Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Kvantifisering av antistoff avhengige forsterkning av Zika viruset i primære menneskelige celler

doi: 10.3791/58691 Published: January 18, 2019

Summary

Vi beskriver en metode for å vurdere effekten av eksisterende immunitet mot dengue virus på Zika virusinfeksjon med humant serum, primære menneskelige celler, og infeksjon kvantifisering av kvantitative sanntid polymerasekjedereaksjons.

Abstract

Den nylige framveksten av flavivirus Zika og nevrologiske komplikasjoner, som Guillain-Barrés syndrom og microcephaly hos spedbarn, har brakt alvorlige offentlig sikkerhet bekymringer. Blant risikofaktorer utgjør antistoff avhengige ekstrautstyr (ADE) den viktigste trusselen, siste nytt fremveksten av Zika viruset (ZIKV) er primært i områder der befolkningen har blitt utsatt, og er i en tilstand av pre immunitet til andre nært beslektede flaviviruses, spesielt dengue virus (DENV). Her beskriver vi en protokoll for å kvantifisere effekten av humant serum antistoffer mot DENV på ZIKV infeksjon i primære menneskelige celler eller linjer.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Blant de mygg-borne virale sykdommene er Zika infeksjon en av de mest klinisk viktige1. Infeksjonen forårsakes av flavivirus ZIKV som oftest bruker Aedes aegypti som sin primære vektor1,2. Men finnes det studier som har rapportert Aedes albopictus som en primær vektor i noen ZIKV utbrudd3. Men infeksjonen er asymptomatisk i mange tilfeller, er de vanligste symptomene feber, hodepine og muskel smerter2. Det er ingen kur eller vaksine tilgjengelig for ZIKV infeksjon og behandling tilgjengelig er mest støttende. Nylige utbrudd av ZIKV i Sør-Amerika førte til alvorlige tilfeller av sykdommen og en ca 20-fold økning i neurodevelopmental uorden i fostre kalt microcephaly2. Sør-Amerika er et område som er endemisk til flere arboviruses som DENV og West Nile virus, er det avgjørende å undersøke om tidligere immunitet mot andre flavivirus(es) spiller en rolle i alvorlighetsgraden av ZIKV infeksjoner og sykdom.

Gjennom tidene har virus utviklet seg ulike strategier for å øke sjansen infectivity for å overta verten celle maskiner og undertrykke antiviral svaret. En av de mest fascinerende av alt er bruk av vert pre immun antistoffer av virus å forbedre deres replikering med fenomenet ADE4. ADE over alle fire serotyper av DENV har vært godt studert og bevist å øke viral titers og sykdom utfallet5,6,7. I en tidligere i vitro studie, har vi vist betydelig forbedring av ZIKV replikering på grunn av eksisterende DENV immunitet i primære menneskelige immunceller8. Vi også demonstrert en relevant i vitro metode for å kvantifisere evnen til å DENV eksisterende antistoffer til å forbedre ZIKV replikering i primære celler.

Protokollen som vi har utviklet bruker koagulasjon som testes for DENV nøytralisering i TCID-50 eller plakk reduksjon nøytralisering test (PRNT) søk, sammen med ZIKV i biologisk relevante celler eller celler avledet fra vev som ZIKV kan infisere.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Serumprøver brukt i denne studien ble innhentet fra menneskelige deltakere på en kohort fra Columbia. Prøvetaking ble godkjent av intern gjennomgang board (IRB) på Universidad de Pamplona (Columbia, Sør-Amerika) og Los Potios Hospital8. Prøvene er anonymt levert og etterforskere har ikke tilgang til pasientinformasjon. Serumprøver ble sjekket for DENV serotype. Prøvene ble ytterligere bekreftet for å nøytralisere DENV infeksjon i vitro. For kontrollen ble serumprøver fra friske individer (HC) fra USA brukt.

Merk: Denne protokollen kan brukes til å undersøke ADE av ZIKV replikering i en menneskelig celle type uttrykke Fcγ reseptoren. Protokollen består av tre deler (figur 1).

1. celle såing og infeksjon oppsett

Merk: For denne studien, menneskelige primære makrofager eller U937 myelomonocytic celle linje (ATCC-CRL-1593.2) ble brukt. Cellene ble opprettholdt i RPMI vekst medium med 10% fosterets bovin serum (FBS) på en 37 ° C inkubator med 5% karbondioksid (CO2). Alle trinnene ble utført i en biosafety nivå 2 (BSL-2) biosikkerhet regjering sterile forhold.

  1. Frø 3 x 104 celler per godt i et sterilt flat bunn 96-brønns plate med 100 µL av medium og plassere dem i 37 ° C inkubator med 5% CO2.
  2. Etter seeding cellene, tine serumprøver ved romtemperatur og gjøre 10 ganger føljetong fortynninger (dvs.1/10 1/100 1/1000, 1/10 000) ved å blande prøvene i serum-free medium. Aliquot fortynninger i et sterilt 96-brønns plate. Bruk viruset uten serum som en ekstra kontroll.
  3. Tine ZIKV aksjen på 37 ° C i et vannbad i 1-2 min, og raskt overføre dem til is for fremtidig bruk.
  4. Legge til et 0,1 mangfold av infeksjon (MOI) tilsvarende mengde ZIKV belastning MR766 serum dele.
    Merk: Kontroller at fortynningsfaktoren forblir konstant og det totale volumet er ~ 200 µL; Det er nok for triplicates hver behandling. Hold tre brønner infisert bruke som negativ kontroll for nedstrøms.
  5. Inkuber serum fortynninger av ekstra viruset i 37 ° C inkubator med 5% CO2 for 1 h for å tillate DENV antistoffer til skjemaet komplekser med Zika virions (for bekvemmelighet, heretter kalt "immun komplekser").
  6. Sug opp media fra cellene som ble sådd i 96-brønnen flat-bunnplaten. Vask cellene med sterilt 1 x fosfat-bufret saltvann (1 x PBS).
  7. Legg til 50 µL av immun komplekser hver brønn og ruge dem i 37 ° C inkubator med 5% CO2 2 h.
  8. Etter 2 timer med inkubasjon Sug opp mediet som inneholder immun komplekser fra celler, ved å bruke en Pipetter, og vask cellene 2 x med 1 x PBS fjerne immun komplekser og noen ledige virions.
  9. Legg 100 µL frisk komplett medier med 10% FBS hver godt og ruge cellene i 37 ° C inkubator med 5% CO2 48 h.

2. RNA utvinning

  1. Fjern 96-brønns platen settefiskanlegg og overføre den til biosikkerhet kabinett.
  2. Sug opp media, vask cellene 2 x med 1 x PBS, og videre til RNA utvinning.
    Merk: RNA kan hentes av alle metoden for valg (se Tabell for materiale).
  3. Legge til 250 µL av cellen lyseringsbuffer med 10% β-mercaptoethanol per brønn. Pipetter bufferen opp og ned minst 5 x sammen med skrape cellene med Pipetter spissen å fremskynde lysis prosedyren.
  4. Overføre celle lysates til nye, merket, bakteriefri 1.5 mL rør.
  5. Legge til en lik mengde 70% etanol (250 µL). Pipetter opp og ned 4 x - 5 x til blandingen er klart.
  6. Overføre blanding (~ 500 µL) til merket silisium-baserte kolonner i 2 mL samling rør og sentrifuge 15.000 x g for 30 s. kast flyten gjennom og holde kolonnene i samme samling rør.
  7. Legge til 700 µL av vaskebuffer 1 hver kolonne og sentrifuge 15.000 x g for 30 s. kast flyten gjennom og beholde kolonnene i samme samling rør.
  8. Legg til 500 µL av vaskebuffer 2 til hver kolonne og sentrifuger 15.000 x g for 30 s. kast nedbryting. Gjenta dette trinnet 2 x.
  9. Overføring kolonnene til nye 2 mL samling rør og sentrifuge 15.000 x g for 2 min. kontrollerer at silisium-baserte kolonner får helt tørt og det er ingen etanol igjen fra vaskebuffer 2.
  10. Forkaste 2 mL rør og plasser kolonnene i ny, sterile, merket, 1,5 mL utvinning rør.
  11. Legg til prewarmed (42 ° C) 30 µL av RNase-fritt vann på midten av hver kolonne og sentrifuge 15.000 x g for 1 min.
  12. Gjenopprette eluted RNA og kvantifisere prøvene, bruker et spektrofotometer på en 260 nm bølgelengde.
    Merk: Ideelt sett bestemme renheten av den ved å beregne forholdet mellom absorbansen verdiene på 260 nm og 280 nm. Renset RNA 260/280 forholdet er ideelt mellom 1,8-2,0.

3. kvantitativ sanntid polymerasekjedereaksjons

Merk: Kvantitativ sanntids polymerasekjedereaksjons (qRT-PCR) kan utføres ved hjelp av noen SYBR grønne blanding som vanligvis består av SYBR Green jeg fargestoff, Taq DNA polymerase, deoxynucleotide triphosphates (dNTPs) og en passiv fargestoff. Enhver qPCR maskin kan gjenkjenning av SYBR grønne kan brukes til å utføre reaksjonen og hente data. For dette eksperimentet, en ettrinns RT PCR kit ble brukt som hadde en cocktail av SYBR Green jeg ROX fargestoff, Taq DNA polymerase, dNTPs og en ekstra blanding av revers transkriptase (se Tabell for materiale). Grunning mot regionen konvolutt og brukes i denne studien for å kvantifisere ZIKV genomisk nivåer er CCGCTGCCCAACACAAG for ZIKV-qF og CCACTAACGTTCTTTTGCAGACAT for ZIKV-qR. Som en kontroll, ble menneskelige β-2-microglobulin (B2M) målt og brukes til å normalisere uttrykk for ZIKV (housekeeping gen). Primer sekvenser å kvantifisere B2M gene uttrykket som brukes i denne studien er CTCCGTGGCCTTAGCTGTG for B2M-qF og TTTGGAGTACGCTGGATAGCCT for B2M-qR. Sikre for å sette tre tekniske gjentak for hver prøve både i ZIKV og B2M gener. Oppsettet av RT-PCR er kort beskrevet nedenfor.

  1. RT PCR oppsett
    1. Bruk 100 ng av per prøve.
    2. Legge til 1 µL fra 10 µM bestander av både forover og bakover grunning av et bestemt gen for hver reaksjon.
    3. Legge til 0,25 µL av revers transkriptase blanding per prøve.
    4. For hver personlige reaksjon, legge 12.5 µL SYBR grønn mix.
    5. Legg opptil 25 µL av vann. Gjøre en master blande alle de ovennevnte reagenser unntatt RNA, aliquot den i 96-brønnen PCR plate, og Legg til RNA sist.
    6. Forsegle platen med gjennomsiktig teip.
    7. Sentrifuge platen på 1000 x g for 1 min å blande reagenser.
    8. La platen i maskinen qPCR.
  2. RT PCR profil
    Merk: Bruk den RT PCR-profilen vises i tabell 1.
    1. Inkuber prøvene ved 50 ° C i 10 min slik syntese av komplementære DNA (cDNA).
    2. Etter cDNA syntese, aktivere Taq DNA polymerase ved 95 ° C i 5 minutter.
    3. Utføre 40 sykluser av rødsprit 95 ° c for 10 s og primer avspenning og utvidelse ved 60 ° C i 30 s.
    4. Sette det ekstra smelte kurve trinnet (65° C) til slutt.
  3. Dataanalyse
    1. Overvåke smelte kurven ved å klikke kategorien smelte kurve i programmet brukes til å kjøre qPCR maskinen, som ideelt sett viser en enkelt topp i alle prøvene for et bestemt gen å bekrefte tilstedeværelse av bare en amplicon og en forsterkning verdi mer enn 1.6 Hvis algori thm vurderer 2 som 100% forsterkning verdien (forsterkning verdien varierer etter algoritmen som brukes av qPCR maskinen). Bruk 0,5 ° C temperatur intervaller mellom trinn og minimum holder tid 10 s i smelte kurve protokollen, for optimale resultater.
    2. Etter at det er klikker et enkelt amplicon og gode forsterkningen verdi, først på kategorien for kvantifisering data for å få en kvantitativ syklus (Ct/Cq verdi) av hver prøve og Eksporter til Microsoft Excel.
    3. Bruker et regneark, beregne gjennomsnittet for hvert utvalg med Ct verdien. Deretter Klikk i formlene og velg gjennomsnittet. Gjennomsnittlig CT verdiene for hvert utvalg (kopiere) brukes for videre analyse.
    4. Deretter beregner ΔCt ved hjelp av formelen ΔCt = gjennomsnittlig Ct av målet genet - gjennomsnittlig Ct av kontroll genet (i dette tilfellet ΔCt = gjennomsnittlig Ct av ZIKV genet - gjennomsnittlig Ct av B2M genet).
    5. Beregne ΔΔCt å normalisere data (i dette tilfellet, ΔΔCt = ΔCt ZIKV samples - B2M prøver).
    6. Beregne fold øke genuttrykk ved å skrive inn formelen 2^-(ΔΔCt) for hver enkelt ΔΔCt normalisert verdi. Resultatene av fold økning utføre statistiske tester kan fås som beskrevet i tidligere studier9,10.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I figur 1er det en trinnvis diagrammatisk illustrasjon av alle trinnene involveredd utføre ADE protokollen. Det er en skjematisk diagram viser hele prosedyren av ADE av ZIKV på grunn av eksisterende immunitet til DENV. Figur 2 viser hvordan humant serum prøver ble kategorisert i tre ulike grupper: DENV infeksjon bekreftet prøver kalles DENV-infisert gruppen, DENV antistoff-bekreftet prøvene er referert til som DENV-eksponerte gruppen, og sunt individene sera uten DENV-nøytralisere antistoffer eller RNA kalles sunn (HC) kontrollgruppen. (Figur 2).

Alle serumprøver ble tillatt å gjøre komplekser med ZIKV og ble da brukt å infisere macrophage celler. Etter 48 timer postinfection, var RNA trukket ut og utsatt for qRT PCR. Representant eksperimentet i Figur 3 viser at de fleste av sera inneholder DENV serotype 1 til 4 antistoffer kunne forbedre ZIKV replikering på ulike nivåer. Den høyeste økningen i ZIKV titers ble funnet i makrofager behandlet med sera inneholder DENV serotype 2 og 4 antistoffer i forhold til serotype 1 og 3, som viste en relativt mindre induksjon av ZIKV.

Figure 1
Figur 1 : Diagrammatisk illustrasjon av ADE protokollen. En trinnvis illustrasjonen viser alle trinnene involvert i hele protokollen. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Skjematisk av den eksperimentelle prosedyren. Tre typer sera ble inkubert med Zika virus. Gruppe jeg bestod av DENV-RNA positive (DENV-infisert) prøver. Gruppen II besto av DENV-antistoff positive (DENV-utsatt) prøver. Gruppe III besto av prøver uten DENV RNA eller antistoff (sunn kontroller). Virus-sera blandingen ble lagt til menneskelig makrofager og infeksjon kvantifisert. Dette tallet er endret fra Londono-Renteria et al.8. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : DENV immune sera forbedrer ZIKV infeksjon i primære menneskelige makrofager. Menneskelige sera med DENV antistoffer (DENV1-4 er serotype bekreftet, Col serotype ukjent) eller fra sunn kontroller var fortynnes 1:10 til 1:10,000, og inkubert med ZIKV. Sera er beskrevet i tabell 1. Primære isolert menneskelige makrofager var infisert med ZIKV alene eller med ZIKV-sera blandinger. (en) DENV1 antistoff inneholder sera. (b) DENV2 antistoff inneholder sera. (c) DENV3 antistoff inneholder sera. (d) DENV4 antistoff inneholder sera. (e) DENV-antistoff sera fra colombianske personlige 1. (f) DENV-antistoff sera fra colombianske personlige 2. Infeksjonen ble målt ved qRT PCR analyse på 48 timer postinfection. Teknisk og biologiske gjentak ble gjort i tre eksemplarer. Dataene er gruppert og feilfeltene angir standardavvik. Student t-test og ANOVA ble brukt til statistisk analyse. P < 0,001. Dette tallet er endret fra Londono-Renteria et al.8. Klikk her for å se en større versjon av dette tallet.

Table 1
Tabell 1: Termisk profil av qRT PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kryssreaktivitet av DENV antistoffer fører til ADE av andre DENV serotyper har hindret utviklingen av en effektiv vaksine11. ZIKV tilhører samme familie, Flaviviridae, og har en betydelig homologi med andre flaviviruses, spesielt DENV12. Hovedmålet for nøytralisere antistoffer for både ZIKV og DENV er konvolutt protein, som deler en svært høy strukturelle og kvartær sekvens homologi mellom de to virus13,14,15. Det har blitt demonstrert at pre immunitet til enten DENV eller ZIKV kan forbedre infeksjon av de andre virus8,16.

Det finnes en rekke forskjellige metoder for å kvantifisere det viral infectivity ADE eksperimenter, fra plakk analyser17, intracellulær viral antigen flekker bruker antistoffer konjugert med fluorescerende fargestoffer og flowcytometri18 ,19. Disse analyser er tidkrevende og ikke lett tilpasses den høy gjennomstrømmingen av flere eksempler på samme tid. Viktigere, de fleste studiene brukte DENV-spesifikke monoklonale antistoffer til å sjekke deres effekt på ZIKV og undersøkt ADE i cellen linjer bare20,21. I denne protokollen beskriver vi en enkel men effektiv metode der vi brukte pre immun koagulasjon som har en nøytraliserende evne mot DENV, sammen med primære menneskelige immunceller, å undersøke effekten av pasienten serum på ZIKV replikering ved hjelp av qRT PCR. Denne metoden er robust, relevante, og kan være ferdig i tre dager. Selv om representant resultatene i dette manuskriptet viser sin søknad om ZIKV, kan denne protokollen lett endres og brukes for andre flaviviruses, som gulfeber virus og dengue virus West Nile virus. En viktig faktor å vurdere er at denne protokollen har en begrensning i skille mellom eldre og umodne viral RNA.

Under protokollen, er det viktig å gi nøye overveielse når RNA utdrag, at miljøet er RNase-fri under alle RNA håndtering trinnene. Videre bør viral aksjer være tint på 37 ° C i et vannbad i 1-2 min og umiddelbart lagt på is. Men burde viruset ikke være holdt på is for lenge, så det kan miste sin infectivity.

Tidligere resultater har vist at denne protokollen er svært praktisk og tilpasningsdyktig til å håndtere en rekke prøver og kan gjennomføres på relativt mindre tid enn andre metoder. Denne protokollen har potensial til å bli brukt som en nyttig analysen for fremtidige ADE studier.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å fortolle.

Acknowledgments

Dette arbeidet ble sjenerøst støttet av 1R21AI129881-01 (til T.M.C.), oppstart midler fra nasjonale nye smittsomme sykdommer laboratorier og Boston University School of Medicine.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Kvantifisering av antistoff avhengige forsterkning av Zika viruset i primære menneskelige celler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter