Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Quantification de l’amélioration dépendante des anticorps du Virus dans les cellules humaines primaires Zika

doi: 10.3791/58691 Published: January 18, 2019

Summary

Les auteurs décrivent une méthode pour évaluer l’effet d’immunité préexistante contre le virus de la dengue sur l’infection par le virus Zika à l’aide de sérum humain, des cellules humaines primaires et quantification de l’infection par PCR en temps réel quantitative.

Abstract

L’émergence récente des flavivirus Zika et des complications neurologiques, tels que syndrome de Guillain-Barré et une microcéphalie chez les nourrissons, a apporté une sécurité publique sérieusement. Parmi les facteurs de risque, mise en valeur dépendante des anticorps (ADE) pose la menace la plus importante, comme la récente résurgence du virus Zika (ZIKV) est principalement dans les zones où la population a été exposée et se trouve dans un état d’immunité avant d’autres étroitement associés flavivirus, notamment le virus de la dengue (DENV). Nous décrivons ici un protocole de quantification de l’effet des anticorps de sérum humain contre le ministère de l’environnement sur l’infection ZIKV dans des cellules humaines primaires ou de lignées cellulaires.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Parmi les maladies virales transmises par les moustiques, Zika infection est l’un des plus cliniquement importants1. L’infection est causée par le flavivirus ZIKV qui, dans la plupart des cas, utilise l’Aedes aegypti comme son principal vecteur1,2. Cependant, il y a des études qui ont signalé l’Aedes albopictus comme vecteur principal dans certains foyers ZIKV3. Bien que l’infection est asymptomatique dans de nombreux cas, les symptômes les plus courants sont la fièvre, maux de tête et de douleurs musculaires2. Il n’y a aucun remède ou vaccin disponible pour une infection ZIKV et le traitement disponible est le plus souvent favorable. Les flambées récentes de ZIKV en Amérique du Sud a conduit à des cas graves de la maladie et une augmentation d’environ 20 fois dans le trouble neurologique du développement chez les foetus nommé microcéphalie2. Comme l’Amérique du Sud est une zone endémique de plusieurs arbovirus telles que le virus DENV et du Nil occidental, il est crucial d’étudier si l’immunité préalable aux autres flavivirus(es) joue un rôle dans la sévérité des infections de ZIKV et de la maladie.

Au cours des âges, les virus ont évolué différentes stratégies pour augmenter leurs chances d’infectiosité afin de prendre en charge le mécanisme cellulaire et de réprimer la réponse antivirale. L’un des plus fascinants de tous est l’utilisation d’anticorps préalablement immunisée hôte par des virus pour améliorer leur réplication avec le phénomène ADE4. ADE à travers les quatre sérotypes du ministère de l’environnement a été bien étudiée et démontrée pour augmenter des titres viraux et maladie issue5,6,7. Dans une précédente étude in vitro, nous avons montré une amélioration significative de la réplication en raison préexistants DENV l’immunité dans des cellules immunitaires humaines primaires8ZIKV. Nous avons aussi démontré une méthode in vitro pertinente afin de quantifier la capacité des anticorps préexistants DENV afin d’améliorer la réplication dans les cellules primaires ZIKV.

Le protocole que nous avons développé utilise des échantillons de sérum humain qui sont testés pour la neutralisation DENV DECT-50 ou test de neutralisation de réduction plaque (PRNT) épreuves biologiques, ainsi que ZIKV dans les cellules biologiquement pertinentes ou de cellules provenant de tissus qui peuvent infecter les ZIKV.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Des échantillons de sérum utilisés dans cette étude proviennent de participants humains d’une cohorte de la Colombie. Prélèvement de l’échantillon a été approuvé par la Commission de révision interne (CISR), Universidad de Pamplona (Colombie, Amérique du Sud) et l’hôpital de Los Potios8. Les échantillons ont été anonymement et les enquêteurs n’avaient pas accès à l’information du patient. Les échantillons de sérum ont été vérifiés pour le sérotype DENV. Les échantillons ont été confirmées à neutraliser l’infection DENV in vitro. Pour un contrôle, des échantillons de sérum de sujets sains (HC) des États-Unis ont été utilisés.

Remarque : Ce protocole peut être utilisé pour examiner la réplication ADE de ZIKV dans n’importe quel type de cellules humaines exprimant les récepteurs Fcγ. Le protocole se compose de trois parties (Figure 1).

1. cellules ensemencement et Infection d’installation

Remarque : Pour cette étude en particulier, les macrophages humains primaires ou de lignée U937 myélomonocytaire (ATCC-CRL-1593.2) ont été utilisés. Les cellules ont été maintenues dans le milieu RPMI additionné de 10 % sérum fœtal (SVF) dans un incubateur à 37 ° C avec 5 % de dioxyde de carbone (CO2). Tous les étapes ont été effectuées dans un biosafety level 2 armoire de biosafety (BSL-2) dans des conditions stériles.

  1. Semences 3 x 104 cellules par bien dans une plaque à 96 puits à fond plat stérile avec 100 µL de milieu et les placent dans un incubateur à 37 ° C avec 5 % de CO2.
  2. Après l’ensemencement les cellules, décongeler les échantillons de sérum à la température ambiante et faire 10 fois des dilutions successives (c'est-à-dire1/10, 1/100, 1/1 000, 1/10 000) en mélangeant les échantillons dans un milieu sans sérum. Aliquote les dilutions dans une plaque à 96 puits stérile. Utiliser le virus sans sérum comme un contrôle supplémentaire.
  3. Décongeler le stock ZIKV à 37 ° C au bain-marie pendant 1-2 min et transférez-la rapidement à la glace pour une utilisation future.
  4. Ajouter une multiplicité de 0,1 de montant équivalent d’infection (MOI) de la souche ZIKV MR766 pour les aliquotes de sérum.
    Remarque : Assurez-vous que le facteur de dilution reste constant et le volume total est ~ 200 µL ; C’est assez pour la géométrie de chaque traitement. Gardez trois puits non infectés à utiliser comme contrôle négatif pour analyse en aval.
  5. Incuber les dilutions du sérum avec le virus ajouté dans un incubateur à 37 ° C avec 5 % de CO2 pendant 1 h afin de permettre les anticorps DENV pour former des complexes avec les virions Zika (pour plus de commodité, ci-après dénommé « complexes immuns »).
  6. Aspirer les médias des cellules qui ont été ensemencés dans la plaque à 96 puits à fond plat. Laver les cellules avec stérile 1 x solution saline tamponnée au phosphate (solution de 1 PBS x).
  7. Ajouter 50 µL des complexes immuns dans chaque puits et incuber à eux dans un incubateur à 37 ° C pendant 2 h avec 5 % de CO2 .
  8. Après 2 h d’incubation, aspirer les médias contenant les complexes immuns, des cellules, à l’aide d’un multicanal pipeter et laver les cellules 2 x avec du PBS 1 x pour supprimer complètement les complexes immuns et toute seules des virions.
  9. Ajouter 100 µL de supports complets neufs additionnés de 10 % FBS à chaque puits et incuber les cellules dans un incubateur à 37 ° C avec 5 % de CO2 pendant 48 h.

2. Extraction de l’ARN

  1. Sortir la plaque à 96 puits de l’incubateur et transférez-la sur la biosécurité du cabinet.
  2. Aspirer les médias, laver les cellules 2 x avec du PBS 1 x et de procéder à l’extraction de l’ARN.
    Remarque : ARN peut être extrait par n’importe quelle méthode de choix (voir la Table des matières).
  3. Ajouter 250 µL de tampon de lyse cellulaire avec 10 % de β-mercaptoéthanol / puits. Déposer le tampon et descendre au moins 5 fois ainsi que de rayer les cellules avec l’embout de la pipette pour accélérer la procédure de lyse.
  4. Transférer les lysats cellulaires à tubes neuf, étiqueté, stériles de 1,5 mL.
  5. Ajouter une quantité égale de l’éthanol à 70 % (250 µL). Pipette et descendre 4 x - 5 x jusqu'à ce que le mélange soit clair.
  6. Transférer le mélange (~ 500 µL) à marqué des colonnes à base de silice dans les tubes de prélèvement de 2 mL et centrifuger à 15 000 x g pendant 30 s. jeter le débit à travers et garder les colonnes dans les tubes de prélèvement même.
  7. Ajouter 700 µL de tampon de lavage 1 à chaque colonne et centrifuger à 15 000 x g pendant 30 s. jeter le débit à travers et garder les colonnes dans les tubes de prélèvement même.
  8. Ajouter 500 µL de tampon de lavage 2 dans chaque colonne et centrifuger à 15 000 x g pour 30 s. jeter le surnageant. Répétez cette étape 2 x.
  9. Transfert à gauche les colonnes de nouveaux tubes de prélèvement de 2 mL et centrifuger à 15 000 x g pendant 2 min. veiller à ce que les colonnes à base de silice deviennent complètement secs et il n’y a aucun éthanol du tampon de lavage 2.
  10. Jeter les tubes de 2 mL et placer les colonnes de nouveau, stérile, étiqueté, tubes de récupération de 1,5 mL.
  11. Ajouter préchauffée (42 ° C) 30 µL d’eau exempte de RNase au centre de chaque colonne et centrifuger à 15 000 x g pendant 1 min.
  12. Récupérer l’ARN éluée et quantifier les échantillons, à l’aide d’un spectrophotomètre à une longueur d’onde nm 260.
    Remarque : Idéalement, déterminer la pureté de l’ARN en calculant le rapport entre les valeurs d’absorption à 260 nm et 280 nm. Ratio 260/280 de l’ARN purifié est idéalement entre 1,8 et 2,0.

3. quantitative Real-Time Polymerase Chain Reaction

Remarque : Quantitative PCR en temps réel (qRT-PCR) peut être réalisée en utilisant n’importe quel mélange SYBR green, qui habituellement se compose de SYBR Green I teindre, Taq DNA polymerase, désoxyribonucléosides triphosphates (dNTPs) et un colorant passif. N’importe quelle machine de qPCR capable de la détection de SYBR green permet d’effectuer la réaction et se procurer les données. Pour cette expérience, a été utilisé un kit de RT-PCR en une étape, qui avait un cocktail de SYBR Green I, ROX colorant, Taq DNA polymerase, dNTPs et un mélange additionnel de la transcriptase inverse (voir Table des matières). Les amorces conçu contre la région de l’enveloppe et utilisées dans cette étude pour quantifier les niveaux génomiques ZIKV sont CCGCTGCCCAACACAAG pour ZIKV-qF et CCACTAACGTTCTTTTGCAGACAT pour ZIKV-qR. Comme contrôle, β-2-microglobuline humaine (B2M) a été mesurée et utilisée pour normaliser l’expression de ZIKV (gène de ménage). Les séquences d’amorces pour quantifier l’expression de gène de B2M utilisée dans cette étude sont CTCCGTGGCCTTAGCTGTG pour B2M-qF et TTTGGAGTACGCTGGATAGCCT de B2M-qR. Vérifier que vous mettez trois répétitions techniques pour chaque échantillon pour le ZIKV et les gènes de B2M. Le programme d’installation de la RT-PCR est brièvement décrite ci-dessous.

  1. Installation de RT-PCR
    1. Utilisez 100 ng d’ARN par exemple.
    2. Ajouter 1 µL de 10 stocks µM d’amorces avant et arrière d’un gène particulier de chaque réaction.
    3. Ajouter 0,25 µL du mélange de la transcriptase inverse par échantillon.
    4. Pour chaque réaction individuelle, ajouter 12,5 µL du mélange de SYBR Green.
    5. Ajouter jusqu'à 25 µL d’eau. Faire un master mélanger tous les réactifs susmentionnés sauf RNA, aliquote dans la plaque PCR 96 puits et ajoutez les RNA dernière.
    6. Sceller la plaque avec un ruban adhésif transparent.
    7. Centrifuger la plaque à 1 000 x g pendant 1 min mélanger les réactifs.
    8. Mettre la plaque dans la machine de qPCR.
  2. Profil de RT-PCR
    Remarque : Utiliser le profil de RT-PCR montré tableau 1.
    1. Incuber les échantillons à 50 ° C pendant 10 min afin d’assurer la synthèse de l’ADN complémentaire (ADNc).
    2. Après la synthèse de cDNA, activer l’ADN polymérase de Taq à 95 ° C pendant 5 min.
    3. Effectuez 40 cycles de dénaturation à 95 ° C pour 10 s et apprêt recuit et extension à 60 ° C pendant 30 s.
    4. Mettre l’étape de courbe de fusion supplémentaires (65° C) en fin de compte.
  3. Analyse des données
    1. Suivre la courbe de fusion en cliquant sur l’onglet courbe de fusion dans le programme utilisé pour faire fonctionner la machine de qPCR, qui, idéalement, montre un pic unique dans tous les échantillons pour un gène particulier confirmer la présence de seulement un amplicon et une amplification plus de 1,6 cas l’algori THM considère que la valeur d’amplification de 100 % (la valeur d’amplification varie selon l’algorithme utilisé par la machine de qPCR) 2. Assurez-vous d’utiliser des tranches de température de 0,5 ° C entre les étapes et un minimum de temps de 10 de retenue s dans le protocole de courbe de fonte, pour des résultats optimaux.
    2. Après avoir vérifié qu’il y a un amplicon unique et une valeur de bonne amplification, cliquez d’abord sur l’onglet données de quantification pour obtenir un cycle quantitatif (valeur Ct/Cq) de chaque échantillon et exporter vers Microsoft Excel.
    3. À l’aide d’un tableur, calculer la moyenne de chaque échantillon à l’aide de la valeur de Ct. Ensuite, cliquez sur les formules puis sélectionnez la moyenne. Les valeurs de CT moyens de chaque échantillon (réplication) sont utilisées pour une analyse ultérieure.
    4. Puis, calculez le ΔCt à l’aide de la formule ΔCt = moyenne Ct du gène cible - moyenne Ct du gène contrôle (dans ce cas, ΔCt = moyenne Ct du gène ZIKV - Ct du gène B2M en moyenne).
    5. Calculer ΔΔCt pour normaliser les données (dans ce cas, ΔΔCt = ΔCt ZIKV échantillons - B2M).
    6. Calculer que le pli augmente l’expression des gènes en tapant la formule 2^-(ΔΔCt) pour chaque valeur unique ΔΔCt normalisé. Les résultats de la multiplication d’effectuer des tests statistiques peuvent être obtenus comme décrit dans les précédentes études9,10.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dans la Figure 1, il y a une illustration schématique étape par étape de toutes les étapes nécessaires effectuer le protocole de l’ADE. C’est un schéma montrant l’ensemble de la procédure de l’ADE de ZIKV en raison de l’immunité préexistante à DENV. La figure 2 montre comment sériques échantillons ont été classées en trois groupes différents : échantillons d’infection confirmés DENV sont appelées le groupe DENV-infecté, DENV anticorps-confirmé échantillons sont dénommé le groupe exposés au ministère de l’environnement et en bonne santé sérums d’individus sans anticorps neutralisant DENV ou RNA sont appelés le groupe témoin en bonne santé (HC). (Figure 2).

Tous les échantillons de sérum ont été autorisés à faire des complexes avec les ZIKV et ont ensuite été utilisés pour infecter les cellules macrophages. Après 48 h après l’infection, ARN a été extrait et soumis à qRT-PCR. L’expérience de représentant à la Figure 3 montre que la plupart des sérums contenant des anticorps du sérotype 1 à 4 DENV étaient en mesure d’améliorer la réplication ZIKV à différents niveaux. La plus forte hausse des titres ZIKV a été trouvée dans les macrophages traités avec sérum contenant des anticorps sérotype 2 et 4 DENV comparativement à sérotype 1 et 3, qui a montré une induction de relativement moins de ZIKV.

Figure 1
Figure 1 : Illustration schématique du protocole ADE. Une illustration étape par étape montre toutes les étapes impliquées dans le protocole entier. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Schéma de la procédure expérimentale. Trois types de sérums ont été incubées avec virus Zika. Groupe qu'i est constitué des échantillons positifs (DENV-infectés) de DENV-RNA. Groupe II comprenait les échantillons positifs DENV-anticorps (DENV-exposés). Groupe III comprenait des échantillons sans ARN DENV ou anticorps (témoins sains). Le mélange de virus-sérums a été ajouté à des macrophages humains et l’infection quantifié. Ce chiffre a été modifié par Londono-Renteria et al.,8. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Infection ZIKV dans les macrophages humains primaires améliore les antisérums DENV. Sérum humain contenant des anticorps DENV (DENV1-4 sont confirmé de sérotype, Col sérotype inconnu) ou de contrôles sains ont été dilués 01:10 à 1/10 000 et incubées avec ZIKV. Les sérums sont décrites dans le tableau 1. Primaire des macrophages humains isolés ont été infectés avec ZIKV seul ou avec les mélanges de sérums-ZIKV. (un) DENV1 sérum contenant des anticorps. (b) DENV2 sérum contenant des anticorps. (c) DENV3 sérum contenant des anticorps. (d) DENV4 sérum contenant des anticorps. (e), DENV-anticorps sérums de colombien individuelles 1. (f), DENV-anticorps sérums de colombien 2 individuels. L’infection a été mesurée par analyse qRT-PCR 48 h après l’infection. Réplicats techniques et biologiques ont été réalisés en trois exemplaires. Les données sont regroupées et les barres d’erreur indiquent la déviation standard. De Student t-test et analyse de la variance ont été utilisés pour l’analyse statistique. P < 0,001. Ce chiffre a été modifié par Londono-Renteria et al.,8. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Table 1
Tableau 1 : Le profil thermique de qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Réaction croisée des anticorps DENV conduisant à l’ADE des autres sérotypes DENV a entravé le développement d’un vaccin efficace11. ZIKV appartient à la même famille des Flaviviridae et a une grande homologie avec autres flavivirus, surtout DENV12. La principale cible des anticorps neutralisants pour ZIKV et DENV est la protéine de l’enveloppe, qui partage une homologie de séquence de structurelles et quaternaire très élevé entre les deux virus13,14,15. Il a été démontré que l’immunité préalable à DENV ou ZIKV peut renforcer l’infection des autres8,virus16.

Il y a un certain nombre de différentes méthodes utilisées pour quantifier l’infectivité virale dans les expériences de l’ADE, allant des essais de plaque17, antigène viral intracellulaire de coloration à l’aide d’anticorps conjugués avec les colorants fluorescents et cytométrie en flux18 ,,19. Ces tests sont fastidieux et pas facilement adaptable pour le haut débit d’échantillons multiples en même temps. Ce qui est important, la plupart des études DENV spécifique des anticorps monoclonaux permettant de vérifier leur effet sur ZIKV et examiné l’ADE dans cellule lignes seulement20,21. Dans ce protocole, nous décrivons une méthode simple mais efficace dans lequel nous avons utilisé des échantillons de sérum pré immunitaire humain qui ont une capacité neutralisante contre le ministère de l’environnement, ainsi que de cellules immunitaires humaines primaires, afin d’examiner l’effet du sérum du patient sur la réplication ZIKV en employant qRT-PCR. Cette méthode est robuste, pertinent et peut être complétée en trois jours. Bien que les résultats représentatifs dans ce manuscrit montrent sa demande de ZIKV, ce protocole peut être facilement modifié et utilisé pour les autres flavivirus, comme le virus de la fièvre jaune, virus de la dengue et le virus du Nil occidental. Un facteur important à considérer est que ce protocole a une limitation dans la distinction entre l’ARN viral mature et immature.

Pendant le protocole, il est essentiel d’examiner attentivement lorsque vous effectuez les extractions de RNA, veiller à ce que l’environnement soit libre de RNase pendant tous l’ARN étapes de manutention. En outre, les stocks virales devraient être décongelés à 37 ° C au bain-marie pendant 1-2 min et mettre immédiatement sur la glace. Toutefois, le virus ne devrait pas être conservé sur la glace pour longtemps que, ensuite, il peut perdre son infectiosité.

Les résultats antérieurs ont démontré que ce protocole est très pratique et adaptable pour gérer un grand nombre d’échantillons et peut être complété en relativement moins de temps que d’autres méthodes. Ce protocole a le potentiel d’être utilisé comme un test utile pour de futures études d’ADE.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à déclarer.

Acknowledgments

Ce travail a été généreusement soutenu par 1R21AI129881-01 (de T.M.C.), des fonds de démarrage de Emerging Infectious maladies laboratoires nationaux et l’école de médecine de l’Université de Boston.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Quantification de l’amélioration dépendante des anticorps du Virus dans les cellules humaines primaires Zika
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter