Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Kvantificeringen af antistof-afhængige Enhancement Zika virus i primære humane celler

doi: 10.3791/58691 Published: January 18, 2019

Summary

Vi beskriver en metode til at vurdere effekten af allerede eksisterende immunitet mod dengue virus på Zika virusinfektion ved hjælp af humant serum, primære menneskeceller og infektion kvantificering af kvantitative real-time polymerase kæde reaktion.

Abstract

Den nylige fremkomst af flavivirus Zika og neurologiske komplikationer, såsom Guillain-Barrés syndrom og microcephalus i spædbørn, har medført alvorlige offentlige sikkerhed bekymringer. Blandt risikofaktorerne udgør antistof-afhængige enhancement (ADE) den største trussel, som den seneste re-fremkomsten af Zika virus (ZIKV) er primært i områder, hvor befolkningen har været udsat og er i en tilstand af pre immunitet til andre nært beslægtede flavivira, specielt dengue virus (DENV). Her, beskriver vi en protokol for kvantificere effekten af humant serumantistoffer mod DENV på ZIKV infektion i primære humane celler eller cellelinjer.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Blandt de myg-bårne virussygdomme er Zika infektion en af de mest klinisk vigtige1. Infektionen er forårsaget af flavivirus ZIKV, som i de fleste tilfælde bruger Aedes aegypti som sin primære vektor1,2. Men der er undersøgelser, der har rapporteret Aedes albopictus som en primær vektor i nogle ZIKV udbrud3. Selv om infektion er asymptomatisk i mange tilfælde, er de mest almindelige symptomer feber, hovedpine og muskel smerter2. Der er ingen kur eller vaccine tilgængelig for ZIKV infektion og den behandling, der er mest støttende. De seneste udbrud af ZIKV i Sydamerika førte til alvorlige tilfælde af sygdommen og en ca 20-fold stigning i den neurologiske udvikling lidelse i fostre opkaldt mikrocefali2. Som Sydamerika er et område, der er endemiske for flere arboviruses som DENV og West Nile virus, er det vigtigt at undersøge, om forudgående immunitet over for andre flavivirus(es) spiller en rolle i sværhedsgraden af ZIKV infektioner og sygdomme.

Gennem tiderne, har virus udviklet forskellige strategier til at øge deres chance for infektivitet for at overtage vært celle maskiner og undertrykke den antivirale svar. Et af de mest fascinerende af alt er brug af vært pre immunsystemet antistoffer af virus til at forbedre deres replikering med fænomenet ADE4. ADE på tværs af alle fire serotyper af DENV er blevet godt undersøgt og dokumenteret at øge viral titers og sygdom resultatet5,6,7. I en tidligere in vitro-undersøgelse, har vi vist betydelig forøgelse af ZIKV replikering på grund af eksisterende DENV immunitet i primære menneskelige immunceller8. Vi viste også et relevante in vitro-metode for at kvantificere kapacitet af DENV allerede eksisterende antistoffer til at forbedre ZIKV replikering i primærelementer.

Den protokol, som vi har udviklet bruger menneskelige serumprøver, der er testet for DENV neutralisering i TCID-50 eller plaque reduktion neutralisationstest (PRNT) undersøgelser, sammen med ZIKV i biologisk relevante celler eller celler, der stammer fra væv, der ZIKV kan inficere.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Serumprøver anvendes i denne undersøgelse blev indhentet fra menneskelige deltagere af en kohorte fra Columbia. Stikprøven samling blev godkendt af interne review board (IRB) på Universidad de Pamplona (Columbia, Sydamerika) og Los Potios Hospital8. Prøverne blev anonymt leveret og efterforskerne havde ikke adgang til information af patienter. Serumprøver blev kontrolleret for DENV serotype. Prøverne blev yderligere bekræftet for at neutralisere DENV infektion in vitro-. For kontrol anvendtes serumprøver fra raske personer (HC) fra USA.

