We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.
The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barré syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.
Among the mosquitoes-borne viral diseases, Zika infection is one of the most clinically important1. The infection is caused by the flavivirus ZIKV which, in most cases, uses Aedes aegypti as its primary vector1,2. However, there are studies that have reported Aedes albopictus as a primary vector in some ZIKV outbreaks3. Although the infection is asymptomatic in many cases, the most common symptoms are fever, headache, and muscle pain2. There is no cure or vaccine available for ZIKV infection and the treatment available is mostly supportive. Recent outbreaks of ZIKV in South America led to severe cases of the disease and an approximately 20-fold increase in the neurodevelopmental disorder in fetuses named microcephaly2. As South America is an area endemic to several arboviruses such as DENV and West Nile virus, it is crucial to investigate whether prior immunity to other flavivirus(es) plays a role in the severity of ZIKV infections and disease.
Throughout the ages, viruses have evolved different strategies to increase their chance of infectivity in order to take over the host cell machinery and suppress the antiviral response. One of the most fascinating of all is the use of host pre-immune antibodies by viruses to enhance their replication with the phenomenon ADE4. ADE across all four serotypes of DENV has been well studied and demonstrated to increase viral titers and disease outcome5,6,7. In a previous in vitro study, we have shown significant enhancement of ZIKV replication due to pre-existing DENV immunity in primary human immune cells8. We also demonstrated a relevant in vitro method to quantify the capability of DENV pre-existing antibodies to enhance ZIKV replication in primary cells.
The protocol that we have developed uses human serum samples that are tested for DENV neutralization in TCID-50 or plaque reduction neutralization test (PRNT) assays, along with ZIKV in biologically relevant cells or cells derived from tissues that ZIKV can infect.
Access restricted. Please log in or start a trial to view this content.
Serum samples used in this study were obtained from human participants of a cohort from Columbia. Sample collection was approved by the internal review board (IRB) at Universidad de Pamplona (Columbia, South America) and Los Potios Hospital8. The samples were anonymously provided and investigators had no access to patient information. The serum samples were checked for the DENV serotype. The samples were further confirmed to neutralize DENV infection in vitro. For control, serum samples from healthy individuals (HC) from the USA were used.
NOTE: This protocol can be used to examine the ADE of ZIKV replication in any human cell type expressing the Fcγ receptor. The protocol consists of three parts (Figure 1).
1. Cell Seeding and Infection Setup
NOTE: For this particular study, human primary macrophages or U937 myelomonocytic cell line (ATCC-CRL-1593.2) were used. The cells were maintained in RPMI growth medium supplemented with 10% fetal bovine serum (FBS) at a 37 °C incubator with 5% carbon dioxide (CO2). All the steps were carried out in a biosafety level 2 (BSL-2) biosafety cabinet in sterile conditions.
2. RNA Extraction
3. Quantitative Real-time Polymerase Chain Reaction
NOTE: Quantitative real-time polymerase chain reaction (qRT-PCR) can be carried out by using any SYBR green mix which usually is composed of SYBR Green I dye, Taq DNA polymerase, deoxynucleotide triphosphates (dNTPs), and a passive dye. Any qPCR machine capable of the detection of SYBR green can be used to perform the reaction and acquire the data. For this experiment, a one-step RT-PCR kit was used which had a cocktail of SYBR Green I, ROX dye, Taq DNA polymerase, dNTPs, and an additional mixture of reverse transcriptase (refer to Table of Materials). The primers designed against the envelope region and used in this study to quantify ZIKV genomic levels are CCGCTGCCCAACACAAG for ZIKV-qF and CCACTAACGTTCTTTTGCAGACAT for ZIKV-qR. As a control, human β-2-microglobulin (B2M) was measured and used to normalize the expression of ZIKV (housekeeping gene). The primer sequences to quantify the B2M gene expression used in this study are CTCCGTGGCCTTAGCTGTG for B2M-qF and TTTGGAGTACGCTGGATAGCCT for B2M-qR. Ensure to put three technical replicates for each sample for both the ZIKV and the B2M genes. The setup of the RT-PCR is briefly described below.
Access restricted. Please log in or start a trial to view this content.
In Figure 1, there is a step-by-step diagrammatic illustration of all the steps involved to carry out the ADE protocol. It is a schematic diagram showing the whole procedure of ADE of ZIKV due to pre-existing immunity to DENV. Figure 2 shows how human serum samples were categorized into three different groups: DENV infection-confirmed samples are referred to as the DENV-infected group, DENV antibody-confirmed samples are referred...
Access restricted. Please log in or start a trial to view this content.
Cross-reactivity of DENV antibodies leading to the ADE of other DENV serotypes has hindered the development of an effective vaccine11. ZIKV belongs to the same family, Flaviviridae, and has a considerable homology with other flaviviruses, especially DENV12. The main target of neutralizing antibodies for both ZIKV and DENV is the envelope protein, which shares a very high structural and quaternary sequence homology between the two viruses13,
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to declare.
This work was generously supported by 1R21AI129881-01 (to T.M.C.), start-up funds from the National Emerging Infectious Diseases Laboratories, and the Boston University School of Medicine.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Fetal Bovine Serum | GEMINI | 100-106 | |
| iCycler | BioRad | 785BR02188 | Model No. CFX96 Optics Module |
| Microfuge 18 Centrifuge | Beckman Coulter | 367160 | |
| Nanodrop-1000 | Thermoscientific | 1072 | |
| Quantifast SYBR-One step RT-PCR kit | Qiagen | 204154 | Used for 1 step RT-qPCR |
| RNeasy RNA Isolation Kit | Qiagen | 74106 | Used for RNA extraction |
| RPMI-medium | Gibco | 11875093 |
Access restricted. Please log in or start a trial to view this content.