centrifuge | TOMY | AX-310 | For cell culturing |
| Centrifuge | TOMY | MX-305 | For RT-qPCR |
| CHIR99021 | Axon Medchem | Axon 1386 | |
| CLEAN BENCH | SHOWA KAGAKU | S-1601PRV | Clean bench |
| Corning CellBIND 6-well plate | Corning | 3335 | For feeder-free culture of hPSCs/6-well plate |
| Corning Matrigel Basement Membrane Matrix Growth Factor Reduced | Corning | 354230 | Basement membrane matrix |
| Corning Synthemax II-SC Substrate | Corning | 3535 | For feeder-free culture of hPSCs/synthetic surface material for hPSCs |
| Cryostat | Leica | Leica CM1510 S | For immunostaining of aggregates. |
| Cytofix/Cytoperm Kit | Becton Dickinson | 554714 | Perm/Wash buffer is Permeabilization/Wash buffer. Cytofix/Cytoperm buffer is fixation and permeabilization buffer. |
| Dako pen | Dako | S2002 | For immunostaining of aggregates |
| dNTP mix (10 mM) | Thermo Fisher Scientific | 18427-088 | For RT-qPCR |
| Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | A11055 | Secondary antibody, × 1/500 dilution |
| Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 | Thermo Fisher Scientific | A10036 | Secondary antibody, × 1/500 dilution |
| Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 | Thermo Fisher Scientific | A10040 | Secondary antibody, × 1/500 dilution |
| Donkey Serum | Merck Millipore | S30 | Donkey serum |
| D-PBS(-) without Ca or Mg | Nacalai tesque | 14249-95 | DPBS |
| Essential 8 Medium | Thermo Fisher Scientific | A1517001 | For feeder-free culture of hPSCs/hPSC maintenance medium |
| Falcon 5 mL Round Bottom Polystyrene Test Tube, with Cell Strainer Snap Cap | Corning | 352235 | 5 mL round bottom polystyrene tube with cell strainer |
| Filter Tip, 1,000 µL | Watoson | 124-1000S | Use together with pipettes |
| Filter Tip, 20 µL | Watoson | 124-P20S | Use together with pipettes |
| Filter Tip, 200 µL | Watoson | 124-P200S | Use together with pipettes |
| Fluorescence Microscope | Keyence | BZ-X700 | For immunostaining |
| Forma Steri-Cycle CO2 incubator | Thermo Fisher Scientific | 370A | Incubator |
| HNF-1β Antibody (C-20) | Santa Cruz Biotechnology | sc-7411 | Anti-HNF1β, × 1/200 dilution |
| HNF-4α Antibody (H-171) | Santa Cruz Biotechnology | sc-8987 | Anti-HNF4α, × 1/200 dilution |
| Hoechst 33342 | Thermo Fisher Scientific | H3570 | For nucleus staining, × 1/200 dilution |
| Human Pancreas Total RNA | Ambion | AM7954 | For RT-qPCR |
| Human PDX-1/IPF1 Antibody | R&D Systems | AF2419 | Anti-PDX1, goat IgG, × 1/200 dilution |
| Human SOX17 Antibody | R&D Systems | AF1924 | Anti-SOX17, × 1/200 dilution |
| Improved MEM Zinc Option medium | Thermo Fisher Scientific | 10373-017 | iMEM |
| Incubation chamber | Cosmo Bio | 10DO | For immunostaining of aggregates |
| Latex Examination Gloves | Adachi | ||
| MAS coated slide glass | Matsunami Glass | 83-1881 | For immunostaining of aggregates |
| MicroAmp Fast 96-well Reaction Plate | Applied Biosystems/Thermo Fisher Scientific | 4346907 | For RT-qPCR |
| Microscope | Olympus | CKX41N-31PHP | For cell culturing |
| Microtube | Watoson | 131-515CS | |
| Monoclonal Anti-α-Fetoprotein | SIGMA | A8452 | Anti-AFP, × 1/200 dilution |
| Nanodrop 8000 | Thermo Fisher Scientific | For RT-qPCR | |
| Oligo dT | FASMAC | Custom made Oligo | For RT-qPCR of sequence is "TTTTTTTTTTTTTTTTTTTT" |
| Paraformaldehyde, powder | Nacalai tesque | 26126-54 | PFA, fixative, diluted in DPBS |
| Pharmaceutical refrigerator | SANYO | MPR-514 | For 4 °C storing |
| PIPETMAN P | GILSON | Pipette | |
| Recombinant Human KGF/FGF-7 | R&D Systems | 251-KG | KGF |
| Recombinant Human Noggin | PeproTech | 120-10C | NOGGIN |
| Recombinant Human/Mouse/Rat Activin A | R&D Systems | 338-AC | Activin A |
| ReverTra Ace (100 U/μL) | TOYOBO | TRT-101 | For RT-qPCR |
| RNase-free DNase Set (50) | QIAGEN | 79254 | For RT-qPCR |
| RNeasy Mini Kit | QIAGEN | 74104 | For RT-qPCR |
| RPMI 1640 with L-Gln | Nacalai tesque | 30264-85 | RPMI 1640 |
| Sealing Film for Real Time | Takara | NJ500 | For RT-qPCR |
| Serological pipettes 10 mL | Costar/Corning | 4488 | For cell culturing |
| Serological pipettes 25 mL | Costar/Corning | 4489 | For cell culturing |
| Serological pipettes 5 mL | Costar/Corning | 4487 | For cell culturing |
| Sox2 (D6D9) XP Rabbit mAb | Cell signaling | 3579S | Anti-SOX2, × 1/200 dilution |
| StepOnePlus | Applied Biosystems/Thermo Fisher Scientific | For RT-qPCR | |
| Sucrose | Nacalai tesque | 30406-25 | For immunostaining of aggregates |
| TB Green Premix Ex Taq II |
Takara | RR820B | For RT-qPCR |
| TC20 Automated Cell Counter | BIO-RAD | 1450101J1 | Automatic cell counter |
| Tissue-Tek OCT compound 4583 | Sakura Finetechnical | 4583 | For immunostaining of aggregates |
| Tissue-Tek Cryomold Molds/Adapters | Sakura Finetechnical | 4566 | For immunostaining of aggregates |
| Triton X-100 | Nacalai tesque | 35501-15 | |
| Trypan Blue | BIO-RAD | 1450021 | |
| Ultracold freezer | SANYO | MDF-U33V | For -80 °C storing |
| UltraPure 0.5M EDTA, pH 8.0 | Thermo Fisher Scientific | 15575-038 | Dilute with DPBS to prepare 0.5 mM EDTA |
| Veriti Thermal Cycler | Applied Biosystems/Thermo Fisher Scientific | For RT-qPCR | |
| Y-27632 | Wako | 251-00514 |
References
- D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nature Biotechnology. 24 (11), 1392-1401 (2006).
- Pagliuca, F. W., et al. Generation of functional human pancreatic beta cells in vitro. Cell. 159 (2), 428-439 (2014).
- Rezania, A., et al. Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells. Nature Biotechnology. 32 (11), 1121-1133 (2014).
- Kondo, Y., Toyoda, T., Inagaki, N., Osafune, K. iPSC technology-based regenerative therapy for diabetes. Journal of Diabetes Investigation. 9 (2), 234-243 (2017).
- Millman, J. R., et al. Generation of stem cell-derived beta-cells from patients with type 1 diabetes. Nature Communications. 7, 11463 (2016).
- Zeng, H., et al. An Isogenic Human ESC Platform for Functional Evaluation of Genome-wide-Association-Study-Identified Diabetes Genes and Drug Discovery. Cell Stem Cell. 19 (3), 326-340 (2016).
- Hosokawa, Y., et al. Insulin-producing cells derived from 'induced pluripotent stem cells' of patients with fulminant type 1 diabetes: Vulnerability to cytokine insults and increased expression of apoptosis-related genes. Journal of Diabetes Investigation. , (2017).
- Jennings, R. E., et al. Development of the human pancreas from foregut to endocrine commitment. Diabetes. 62 (10), 3514-3522 (2013).
- Jorgensen, M. C., et al. An illustrated review of early pancreas development in the mouse. Endocrine Reviews. 28 (6), 685-705 (2007).
- Jensen, J. Gene regulatory factors in pancreatic development. Developmental Dynamics. 229 (1), 176-200 (2004).
- Hald, J., et al. Generation and characterization of Ptf1a antiserum and localization of Ptf1a in relation to Nkx6.1 and Pdx1 during the earliest stages of mouse pancreas development. Journal of Histochemistry and Cytochemistry. 56 (6), 587-595 (2008).
- Villasenor, A., Chong, D. C., Henkemeyer, M., Cleaver, O. Epithelial dynamics of pancreatic branching morphogenesis. Development. 137 (24), 4295-4305 (2010).
- Serup, P., et al. The homeodomain protein IPF-1/STF-1 is expressed in a subset of islet cells and promotes rat insulin 1 gene expression dependent on an intact E1 helix-loop-helix factor binding site. Biochemical Journal. 310 (Pt 3), 997-1003 (1995).
- Riedel, M. J., et al. Immunohistochemical characterisation of cells co-producing insulin and glucagon in the developing human pancreas. Diabetologia. 55 (2), 372-381 (2012).
- Mae, S. I., et al. Monitoring and robust induction of nephrogenic intermediate mesoderm from human pluripotent stem cells. Nature Communications. 4, 1367 (2013).
- Toyoda, T., et al. Cell aggregation optimizes the differentiation of human ESCs and iPSCs into pancreatic bud-like progenitor cells. Stem Cell Research. 14 (2), 185-197 (2015).
- Toyoda, T., et al. Rho-Associated Kinases and Non-muscle Myosin IIs Inhibit the Differentiation of Human iPSCs to Pancreatic Endoderm. Stem Cell Reports. 9 (2), 419-428 (2017).
- Chen, K. G., Mallon, B. S., McKay, R. D., Robey, P. G. Human pluripotent stem cell culture: considerations for maintenance, expansion, and therapeutics. Cell Stem Cell. 14 (1), 13-26 (2014).
- Bauwens, C. L., et al. Control of human embryonic stem cell colony and aggregate size heterogeneity influences differentiation trajectories. Stem Cells. 26 (9), 2300-2310 (2008).
- Nguyen, Q. H., et al. Single-cell RNA-seq of human induced pluripotent stem cells reveals cellular heterogeneity and cell state transitions between subpopulations. Genome Research. 28 (7), 1053-1066 (2018).
- Narsinh, K. H., et al. Single cell transcriptional profiling reveals heterogeneity of human induced pluripotent stem cells. Journal of Clinical Investigation. 121 (3), 1217-1221 (2011).
- Rosowski, K. A., Mertz, A. F., Norcross, S., Dufresne, E. R., Horsley, V. Edges of human embryonic stem cell colonies display distinct mechanical properties and differentiation potential. Scientific Reports. 5, 14218 (2015).
- Torres-Padilla, M. E., Chambers, I. Transcription factor heterogeneity in pluripotent stem cells: a stochastic advantage. Development. 141 (11), 2173-2181 (2014).
- Cahan, P., Daley, G. Q. Origins and implications of pluripotent stem cell variability and heterogeneity. Nature Reviews Molecular and Cell Biology. 14 (6), 357-368 (2013).
- Chetty, S., et al. A simple tool to improve pluripotent stem cell differentiation. Nature Methods. 10 (6), 553-556 (2013).
- Kimura, A., et al. Small molecule AT7867 proliferates PDX1-expressing pancreatic progenitor cells derived from human pluripotent stem cells. Stem Cell Research. 24, 61-68 (2017).
- Bhattacharya, S., et al. High efficiency differentiation of human pluripotent stem cells to cardiomyocytes and characterization by flow cytometry. Journal of Visualized Experiments. (91), e52010 (2014).
- Honvo-Houeto, E., Truchet, S. Indirect Immunofluorescence on Frozen Sections of Mouse Mammary Gland. Journal of Visualized Experiments. (106), (2015).
- Okita, K., et al. A more efficient method to generate integration-free human iPS cells. Nature Methods. 8 (5), 409-412 (2011).
- Kajiwara, M., et al. Donor-dependent variations in hepatic differentiation from human-induced pluripotent stem cells. Proceedings of the National Academy of Science U S A. 109 (31), 12538-12543 (2012).
- Kikuchi, T., et al. Human iPS cell-derived dopaminergic neurons function in a primate Parkinson's disease model. Nature. 548 (7669), 592-596 (2017).
- Suemori, H., et al. Efficient establishment of human embryonic stem cell lines and long-term maintenance with stable karyotype by enzymatic bulk passage. Biochemical and Biophysical Research Communication. 345 (3), 926-932 (2006).
- Gage, B. K., Webber, T. D., Kieffer, T. J. Initial cell seeding density influences pancreatic endocrine development during in vitro differentiation of human embryonic stem cells. PLoS One. 8 (12), e82076 (2013).
- Nostro, M. C., et al. Efficient generation of NKX6-1+ pancreatic progenitors from multiple human pluripotent stem cell lines. Stem Cell Reports. 4 (4), 591-604 (2015).
- Jonsson, J., Carlsson, L., Edlund, T., Edlund, H. Insulin-promoter-factor 1 is required for pancreas development in mice. Nature. 371 (6498), 606-609 (1994).
- Kelly, O. G., et al. Cell-surface markers for the isolation of pancreatic cell types derived from human embryonic stem cells. Nature Biotechnology. 29 (8), 750-756 (2011).
- Hohwieler, M., et al. Human pluripotent stem cell-derived acinar/ductal organoids generate human pancreas upon orthotopic transplantation and allow disease modelling. Gut. 66 (3), 473-486 (2017).
- Takeuchi, H., Nakatsuji, N., Suemori, H. Endodermal differentiation of human pluripotent stem cells to insulin-producing cells in 3D culture. Scientific Reports. 4, 4488 (2014).
