A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface

11.1K views

⸱

DOI:

10.3791/57699

⸱

July 4th, 2018

In This Article

Summary

Gut host-microbe interactions were assessed using a novel approach combining a synthetic oral community, in vitro gastrointestinal digestion, and a model of the small intestine epithelium. We present a method that can be adapted to evaluate cell invasion of pathogens and multi-species biofilms, or even to test probiotic formulations' survivability.

Abstract

The interplay between host and microbiota has been long recognized and extensively described. The mouth is similar to other sections of the gastrointestinal tract, as resident microbiota occurs and prevents colonisation by exogenous bacteria. Indeed, more than 600 species of bacteria are found in the oral cavity, and a single individual may carry around 100 different at any time. Oral bacteria possess the ability to adhere to the various niches in the oral ecosystem, thus becoming integrated within the resident microbial communities, and favouring growth and survival. However, the flow of bacteria into the gut during swallowing has been proposed to disturb the balance of the gut microbiota. In fact, oral administration of P. gingivalis shifted bacterial composition in the ileal microflora. We used a synthetic community as a simplified representation of the natural oral ecosystem, to elucidate the survival and viability of oral bacteria subjected to simulated gastrointestinal transit conditions. Fourteen species were selected, subjected to in vitro salivary, gastric, and intestinal digestion processes, and presented to a multicompartment cell model containing Caco-2 and HT29-MTX cells to simulate the gut mucosal epithelium. This model served to unravel the impact of swallowed bacteria on cells involved in the enterohepatic circulation. Using synthetic communities allows for controllability and reproducibility. Thus, this methodology can be adapted to assess pathogen viability and subsequent inflammation-associated changes, colonization capacity of probiotic mixtures, and ultimately, potential bacterial impact on the presystemic circulation.

Introduction

Humans cohabit with bacteria, which are present at the same number as human cells1. Hence, it is of crucial important to obtain a comprehensive understanding of the human microbiome. The oral cavity is a unique environment in that it is divided into several smaller habitats, thus containing a large variety of bacteria and biofilms in those different locations. Being an open ecosystem, some species in the mouth may be transient visitors. However, certain microorganisms colonize soon after birth and form organized biofilms2. These are found in the teeth surface above the gingival crevice, the subgingival crevice, tongue, mucosal surfaces and dental prosthetics and fillings3. Bacteria can also be present as flocs and planktonic cells in the lumen of the tooth canal, either intermixed with necrotic pulp tissue or suspended in a fluid phase.

There is active, continuous cross-talk between host cells and the resident microbiota4. Bacteria communicate within and between species, and only a small proportion of the natural colonizers can adhere to tissues, while other bacteria attach to these primary colonizers. For instance, cell-cell binding between microorganisms is key for integrating secondary colonizers into oral biofilms, and building complex networks of interacting microbial cells4. Around 70% of bacterial aggregates in a saliva sample are formed by Porphyromonas sp., Streptococcus sp., Prevotella sp., Veillonella sp., and unidentified Bacteroidetes. F. nucleatum is an intermediate colonizer in the subgingival biofilm and aggregates with the late colonizers P. gingivalis, T. denticola, and Tannerella forsythia, which are implicated in periodontitis5. In addition, Streptococcus mitis occupies both mucosal and dental habitats, while S. sanguinis and S. gordonii prefer to colonize teeth3. Thus, S. sanguinis is present in lower incisors and canines, while Actinomyces naeslundii has been found in upper anteriors6.

In addition, the indigenous microbiome plays a role in maintaining human health2. Resident microbiota participates in immune education and in preventing pathogen expansion. This colonisation resistance occurs because the native bacteria may be better adapted at attaching to surfaces, and more efficient at metabolising the available nutrients for growth. Although probiotic strains survive the gastrointestinal passage and remain active, the persistence of autochthonous bacteria swallowed from an upper location of the gastrointestinal tract has not been fully described. Thus, we subjected an artificial community, representative of the oral ecosystem, to simulated gastrointestinal transit conditions. Viability of bacterial cells was assessed using a multicompartment model resembling the gut epithelium. Current gut simulators offer suitable reproducibility in terms of analysis of the luminal microbial community7. However, bacterial adhesion and host-microbe interaction are separately addressed, as combining cell lines with microbial communities is challenging8. In contrast, we present a framework that provides potential mechanistic explanation of successful colonization events reported on the gut interface. Indeed, this model can be jointly used with a static gut model to evaluate the impact of microbial communities on host surface signalling.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Strains and Culture Conditions

NOTE: The synthetic oral community was composed by strains commonly present in the oral microbiome3.

  1. Obtain the following strains from the American Type Culture Collection (ATCC): Aggregatibacter actinomycetemcomitans (ATCC 43718), Fusobacterium nucleatum (ATCC 10953), Porphyromonas gingivalis (ATCC 33277), Prevotella intermedia (ATCC 25611), Streptococcus mutans (ATCC 25175), Streptococcus sobrinus (ATCC 33478), Actinomyces naeslundii (ATCC 51655), Streptococcus gordonii (ATCC 49818), Actinomyces viscosus (ATCC 15987), and Streptococcus mitis (ATCC 49456).
  2. Acquire Veillonella parvula from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DSM 2007), Streptococcus sanguinis from the BCCM/LMG Bacteria Collection (LMG 14657) and use Streptococcus salivarius strain TOVE-R9, and Streptococcus oralis10.

2. Development of a Multispecies Community Representative of the Oral Microbiome

NOTE: Generate a synthetic community to simulate the potential adhesion capacity of oral bacteria to the in vitro gut epithelium. Grow bacteria on blood agar plates supplemented with 5 μg/mL hemin, 1 μg/mL menadione, and 5% sterile defibrinated horse blood, as described in Hernandez-Sanabria et al. (2017)11. In brief:

  1. Dissolve 100 mg of hemin in 2 mL of 1 M NaOH, add 100 mL of distilled autoclaved water. Store in a dark container. Sterilize through a 0.22 µm filter before adding to medium.
  2. Dissolve 100 mg of menadione in 20 mL of 96% ethanol. Sterilize through a 0.22 µm filter before adding to medium.
  3. Prepare 1 L of blood agar medium (see Table of Materials) according to the manufacturer’s instructions and autoclave. Let cool down before adding the horse blood and the supplements. Mix and pour the plates.
  4. Prepare modified Brain Heart Infusion (BHI) broth as previously reported12. Add 5 μg/mL of hemin and 1 μg/mL of menadione after autoclaving.
  5. Dispense 9 mL of the medium in Hungate tubes, and close with a rubber stopper and an aluminium cap. Flush the tubes with N2/CO2 (90%/10%).
  6. Retrieve 1 mL of anaerobic medium with a syringe and place it in a 1.5 mL microcentrifuge tube. Pick single colonies of each bacterial species, resuspend in the medium, and transfer back into the anaerobic modified BHI. Incubate for 48 h at 37 °C, except for S. salivarius, which must be incubated for 24 h.
  7. If needed, confirm purity of the cultures prior to assembling the synthetic community. In brief:
    1. Extract DNA from the liquid cultures as in Hernandez-Sanabria et al. (2010)13 and amplify the 16S rRNA gene using the primers 27F (AGAGTTTGATYMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACT), and the following program: 5 minutes at 95 °C, 30 cycles of 95 °C for 1 min, 55 °C for 1 min, and 72 °C for 1.5 min, followed by a final extension step of 5 min at 72 °C.
    2. Purify the PCR product with a commercial kit (see Table of Materials), following the manufacturer’s instructions.
    3. Perform the sequencing reaction of the purified products in a 10 μL total volume containing 0.5 μL of dye (see Table of Materials), 3.2 pmol of M13f primer (CGCCAGGGTTTTCCCAGTCACGAC), 2.0 μL of 5x sequencing buffer, and 20 ng of template, using a commercial sequencing system with kit (see Table of Materials).
      NOTE: We had this procedure performed commercially.
    4. Perform a BLAST search on all the sequences (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to determine the closest known taxon and compare with the sequence of the original strain using the RDP Classifier online tool (http://rdp.cme.msu.edu/) and the SINA Alignment service (https://www.arb-silva.de/aligner/).
  8. Measure the cell number at the end of the incubation, using flow cytometry and SYBR Green/Propidium Iodide stain as described in Hernandez-Sanabria et al. (2017)11. Dilute the cultures to 105 cells mL-1, using modified BHI.
  9. Add 1 mL of S. mitis into 75 mL of anaerobic BHI and incubate until stationary phase (6 h). Following, collect 0.75 mL of each diluted strain and mix under anaerobic conditions.
  10. Once all the cultures have been mixed, take 1 mL of the microcosm, and add to the 75 mL of BHI. Incubate the synthetic community under 10% CO2, 10% H2, 80% N2 for 48 h at 37 °C and 200 rpm (see Table of Materials).
  11. Measure cell density as in 2.8. before presenting the community to the cell model. Composition of the community can be assessed with quantitative Real-Time PCR, using the primers and annealing temperatures in Table 1 of Slomka et al. (2017)10. In addition, use 16S rRNA gene amplicon sequencing to provide information on the initial members present13,14. For either identity-confirming protocol, use cDNA as a template to indicate the bacteria actively transcribing proteins, and use DNA as a template to reveal presence/absence of the strains.

3. General Cell Culture Practices

NOTE: For general aspects of cell culture, the authors refer to Master and Stacey (2007)15. Obtain cell lines used from the European Collection of Authenticated Cell Cultures (Caco-2 ECACC 86010202 and HT29-MTX-E12 ECACC 12040401, Public Health England, UK). Reagents for cell culture can be purchased (see Table of Materials), unless otherwise specified.

  1. Maintenance and passaging of Caco-2 and HT29-MTX cell lines
    NOTE: Caco-2 and HT29-MTX cells are routinely grown in 25 cm2 tissue culture flasks containing supplemented DMEM medium (Table 1). Cells are trypsinized when 60–70% confluence is reached.
    1. Remove the cell culture medium from the flasks. Wash twice with 5 mL of PBS without Ca++/Mg++.
    2. Add 2 mL of a 0.5 mg/L solution of trypsin and 0.22 g/L ethylene diamine tetraacetic acid (EDTA). Distribute the trypsin solution by gently moving the flask. Remove 1.5 mL of the trypsin solution and incubate the flask at 37 °C for 10 min.
    3. Check under the microscope if cells are detached from the flask surface. Incubate for additional 5 min, if needed.
    4. Add 5 mL of supplemented cell culture media to the flask to inactivate the trypsin. Pipet up and down to obtain a homogenous single cell suspension.
    5. Immediately, take a 50 µL aliquot of the cell suspension and mix with sterile 0.4% Trypan blue solution in a 1:1 (v/v) proportion for Caco-2 cells or 1:5 v/v for HT29-MTX. Mix by pipetting and load into a counting chamber (see Table of Materials).
    6. Count the viable cells (white bright cells) under the microscope (see manufacturer’s instructions).
    7. Seed in a new flask at a density of 4 x 105 cells/cm2 and 1 x 104 cells/cm2, for Caco-2 and HT29-MTX, respectively.
      NOTE: (1) Caco-2 cells differentiate and form tight junctions once reaching confluency. It is extremely important to avoid over-confluency before trypsinization. Overgrowth of cells in flask can cause failure in cell detachment after trypsinization and/or cell clumps. (2) HT29-MTX cells are mucus-producing cells with high metabolic activity16. These features may cause a fast acidification of the cell culture media, especially if cells are at high density. HEPES buffer can be added to the cell culture medium (Table 1) to maintain the pH between 7 and 7.2. If the pH drops, medium can be exchanged when confluency is less than 50%. However, if confluency >50%, the cell culture must be split.

4. Assembly of a Multicompartment Cell Model Simulating the Gut Host-microbe Interface

NOTE: Complete the co-culture in double chamber wells (diameter 24 mm, pore size 0.4 μm; see Table of Materials).

  1. Add 1.5 mL of complete cell culture media to the apical compartment and 2 mL to the basal. Pre-incubate for 20–30 min to obtain even distribution of the cell suspension when seeding.
  2. Trypsinize the cell culture of Caco-2 and HT29-MTX as described in section 3. The trypsinization procedure must be accurately followed to achieve homogenous distribution of both cell lines, in a single cell suspension, without clumps.
  3. Count the viable cells as described in 3.1.8.
  4. Adjust the cell density to 6.5 x 104 cells/cm2 in a 90/10 proportion of Caco-2/HT29-MTX cells.
  5. Homogenize the cell suspensions and add the corresponding volume of Caco-2 and HT29-MTX cells to a pre-filled sterile container with supplemented cell culture media. Remove the pre-incubated media from the apical side of the chamber by aspiration.
  6. Gently mix the cell suspension by pipetting, and transfer 1.5 mL to the apical compartment of the chamber inserts. The seeding procedure requires a constant homogenization of the cell suspension, as cells tend to sediment. Depending on the experience of the user and working speed, cell suspension must be mixed after dispensing 1–3 wells.
  7. Move plates gently backward and forward and then right to left to right (5–10 times) to obtain an even spread of cells in the well. Transfer to incubator and repeat the movement of the plates.
  8. Maintain the co-culture of Caco-2/HT29-MTX cells for 15 days, refreshing apical and basal compartments every 2 days with supplemented DMEM. After this time, the cell culture media can be changed to supplemented DMEM without antibiotic/antimycotic solution.
  9. Maintain the system until 20–21 days post-seeding by refreshing the medium every 2 days.
  10. Measure the epithelial barrier integrity before starting the assay, using an Electrical Resistance System (see Table of Materials), following the manufacturer instructions.
    1. Ensure that TEER equipment is fully charged (>24 h) before starting the measurements.
    2. Disconnect the TEER equipment from the power supply and cover with a plastic autoclave bag. Make a hole in the bag to introduce the electrode and plug into the input port on the meter. Spray with 70% ethanol/water (v/v) before introducing the TEER equipment into the flow cabinet.
    3. To disinfect the electrode, immerse the electrode tips in 70% ethanol/water (v/v) solution for 15 min. Allow to air dry for 15 s. Rinse the electrode in pre-warmed cell culture media.
    4. Take the cells out of the incubator and allow cells to come to room temperature inside the flow cabinet.
    5. Make sure that the meter is disconnected from the charger. Set the mode switch to Ohms and turn the power switch On.
    6. Measure the cell resistance by immersing the electrode with the shorter tip in the insert and the longer tip out of the well. Keep the electrode at a 90° angle to the plate insert.

5. Bacterial Survival Following In Vitro Gastrointestinal Transit Conditions

NOTE: Prepare simulated digestion fluids following the protocol of Minekus et al. (2014)17, with the modifications described below. Prepare all the dilutions with ultrapure water. Filter-sterilize all solutions through a 0.22 µm filter and perform the digestion procedure under sterile conditions.

  1. Oral digestion:
    1. Place 3 mL of the bacterial community in a 50 mL sterile tube, mix with 3 mL of simulated saliva fluid (SSF), containing (in mmol L-1): KCl, 15.1; KH2PO4, 3.7; NaHCO3, 6.8; MgCl2(H2O)6, 0.5, (NH4) CO3, 0.06; HCl, 1.1; CaCl2(H2O)2, 0.75. Add 75 U/mL of α-amylase from human saliva Type IX-A and 2 g/L mucin from porcine stomach type II to the SSF.
    2. Incubate the mixture for 2 min, at 37 °C, and 100 rpm. Collect a 2 mL sample for DNA extraction and flow cytometry quantification (S1).
  2. Gastric digestion:
    1. Add 4 mL of simulated gastric fluid (SGF), containing (in mmol L-1): KCl, 6.9; KH2PO4, 0.9; NaHCO3, 25; NaCl, 47.2; MgCl2(H2O)6, 0.1, (NH4) CO3, 0.5; HCl, 15.6; CaCl2(H2O)2, 0.075. In addition, the SGF contained 2 g/L of mucin from porcine stomach type II.
    2. Measure the pH and adjust to pH 3 with 1 M HCl, if needed. Incubate at 37 °C and 100 rpm. Collect a 2 mL sample (S2).
  3. Small intestine digestion:
    1. Add 4 mL of simulated intestinal fluid (SIF) containing (in mmol L-1): KCl, 6.8; KH2PO4, 0.8; NaHCO3, 85; NaCl, 38.4; MgCl2(H2O)6, 0.33; HCl, 8.4; CaCl2(H2O)2, 0.3; to the digestion tube.
    2. Adjust to pH 7 with 1 M NaOH, if needed. Incubate at 37 °C and 100 rpm. Collect a 2 mL sample (S3).

6. Bacterial Colonization Ability Following In Vitro Gastrointestinal Transit Conditions

  1. Centrifuge 2 mL of the small intestine digestion, for 10 min at 2,650 x g.
  2. Remove the supernatant and mix the bacterial pellet with 5 mL of supplemented DMEM without antibiotic and antimycotic.
  3. Stain and quantify intact/damaged cells using a flow cytometer (see Table of Materials), as described by Hernandez-Sanabria et al. (2017)11.
  4. Adjust the cell density to 105 viable cells/mL by diluting in supplemented DMEM without antibiotic and antimycotic.
  5. Remove the apical medium of the transwell system and add 1.5 mL of the bacterial suspension. Co-culture the system for 2 h under general cell culture conditions (37 °C, 95% humidity, 5% CO2).
    NOTE: This time can be extended up to 48 h, depending on the experimental protocol required. The co-culture can be maintained in a different incubator than that used for routine cell maintenance, to avoid contaminations.
  6. Measure the TEER values after incubation, to evaluate the integrity of the epithelial barrier as described in 4.11.
  7. Upon completing incubation time, remove apical media, and collect 0.5 mL for further analyses (S4). A subsample of media can be used for assessment of cell viability by Lactate Dehydrogenase (LDH) assay (see Table of Materials), following the manufacturer instructions.
  8. Add 0.5 mL of 10 mM N-acetylcysteine in HBSS (NAC-buffer) to solubilize the mucus produced by the HT29-MTX and to recover adhered bacteria. Incubate the plates at 37 °C for 1 h, under agitation (135 rpm, see Table of Materials).
  9. Recover the NAC-HBSS in a microcentrifuge tube (S5) and wash twice the cells with 1 mL DPBS.
  10. Add 0.5 mL of 0.5% Triton X-100 (w/v) on top of the monolayers, disrupt the cells by pipetting, recover the liquid and vortex for 1 min. Speed is crucial to avoid damaging the bacterial cells with the detergent.
  11. Centrifuge the cells for 5 min at 2,650 x g, and separate the supernatant (S6) and the pellet (S7).

7. Sample Analysis

NOTE: Analyse collected samples (S1-S7) to evaluate bacterial viability and adhesion potential to the intestinal cells, following a simulated gastrointestinal digestion.

  1. Bacterial viability: Pass samples S1-S5 twice through a 0.45 µm and quantify bacterial cells using live/dead cell staining and flow cytometry, as indicated in step 2.811.
  2. Adhesion potential: Prepare serial dilutions (-1 to -8) for S1-S6 and streak 10 µL in blood agar and modified BHI plates. Incubate at 37 °C under anaerobic conditions for 24–48 h. Plate the same volume of undiluted S7.
    1. Taxonomical identification of adhered bacteria:
      1. Pick individual colonies with a culture loop and resuspend each on 10 µL of nuclease-free water. Collect 4 µL of this suspension and use it as a template for PCR amplification of the 16S rRNA gene using the primers and conditions described in 2.7.1.
      2. Perform sequencing following the protocol in 2.7.3, and validation of the sequence using the procedure included in 2.7.4.
  3. Do further downstream analysis such as total DNA extraction, qPCR quantification and/or 16S rRNA amplicon sequencing, RNA extraction, and transcriptomic profiling as desired.
    NOTE: Flow cytometry quantification was performed immediately after sampling. As a control for membrane-permeabilized cells, a sample exposed to 70 °C for 3 min was used. Background noise was assessed by measuring with flow cytometry the digestion fluids or samples obtained from the cell culture model without bacteria. Every sample was measured in triplicate.

Access restricted. Please log in or start a trial to view this content.

Results

This protocol leads to the generation of a model suitable for elucidating the survival and viability of oral bacteria subjected to simulated gastrointestinal transit conditions. The counts of intact cells from individual strains is approximately 108 cells mL-1 prior the creation of the synthetic community, while the multispecies microcosm contained above 90% of viable cells during the establishment of the community (Figure 1A

Access restricted. Please log in or start a trial to view this content.

Discussion

The oral microbiome is a key element in human health as recently reported by several authors20,21. Previous findings suggest that the ingestion of saliva containing large loads of bacteria can influence the microbial ecosystem of the small intestine, which is one of the main sites for immune priming. The combination of a static upper gastrointestinal digestion model with the host interface represented by intestinal epithelial and mucus-secreting cells, served to ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose

Acknowledgements

The authors gratefully acknowledge financial support from the Flanders Research Foundation to Marta Calatayud Arroyo (FWO postdoctoral fellowship-12N2815N). Emma Hernandez-Sanabria is a postdoctoral fellow supported by Flanders Innovation and Entrepreneurship (Agentschap voor Innovatie door Wetenschap en Technologie, IWT).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
STRAINS
Aggregatibacter actinomycetemcomitans American Type Culture CollectionATCC 43718
Fusobacterium nucleatum American Type Culture CollectionATCC 10953
Porphyromonas gingivalis American Type Culture CollectionATCC 33277
Prevotella intermedia American Type Culture CollectionATCC 25611
Streptococcus mutans American Type Culture CollectionATCC 25175
Streptococcus sobrinus American Type Culture CollectionATCC 33478
Actinomyces viscosus American Type Culture CollectionATCC 15987
Streptococcus salivarius  TOVE-R
Streptococcus mitis American Type Culture CollectionATCC 49456
Streptococcus sanguinis BCCM/LMG Bacteria CollectionLMG 14657
Veillonella parvula Leibniz Institute DSMZ-German Collection of Microorganisms and Cell CulturesDSM 2007
Streptococcus gordonii American Type Culture CollectionATCC 49818
CELL LINES
Caco-2 cellsEuropean Collection of Authenticated Cell Cultures86010202
HT29-MTX cellsEuropean Collection of Authenticated Cell Cultures12040401
REAGENTS AND CONSUMABLES
Brain Heart Infusion (BHI) brothOxoidCM1135
Blood Agar 2OxoidCM0055Blood Agar medium
MenadioneSigmaM9429
HeminSigmaH9039
5% sterile defibrinated horse bloodE&O Laboratories Ltd,P030
InnuPREP PCRpure KitAnalytik Jena845-KS-5010250PCR purification kit
Big DyeApplied Biosystems4337454Dye for sequencing
ABI Prism BigDye Terminator v3.1 cycle sequencing kitApplied Biosystems4337456
SYBR Green IInvitrogenS7585
Propidium IodideInvitrogenP1304MP
T25 culture flasks uncoated, cell-culture treated, vented, sterileVWR734-2311
Trypsin-EDTA solutionSigma-AldrichT3924-100ML
Trypan Blue solution
0.4%, liquid, sterile-filtered
Sigma-AldrichT8154 
PBSGibco14190250
DMEM cell culture media, with GlutaMAX and PyruvateLife technologies31966-047
Corning Transwell polyester membrane cell culture insertsSigma-AldrichCLS3450-24EA
Mucin from porcine stomach Type II  Sigma-AldrichM2378
Inactivated fetal bovine serumGreiner Bio One758093
Antibiotic-Antimycotic (100X)Gibco15240062
Triton X 100 for molecular biologySigma-AldrichT8787 
DPBS without calcium, magnesiumGibco14190-250
Pierce LDH Cytotoxicity Assay KitThermo Fisher Scientific88953
Corning HTS Transwell-24 well, pore size 0.4 µmCorning Costar Corp3450
Nuclease-free waterServa Electrophoresis28539010
EQUIPMENT
Neubauer counting chamber improvedCarl RothT729.1
BD Accuri C6 Flow cytometerBD Biosciences653118
PowerLyzer 24 HomogenizerMoBio13155
T100 Thermal CyclerBioRad186-1096
Flush systemCustom made-
InnOva 4080 Incubator ShakerNew Brunswick Scientific8261-30-1007Shaker for 2.10
Memmert CO2 incubatorMemmert GmbH & Co.ICO150med
Millicell ERS (Electrical Resistance System)EMD Millipore, Merck KGaAMERS00002
Millipore Milli-Q academic, ultra pure water systemMillipore, Merck KGaA-
Shaker (ROCKER 3D basic)IKA4000000Shaker for 6.10

References

  1. Sender, R., Fuchs, S., Milo, R. Revised estimates for the number of human and bacteria cells in the body. PLoS Biology. 14, e1002533(2016).
  2. Kelly, D., King, T., Aminov, R. Importance of microbial colonization of the gut in early life to the development of immunity. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. , 58-69 (2007).
  3. Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., Dewhirst, F. E. Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology. 43, 5721-5732 (2005).
  4. Marsh, P. D., Head, D. A., Devine, D. A. Dental plaque as a biofilm and a microbial community-Implications for treatment. Journal of Oral Biosciences. 57, 185-191 (2015).
  5. Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C., Kent, R. L. Microbial complexes in subgingival plaque. Journal of Clinical Periodontology. 25, 134-144 (1998).
  6. Haffajee, A. D., et al. Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects. Journal of Clinical Periodontology. 25, 346-353 (1998).
  7. Venema, K. Microbial metabolites produced by the colonic microbiota as drivers for immunomodulation in the host. The FASEB Journal. 27, (2013).
  8. Marzorati, M., et al. The HMI (TM) module: A new tool to study the Host-Microbiota Interaction in the human gastrointestinal tract in vitro. BMC Microbiology. 14, 133(2014).
  9. Tanzer, J. M., Kurasz, A. B., Clive, J. Competitive displacement of mutans streptococci and inhibition of tooth-decay by Streptococcus-Salivarius Tove-R. Infection and Immunity. 48, 44-50 (1985).
  10. Slomka, V., et al. Nutritional stimulation of commensal oral bacteria suppresses pathogens: the prebiotic concept. Journal of Clinical Periodontology. 44, 344-352 (2017).
  11. Hernandez-Sanabria, E., et al. In vitro increased respiratory activity of selected oral bacteria may explain competitive and collaborative interactions in the oral microbiome. Frontiers in Cellular and Infection Microbiology. 7, 235(2017).
  12. Alvarez, G., Gonzalez, M., Isabal, S., Blanc, V., Leon, R. Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide. AMB Express. 3, (2013).
  13. Ehsani, E., et al. Initial evenness determines diversity and cell density dynamics in synthetic microbial ecosystems. Scientific Reports. 8, 340(2018).
  14. Hernandez-Sanabria, E., et al. Correlation of particular bacterial PCR-denaturing gradient gel electrophoresis patterns with bovine ruminal fermentation parameters and feed efficiency traits. Applied and Environmental Microbiology. 76, 6338-6350 (2010).
  15. Masters, J. R., Stacey, G. N. Changing medium and passaging cell lines. Nature Protocols. 2, 2276-2284 (2007).
  16. Calatayud, M., Velez, D., Devesa, V. Metabolism of inorganic arsenic in intestinal epithelial cell lines. Chemical Research in Toxicology. 25, 2402-2411 (2012).
  17. Minekus, M., et al. A standardised static in vitro digestion method suitable for food - an international consensus. Food & Function. 5, 1113-1124 (2014).
  18. Berney, M., Hammes, F., Bosshard, F., Weilenmann, H. U., Egli, T. Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Applied and Environmental Microbiology. 73, 3283-3290 (2007).
  19. Props, R., Monsieurs, P., Mysara, M., Clement, L., Boon, N. Measuring the biodiversity of microbial communities by flow cytometry. Methods in Ecology and Evolution. 7, 1376-1385 (2016).
  20. Yamashita, Y., Takeshita, T. The oral microbiome and human health. Journal of Oral Science. 59, 201-206 (2017).
  21. Wade, W. G. The oral microbiome in health and disease. Pharmacological Research. 69, 137-143 (2013).
  22. Yu, M., et al. A resource for cell line authentication, annotation and quality control. Nature. 520, 307(2015).
  23. Pelaseyed, T., et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunological Reviews. 260, 8-20 (2014).
  24. Bengoa, A. A., et al. Simulated gastrointestinal conditions increase adhesion ability of Lactobacillus paracasei strains isolated from kefir to Caco-2 cells and mucin. Food Research International. 103, 462-467 (2018).
  25. Kleiveland, C. R., et al. The Impact of Food Bioactives on Health: in vitro and ex vivo models. Verhoeckx, K., et al. , Springer International Publishing. 197-205 (2015).
  26. Laparra, J. M., Sanz, Y. Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium. Letters in Applied Microbiology. 49, 695-701 (2009).
  27. Gagnon, M., Berner, A. Z., Chervet, N., Chassard, C., Lacroix, C. Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion. Journal of Microbiological Methods. 94, 274-279 (2013).
  28. Großkopf, T., Soyer, O. S. Synthetic microbial communities. Current Opinion in Microbiology. 18, 72-77 (2014).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

In Vitro Gut ModelGastrointestinal Transit SimulationFlow Cytometry ViabilityCaco-2 HT29-MTX Co-cultureSimulated Digestion FluidsEpithelial Barrier IntegrityBacterial Community CompositionProbiotic Colonization Capacity