1. Strains and Culture Conditions
NOTE: The synthetic oral community was composed by strains commonly present in the oral microbiome3.
- Obtain the following strains from the American Type Culture Collection (ATCC): Aggregatibacter actinomycetemcomitans (ATCC 43718), Fusobacterium nucleatum (ATCC 10953), Porphyromonas gingivalis (ATCC 33277), Prevotella intermedia (ATCC 25611), Streptococcus mutans (ATCC 25175), Streptococcus sobrinus (ATCC 33478), Actinomyces naeslundii (ATCC 51655), Streptococcus gordonii (ATCC 49818), Actinomyces viscosus (ATCC 15987), and Streptococcus mitis (ATCC 49456).
- Acquire Veillonella parvula from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DSM 2007), Streptococcus sanguinis from the BCCM/LMG Bacteria Collection (LMG 14657) and use Streptococcus salivarius strain TOVE-R9, and Streptococcus oralis10.
2. Development of a Multispecies Community Representative of the Oral Microbiome
NOTE: Generate a synthetic community to simulate the potential adhesion capacity of oral bacteria to the in vitro gut epithelium. Grow bacteria on blood agar plates supplemented with 5 μg/mL hemin, 1 μg/mL menadione, and 5% sterile defibrinated horse blood, as described in Hernandez-Sanabria et al. (2017)11. In brief:
- Dissolve 100 mg of hemin in 2 mL of 1 M NaOH, add 100 mL of distilled autoclaved water. Store in a dark container. Sterilize through a 0.22 µm filter before adding to medium.
- Dissolve 100 mg of menadione in 20 mL of 96% ethanol. Sterilize through a 0.22 µm filter before adding to medium.
- Prepare 1 L of blood agar medium (see Table of Materials) according to the manufacturer’s instructions and autoclave. Let cool down before adding the horse blood and the supplements. Mix and pour the plates.
- Prepare modified Brain Heart Infusion (BHI) broth as previously reported12. Add 5 μg/mL of hemin and 1 μg/mL of menadione after autoclaving.
- Dispense 9 mL of the medium in Hungate tubes, and close with a rubber stopper and an aluminium cap. Flush the tubes with N2/CO2 (90%/10%).
- Retrieve 1 mL of anaerobic medium with a syringe and place it in a 1.5 mL microcentrifuge tube. Pick single colonies of each bacterial species, resuspend in the medium, and transfer back into the anaerobic modified BHI. Incubate for 48 h at 37 °C, except for S. salivarius, which must be incubated for 24 h.
- If needed, confirm purity of the cultures prior to assembling the synthetic community. In brief:
- Extract DNA from the liquid cultures as in Hernandez-Sanabria et al. (2010)13 and amplify the 16S rRNA gene using the primers 27F (AGAGTTTGATYMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACT), and the following program: 5 minutes at 95 °C, 30 cycles of 95 °C for 1 min, 55 °C for 1 min, and 72 °C for 1.5 min, followed by a final extension step of 5 min at 72 °C.
- Purify the PCR product with a commercial kit (see Table of Materials), following the manufacturer’s instructions.
- Perform the sequencing reaction of the purified products in a 10 μL total volume containing 0.5 μL of dye (see Table of Materials), 3.2 pmol of M13f primer (CGCCAGGGTTTTCCCAGTCACGAC), 2.0 μL of 5x sequencing buffer, and 20 ng of template, using a commercial sequencing system with kit (see Table of Materials).
NOTE: We had this procedure performed commercially.
- Perform a BLAST search on all the sequences (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to determine the closest known taxon and compare with the sequence of the original strain using the RDP Classifier online tool (http://rdp.cme.msu.edu/) and the SINA Alignment service (https://www.arb-silva.de/aligner/).
- Measure the cell number at the end of the incubation, using flow cytometry and SYBR Green/Propidium Iodide stain as described in Hernandez-Sanabria et al. (2017)11. Dilute the cultures to 105 cells mL-1, using modified BHI.
- Add 1 mL of S. mitis into 75 mL of anaerobic BHI and incubate until stationary phase (6 h). Following, collect 0.75 mL of each diluted strain and mix under anaerobic conditions.
- Once all the cultures have been mixed, take 1 mL of the microcosm, and add to the 75 mL of BHI. Incubate the synthetic community under 10% CO2, 10% H2, 80% N2 for 48 h at 37 °C and 200 rpm (see Table of Materials).
- Measure cell density as in 2.8. before presenting the community to the cell model. Composition of the community can be assessed with quantitative Real-Time PCR, using the primers and annealing temperatures in Table 1 of Slomka et al. (2017)10. In addition, use 16S rRNA gene amplicon sequencing to provide information on the initial members present13,14. For either identity-confirming protocol, use cDNA as a template to indicate the bacteria actively transcribing proteins, and use DNA as a template to reveal presence/absence of the strains.
3. General Cell Culture Practices
NOTE: For general aspects of cell culture, the authors refer to Master and Stacey (2007)15. Obtain cell lines used from the European Collection of Authenticated Cell Cultures (Caco-2 ECACC 86010202 and HT29-MTX-E12 ECACC 12040401, Public Health England, UK). Reagents for cell culture can be purchased (see Table of Materials), unless otherwise specified.
- Maintenance and passaging of Caco-2 and HT29-MTX cell lines
NOTE: Caco-2 and HT29-MTX cells are routinely grown in 25 cm2 tissue culture flasks containing supplemented DMEM medium (Table 1). Cells are trypsinized when 60–70% confluence is reached.
- Remove the cell culture medium from the flasks. Wash twice with 5 mL of PBS without Ca++/Mg++.
- Add 2 mL of a 0.5 mg/L solution of trypsin and 0.22 g/L ethylene diamine tetraacetic acid (EDTA). Distribute the trypsin solution by gently moving the flask. Remove 1.5 mL of the trypsin solution and incubate the flask at 37 °C for 10 min.
- Check under the microscope if cells are detached from the flask surface. Incubate for additional 5 min, if needed.
- Add 5 mL of supplemented cell culture media to the flask to inactivate the trypsin. Pipet up and down to obtain a homogenous single cell suspension.
- Immediately, take a 50 µL aliquot of the cell suspension and mix with sterile 0.4% Trypan blue solution in a 1:1 (v/v) proportion for Caco-2 cells or 1:5 v/v for HT29-MTX. Mix by pipetting and load into a counting chamber (see Table of Materials).
- Count the viable cells (white bright cells) under the microscope (see manufacturer’s instructions).
- Seed in a new flask at a density of 4 x 105 cells/cm2 and 1 x 104 cells/cm2, for Caco-2 and HT29-MTX, respectively.
NOTE: (1) Caco-2 cells differentiate and form tight junctions once reaching confluency. It is extremely important to avoid over-confluency before trypsinization. Overgrowth of cells in flask can cause failure in cell detachment after trypsinization and/or cell clumps. (2) HT29-MTX cells are mucus-producing cells with high metabolic activity16. These features may cause a fast acidification of the cell culture media, especially if cells are at high density. HEPES buffer can be added to the cell culture medium (Table 1) to maintain the pH between 7 and 7.2. If the pH drops, medium can be exchanged when confluency is less than 50%. However, if confluency >50%, the cell culture must be split.
4. Assembly of a Multicompartment Cell Model Simulating the Gut Host-microbe Interface
NOTE: Complete the co-culture in double chamber wells (diameter 24 mm, pore size 0.4 μm; see Table of Materials).
- Add 1.5 mL of complete cell culture media to the apical compartment and 2 mL to the basal. Pre-incubate for 20–30 min to obtain even distribution of the cell suspension when seeding.
- Trypsinize the cell culture of Caco-2 and HT29-MTX as described in section 3. The trypsinization procedure must be accurately followed to achieve homogenous distribution of both cell lines, in a single cell suspension, without clumps.
- Count the viable cells as described in 3.1.8.
- Adjust the cell density to 6.5 x 104 cells/cm2 in a 90/10 proportion of Caco-2/HT29-MTX cells.
- Homogenize the cell suspensions and add the corresponding volume of Caco-2 and HT29-MTX cells to a pre-filled sterile container with supplemented cell culture media. Remove the pre-incubated media from the apical side of the chamber by aspiration.
- Gently mix the cell suspension by pipetting, and transfer 1.5 mL to the apical compartment of the chamber inserts. The seeding procedure requires a constant homogenization of the cell suspension, as cells tend to sediment. Depending on the experience of the user and working speed, cell suspension must be mixed after dispensing 1–3 wells.
- Move plates gently backward and forward and then right to left to right (5–10 times) to obtain an even spread of cells in the well. Transfer to incubator and repeat the movement of the plates.
- Maintain the co-culture of Caco-2/HT29-MTX cells for 15 days, refreshing apical and basal compartments every 2 days with supplemented DMEM. After this time, the cell culture media can be changed to supplemented DMEM without antibiotic/antimycotic solution.
- Maintain the system until 20–21 days post-seeding by refreshing the medium every 2 days.
- Measure the epithelial barrier integrity before starting the assay, using an Electrical Resistance System (see Table of Materials), following the manufacturer instructions.
- Ensure that TEER equipment is fully charged (>24 h) before starting the measurements.
- Disconnect the TEER equipment from the power supply and cover with a plastic autoclave bag. Make a hole in the bag to introduce the electrode and plug into the input port on the meter. Spray with 70% ethanol/water (v/v) before introducing the TEER equipment into the flow cabinet.
- To disinfect the electrode, immerse the electrode tips in 70% ethanol/water (v/v) solution for 15 min. Allow to air dry for 15 s. Rinse the electrode in pre-warmed cell culture media.
- Take the cells out of the incubator and allow cells to come to room temperature inside the flow cabinet.
- Make sure that the meter is disconnected from the charger. Set the mode switch to Ohms and turn the power switch On.
- Measure the cell resistance by immersing the electrode with the shorter tip in the insert and the longer tip out of the well. Keep the electrode at a 90° angle to the plate insert.
5. Bacterial Survival Following In Vitro Gastrointestinal Transit Conditions
NOTE: Prepare simulated digestion fluids following the protocol of Minekus et al. (2014)17, with the modifications described below. Prepare all the dilutions with ultrapure water. Filter-sterilize all solutions through a 0.22 µm filter and perform the digestion procedure under sterile conditions.
- Oral digestion:
- Place 3 mL of the bacterial community in a 50 mL sterile tube, mix with 3 mL of simulated saliva fluid (SSF), containing (in mmol L-1): KCl, 15.1; KH2PO4, 3.7; NaHCO3, 6.8; MgCl2(H2O)6, 0.5, (NH4) CO3, 0.06; HCl, 1.1; CaCl2(H2O)2, 0.75. Add 75 U/mL of α-amylase from human saliva Type IX-A and 2 g/L mucin from porcine stomach type II to the SSF.
- Incubate the mixture for 2 min, at 37 °C, and 100 rpm. Collect a 2 mL sample for DNA extraction and flow cytometry quantification (S1).
- Gastric digestion:
- Add 4 mL of simulated gastric fluid (SGF), containing (in mmol L-1): KCl, 6.9; KH2PO4, 0.9; NaHCO3, 25; NaCl, 47.2; MgCl2(H2O)6, 0.1, (NH4) CO3, 0.5; HCl, 15.6; CaCl2(H2O)2, 0.075. In addition, the SGF contained 2 g/L of mucin from porcine stomach type II.
- Measure the pH and adjust to pH 3 with 1 M HCl, if needed. Incubate at 37 °C and 100 rpm. Collect a 2 mL sample (S2).
- Small intestine digestion:
- Add 4 mL of simulated intestinal fluid (SIF) containing (in mmol L-1): KCl, 6.8; KH2PO4, 0.8; NaHCO3, 85; NaCl, 38.4; MgCl2(H2O)6, 0.33; HCl, 8.4; CaCl2(H2O)2, 0.3; to the digestion tube.
- Adjust to pH 7 with 1 M NaOH, if needed. Incubate at 37 °C and 100 rpm. Collect a 2 mL sample (S3).
6. Bacterial Colonization Ability Following In Vitro Gastrointestinal Transit Conditions
- Centrifuge 2 mL of the small intestine digestion, for 10 min at 2,650 x g.
- Remove the supernatant and mix the bacterial pellet with 5 mL of supplemented DMEM without antibiotic and antimycotic.
- Stain and quantify intact/damaged cells using a flow cytometer (see Table of Materials), as described by Hernandez-Sanabria et al. (2017)11.
- Adjust the cell density to 105 viable cells/mL by diluting in supplemented DMEM without antibiotic and antimycotic.
- Remove the apical medium of the transwell system and add 1.5 mL of the bacterial suspension. Co-culture the system for 2 h under general cell culture conditions (37 °C, 95% humidity, 5% CO2).
NOTE: This time can be extended up to 48 h, depending on the experimental protocol required. The co-culture can be maintained in a different incubator than that used for routine cell maintenance, to avoid contaminations.
- Measure the TEER values after incubation, to evaluate the integrity of the epithelial barrier as described in 4.11.
- Upon completing incubation time, remove apical media, and collect 0.5 mL for further analyses (S4). A subsample of media can be used for assessment of cell viability by Lactate Dehydrogenase (LDH) assay (see Table of Materials), following the manufacturer instructions.
- Add 0.5 mL of 10 mM N-acetylcysteine in HBSS (NAC-buffer) to solubilize the mucus produced by the HT29-MTX and to recover adhered bacteria. Incubate the plates at 37 °C for 1 h, under agitation (135 rpm, see Table of Materials).
- Recover the NAC-HBSS in a microcentrifuge tube (S5) and wash twice the cells with 1 mL DPBS.
- Add 0.5 mL of 0.5% Triton X-100 (w/v) on top of the monolayers, disrupt the cells by pipetting, recover the liquid and vortex for 1 min. Speed is crucial to avoid damaging the bacterial cells with the detergent.
- Centrifuge the cells for 5 min at 2,650 x g, and separate the supernatant (S6) and the pellet (S7).
7. Sample Analysis
NOTE: Analyse collected samples (S1-S7) to evaluate bacterial viability and adhesion potential to the intestinal cells, following a simulated gastrointestinal digestion.
- Bacterial viability: Pass samples S1-S5 twice through a 0.45 µm and quantify bacterial cells using live/dead cell staining and flow cytometry, as indicated in step 2.811.
- Adhesion potential: Prepare serial dilutions (-1 to -8) for S1-S6 and streak 10 µL in blood agar and modified BHI plates. Incubate at 37 °C under anaerobic conditions for 24–48 h. Plate the same volume of undiluted S7.
- Taxonomical identification of adhered bacteria:
- Pick individual colonies with a culture loop and resuspend each on 10 µL of nuclease-free water. Collect 4 µL of this suspension and use it as a template for PCR amplification of the 16S rRNA gene using the primers and conditions described in 2.7.1.
- Perform sequencing following the protocol in 2.7.3, and validation of the sequence using the procedure included in 2.7.4.
- Do further downstream analysis such as total DNA extraction, qPCR quantification and/or 16S rRNA amplicon sequencing, RNA extraction, and transcriptomic profiling as desired.
NOTE: Flow cytometry quantification was performed immediately after sampling. As a control for membrane-permeabilized cells, a sample exposed to 70 °C for 3 min was used. Background noise was assessed by measuring with flow cytometry the digestion fluids or samples obtained from the cell culture model without bacteria. Every sample was measured in triplicate.