Bemærk: Denne protokol kan bruges til at undersøge ADE af ZIKV replikering i enhver menneskelig celletype udtrykker Fcγ receptoren. Protokollen består af tre dele (figur 1).

1. celle, såning og infektion Setup

Bemærk: For denne særlige undersøgelse, menneskelig primær makrofager eller U937 myelomonocytic cellelinje (ATCC-CRL-1593.2) blev brugt. Cellerne blev opretholdt i RPMI vækstmediet suppleret med 10% føtal bovint serum (FBS) ved 37 ° C kuvøse med 5% kuldioxid (CO2). Alle trin blev gennemført i en biosikkerhed på niveau 2 (BSL-2) biosikkerhed kabinet i sterile forhold.

  1. Frø 3 x 104 celler pr godt i en steril flad bund 96-brønd plade sammen med 100 µL af medium og placere dem i 37 ° C kuvøse med 5% CO2.
  2. Efter såning cellerne, tø serumprøver ved stuetemperatur og 10-fold serielle fortyndinger (dvs.1/10, 1/100, 1/1.000, 1/10.000) ved at blande prøver i serumfrit medium. Alikvot fortyndinger i en steril 96-brønd plade. Bruge virus uden serum som en yderligere kontrol.
  3. Optø ZIKV lager ved 37 ° C i et vandbad i 1-2 min. og hurtigt at overføre dem til is til fremtidig brug.
  4. Tilføje en 0,1 mangfoldighed af infektion (MOI) tilsvarende beløb af ZIKV stamme MR766 til serum delprøver.
    Bemærk: Sørg for, at fortyndingsfaktoren forbliver konstant og det samlede volumen er ~ 200 µL; Det er nok til tre af hver behandling. Holde tre brønde inficerede bruge som negativ kontrol for downstream analyse.
  5. Inkuber serum fortyndinger med tilføjet virus i 37 ° C kuvøse med 5% CO2 til 1 time for at tillade DENV antistoffer mod form komplekser med Zika virioner (for nemheds skyld, herefter benævnt "immunkomplekser").
  6. Opsug medierne fra de celler, der var seedet i flad bund 96-brønd plade. Cellerne vaskes med steril 1 x fosfatbufferet saltopløsning (1 x PBS).
  7. Tilsæt 50 µL af de immunkomplekser til hver brønd og Inkuber dem i 37 ° C kuvøse med 5% CO2 for 2 h.
  8. Efter 2 h inkubation, Aspirér medier indeholdende immunkomplekser fra cellerne, med en multikanal afpipetteres og vaske celler 2 x med 1 x PBS til helt at fjerne de immunkomplekser og eventuelle separate virioner.
  9. Tilsæt 100 µL af frisk komplet media suppleret med 10% FBS til hver godt og Inkuber celler i 37 ° C kuvøse med 5% CO2 for 48 h.

2. RNA udvinding

  1. Fjerne den 96-brønd plade fra rugemaskinen og overføre det til biosikkerhed kabinet.
  2. Opsug mediet, vaske celler 2 x med 1 x PBS, og Fortsæt til RNA udvinding.
    Bemærk: RNA kan udvindes af enhver metode (Se Tabel af materialer).
  3. Tilsæt 250 µL af celle lysisbuffer med 10% β-mercaptoethanol pr. brønd. Der afpipetteres buffer op og ned på mindst 5 x sammen med skrabe celler med pipette tip til at fremskynde proceduren lysering.
  4. Overføre cellelysater til nye, mærket, sterile 1,5 mL rør.
  5. Tilføje en lige stor del af 70% ethanol (250 µL). Pipetteres op og ned 4 x - 5 x indtil blandingen er klar.
  6. Overfør blandingen (~ 500 µL) til mærket silica-baserede kolonner i 2 mL indsamling rør og centrifugeres ved 15.000 x g for 30 s. udsmid flow gennem og holde kolonnerne i de samme samling rør.
  7. Tilføje 700 µL af wash buffer 1 til hver kolonne og centrifugeres ved 15.000 x g for 30 s. udsmid flow gennem og holde kolonnerne i de samme samling rør.
  8. Tilføje 500 µL af vaskebuffer 2 til hver kolonne og centrifugeres ved 15.000 x g for 30 s. udsmid supernatanten. Gentag dette trin 2 x.
  9. Overførsel kolonner til ny 2 mL indsamling rør og centrifugeres ved 15.000 x g i 2 min. Kontroller at silica-baserede kolonner bliver helt tør og der er ingen ethanol venstre fra vaskebuffer 2.
  10. Kassere 2 mL rør og placere kolonner i ny, sterile, mærket, 1,5 mL opsving rør.
  11. Tilføje forvarmet (42 ° C) 30 µL af RNase-fri vand på midten af hver kolonne og centrifugeres ved 15.000 x g i 1 min.
  12. Genskab den eluted RNA og kvantificere prøver, bruger et spektrofotometer ved en 260 nm bølgelængde.
    Bemærk: Ideelt, bestemme renheden af RNA ved beregning af forholdet mellem absorbans værdier på 260 nm og 280 nm. Oprensede RNA 260/280-forholdet er ideelt mellem 1,8-2,0.

3. kvantitative Real-time Polymerase Chain Reaction

Bemærk: Kvantitative real-time polymerase kædereaktion (qRT-PCR) kan foretages ved hjælp af enhver SYBR green-mix, der normalt er sammensat af SYBR Green jeg farve, Taq DNA polymerase, deoxynucleotide triphosphates (dNTP'er) og en passiv farvestof. Enhver qPCR maskine i stand til påvisning af SYBR green kan bruges til at udføre reaktionen og erhverve data. For dette eksperiment, en et-trins RT-PCR kit blev brugt som havde en cocktail af SYBR Green jeg ROX farvestof, Taq DNA polymerase, dNTP'er og en yderligere blanding af reverse transkriptase (Se Tabel af materialer). Primere designet mod regionen kuvert og anvendes i denne undersøgelse for at kvantificere ZIKV genomisk niveauer er CCGCTGCCCAACACAAG for ZIKV-qF og CCACTAACGTTCTTTTGCAGACAT for ZIKV-qR. Som kontrol, var menneskelige β-2-mikroglobulin (B2M) måles og bruges til at normalisere udtryk for ZIKV (husholdning gen). Primer sekvenser at kvantificere B2M genekspression anvendes i denne undersøgelse er CTCCGTGGCCTTAGCTGTG for B2M-qF og TTTGGAGTACGCTGGATAGCCT for B2M-qR. Sikre for at sætte tre tekniske flergangsbestemmelser for hver prøve for både ZIKV og B2M gener. Opsætningen af RT-PCR er kort beskrevet nedenfor.

  1. RT-PCR setup
    1. Brug 100 ng af RNA pr. prøve.
    2. Tilføj 1 µL af 10 µM bestande af både forward og reverse primere af et bestemt gen for hver reaktion.
    3. Tilføje 0,25 µL af reverse transkriptase mix pr. prøve.
    4. For hver enkelte reaktion, tilføje 12,5 µL af SYBR Green mix.
    5. Tilføje op til 25 µL vand. Gøre en master mix af alle de ovennævnte reagenser undtagen RNA, alikvot det i 96-brønd PCR plade, og tilføje RNA sidst.
    6. Forsegle pladen med gennemsigtig dobbeltklæbende tape.
    7. Der centrifugeres plade på 1.000 x g i 1 min. at blande reagenserne.
    8. Sæt pladen i qPCR maskine.
  2. RT-PCR profil
    Bemærk: Brug den i tabel 1viste RT-PCR-profil.
    1. Inkuber prøver ved 50 ° C i 10 min for at sikre syntesen af supplerende DNA (cDNA).
    2. Efter cDNA syntese, aktivere Taq DNA polymerase ved 95 ° C i 5 min.
    3. Udføre 40 cyklusser af denaturering ved 95 ° C til 10 s og primer udglødning og udvidelse ved 60 ° C i 30 s.
    4. Sætte yderligere smelte kurve trin (65° C) i sidste ende.
  3. Dataanalyse
    1. Overvåge smelte kurve ved at klikke på fanen smelte kurve i programmet bruges til at køre qPCR maskine, som ideelt set viser en enkelt peak i alle prøver for en bestemt gen at bekræfte tilstedeværelsen af kun én amplikon og en forstærkning værdi mere end 1,6 if algori THM mener 2 som værdien 100% forstærkning (forstærkning værdi varierer alt efter den algoritme, der bruges af qPCR maskine). Sørg for at bruge 0,5 ° C temperatur intervaller mellem trappe og minimum holde gang 10 s i smelte kurve protokol for optimale resultater.
    2. Efter at gøre sikker på der er klikke en enkelt amplikon og god forstærkning værdi, først på fanen kvantificering data at få en kvantitativ cyklus (Ct/Cq værdi) af hver prøve og eksportere til Microsoft Excel.
    3. Bruger et regneark, Beregn gennemsnittet af hver prøve ved hjælp af Ct værdi. Næste, klik på formler og marker gennemsnitlige. De gennemsnitlige CT værdierne af hver prøve (replikat) bruges til yderligere analyse.
    4. Dernæst beregnes ΔCt ved hjælp af formlen ΔCt = gennemsnitlig Ct af target gen - gennemsnitlig Ct af kontrol-genet (i dette tilfælde, ΔCt = gennemsnitlig Ct af ZIKV-genet - gennemsnitlig Ct af B2M gen).
    5. Beregn ΔΔCt for at normalisere dataene (i dette tilfælde, ΔΔCt = ΔCt ZIKV prøver - B2M prøver).
    6. Beregning af folden øge genekspression ved at skrive den formel 2^-(ΔΔCt) for hver enkelt ΔΔCt normaliseret værdi. Resultaterne af fold stigning til gennemførelse af statistiske test kan fås som beskrevet i tidligere undersøgelser9,10.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I figur 1er der en trinvis skematisk illustration af alle trin involveret til at udføre ADE-protokollen. Det er en skematisk diagram viser hele proceduren af ADE af ZIKV på grund af allerede eksisterende immunitet til DENV. Figur 2 viser, hvordan human serum prøver blev kategoriseret i tre forskellige grupper: DENV infektion-bekræftet prøver er benævnt gruppen DENV-inficerede, DENV antistof-bekræftet prøver er benævnt DENV-udsat gruppe, og sund enkeltes sera uden DENV-neutraliserende antistoffer eller RNA kaldes den raske kontrolgruppe (HC). (Figur 2).

Alle serumprøver fik lov til at gøre komplekser med ZIKV og blev derefter brugt til at inficere makrofag celler. Efter 48 timer efter infektion, var RNA ekstraheret og underkastes qRT-PCR. Repræsentative forsøget i figur 3 viser, at de fleste af de sera, der indeholder DENV serotype 1-4 antistoffer var købedygtig forøge ZIKV replikering på forskellige niveauer. Den største stigning i ZIKV titers blev fundet i makrofager behandlet med sera, der indeholder DENV serotype 2 og 4 antistoffer i forhold til serotype 1 og 3, som viste en relativt mindre induktion af ZIKV.

Figure 1
Figur 1 : Skematisk illustration af ADE protokol. En trinvis illustration viser alle trin involveret i den hele protokol. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Skematisk af forsøgsmetoden. Tre typer af sera blev inkuberet med Zika virus. Gruppen jeg bestod af DENV-RNA positive (DENV-inficeret) prøver. Gruppe II bestod af DENV-antistof positivt (DENV-eksponerede) prøver. Gruppe III bestod af prøver med ingen DENV RNA eller antistof (raske kontrolpersoner). Virus-sera blandingen blev føjet til menneskelige makrofager og infektionen kvantificeret. Dette tal er blevet ændret fra Londono-Renteria et al.8. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : DENV immun sera forbedrer ZIKV infektion i primære menneskelige makrofager. Menneskelige sera, der indeholder DENV antistoffer (DENV1-4 er serotype bekræftet, Col serotype ukendt) eller fra raske kontrolpersoner blev fortyndet 1:10-1:10,000 og inkuberes med ZIKV. Seraene er beskrevet i tabel 1. Primære isolerede menneskelige makrofager blev smittet med ZIKV alene eller med ZIKV-sera blandinger. (en) DENV1 antistof-holdige sera. (b) DENV2 antistof-holdige sera. (c) DENV3 antistof-holdige sera. (d) DENV4 antistof-holdige sera. (e) DENV-antistof sera fra colombianske individuelle 1. (f) DENV-antistof sera fra colombianske enkelte 2. Infektionen blev målt af qRT-PCR analyse på 48 timer efter infektion. Tekniske og biologiske replikater blev gjort i tre eksemplarer. Data er samlet, og fejllinjer angiver standardafvigelsen. Student's t-test og ANOVA blev brugt til statistisk analyse. P < 0,001. Dette tal er blevet ændret fra Londono-Renteria et al.8. Venligst klik her for at se en større version af dette tal.

Table 1
Tabel 1: Termisk profil af qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Krydsreaktivitet af DENV antistoffer fører til ADE af andre DENV serotyper har hindret udviklingen af en effektiv vaccine11. ZIKV tilhører den samme familie, Flaviviridae, og har en betydelig homologi med andre flavivira, især DENV12. Det vigtigste mål for neutraliserende antistoffer for både ZIKV og DENV er kuvert protein, som deler en meget høj strukturel og kvaternære sekvens homologi mellem to vira13,14,15. Det er blevet påvist, at før immunitet til enten DENV eller ZIKV kan øge infektion i de andre virus8,16.

Der er en række forskellige metoder, der anvendes til at kvantificere de viral infektivitet i ADE eksperimenter, lige fra plaque assays17, intracellulære virusantigen farvning af antistoffer konjugeret med fluorescerende farvestoffer og flowcytometri18 ,19. Disse assays er tidskrævende og ikke let at tilpasse til høj-gennemløb af flere prøver på samme tid. Vigtigere, de fleste af undersøgelserne bruges DENV-specifikke monoklonale antistoffer til at kontrollere deres effekt på ZIKV og undersøgt ADE i celle linjer kun20,21. I denne protokol beskriver vi en enkel, men effektiv metode, hvor vi brugte menneskelige pre immun serumprøver, der har en neutraliserende evne mod DENV, sammen med primære menneskelige immunceller til at undersøge effekten af patientens serum på ZIKV replikering ved at ansætte qRT-PCR. Denne metode er robust, relevante, og kan udføres i tre dage. Selvom de repræsentative resultater i dette manuskript viser sin ansøgning om ZIKV, kan denne protokol nemt ændres og anvendes til andre flavivira, som gul feber virus, dengue virus og West Nile-virus. En vigtig faktor til at overveje er, at denne protokol har en begrænsning i at skelne mellem modne og umodne viral RNA.

Under protokollen, er det kritisk at nøje overveje, når du udfører RNA ekstraktioner, sikre, at miljøet er RNase-fri under alle RNA håndtering trin. Desuden bør viral bestande optøet ved 37 ° C i et vandbad i 1-2 min. og straks lagt på is. Imidlertid bør virussen ikke opbevares på is for længe, så det kan miste sin smitteevne.

Tidligere resultater har vist, at denne protokol er meget praktisk og fleksibel til at håndtere et stort antal prøver og kan udføres i relativt mindre tid end andre metoder. Denne protokol har potentiale til at blive brugt som en nyttig analyse for fremtidige ADE undersøgelser.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at erklære.

Acknowledgments

Dette arbejde var generøst støttet af 1R21AI129881-01 (til T.M.C.), start-up midler fra de nationale nye smitsomme sygdomme laboratorier, og Boston University School of Medicine.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Kvantificeringen af antistof-afhængige Enhancement Zika virus i primære humane celler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter