Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

특정 성장 속도로 타 바이러스의 세포 바인딩 기능에 대 한 분석

Published: January 28, 2019 doi: 10.3791/58821

Summary

여기 두 개의 프로토콜 특정 성장 율 및 상 패 분석 결과 실시간 정량 Pcr를 사용 하 여로 타 바이러스의 셀 바인딩 기능에 대 한 다른 측정 한 선물이. 이러한 프로토콜으로 타 바이러스 변종 고기에 차이 확인 수 있습니다.

Abstract

로 타 바이러스는 유아 설사에 대 한 주요 etiological 요인이 다. (Ds) 이중 가닥 RNA 바이러스가 고 형성 한다 quasispecies, 그들의 높은 돌연변이 비율 때문으로 알려진 유전으로 다양 한 인구. 여기, 우리가 특정 성장 율 및 그것의 고기도로 타 바이러스의 셀 바인딩 능력을 측정 하는 방법을 설명 합니다. 로 타 바이러스 세포 수용 체를 인식 하는 트립 신으로 처리 하 고 MA104 세포 배양에 주사. 바이러스 성 progenies를 포함 하 여 상쾌한 간헐적으로 수집 됩니다. 상 패 분석 결과 바이러스 titer를 확인 하는 데 사용은 (패 형성 단위: pfu) 각 수집된 상쾌한의. 특정 성장 율 수정 Gompertz 모델 pfu/mL의 시간-코스 데이터를 피팅 하 여 추정 된다. 셀 바인딩 분석 결과 24-잘 접시의 MA104 세포로 타 바이러스에 감염 되며 세포 수용 체로 흡착 4 ° C에서 90 분 동안 알을 품을. 낮은 온도로 타 바이러스 주인 세포에 침입에서 멈출. 씻은 후 언바운드 virions를 제거 하, RNA virions 세포 수용 체 cDNA 합성 및 반전 전사 정량 PCR (RT-정량)에 연결 된에서 추출 됩니다. 바이러스 성 긴장 중 phenotypic 차이 조사에 대 한 이러한 프로토콜을 적용할 수 있습니다.

Introduction

RNA 바이러스는 그들의 돌연변이 비율, DNA 기반 생물의 보다 높은2 인해 quasispecies1로 알려진 유전으로 다양 한 인구를 형성 한다. Quasispecies에 인구 구조는 돌연변이, 유전적 부동, 선택의 압력 등 인구 유전 요인에 의해 영향을 받습니다. 단일 유전 계보 내의 긴장 유전적 다양성 때문에 다른 고기를 표시할 수 있습니다. 예를 들어 Rachmadi 외. 무료 염소 감도 플 라크 정화 스트레인 S7-p p 3의3에서 murine 노로바이러스 긴장 가운데 다른 했다 보여주었다.

Rotaviruses (reoviridae 가족에 속으로)는 비 싸여 ds RNA 바이러스 quasispecies2를 형성. 위에서 설명한 인구 유전 요인 뿐만 아니라 게놈 reassortment 영향을 미칩니다로 타 바이러스의 유전적 다양성을 때문에이 바이러스는 11 세그먼트 유전자4. Rotaviruses는 주로 유아, 중 설사를 일으킬 하 고 2013 년에 유아 죽음 2500005에 대 한 추정 했다. 하지만 일부 연구 자들은 이제 백신 탈출 돌연변이6,,78, 의 존재를 논의 하는 두 백신 여러 국가에서 사용 하 고로 타 바이러스 감염의 부담을 줄이는 효과가 있다 9. 이러한 돌연변이의 특성 백신 탈출 메커니즘을 이해 하는 것이 중요 하다.

여기, 우리가 특정 성장 율 및 변종/돌연변이 간의 phenotypic 차이 이해 하기 위해로 타 바이러스의 세포 바인딩 능력을 평가 하기 위한 두 개의 분석 실험에 대 한 프로토콜 제시. Rotaviruses의 성장 곡선 이전 보고서10, 발표 되었습니다 하지만 특정 성장률 등 성장 매개 변수는 일반적으로 측정 되지 않습니다. 실시 셀 바인딩 분석 결과 이전 immunofluorescent 얼룩 기법11를 포함 한다. 우리는 여기 패 분석 결과 및 RT-정량, 양적 바이러스 고기에 차이 논의 하기 위해 우리를 사용 하 여 쉽게 방법을 보여줍니다. 이러한 방법은 고기 특성에 대 한 적절 한 하 고 마침내 여러 genotypes에 대 한 효과적인 새로운 백신의 건설에 기여할 수 있습니다.

Protocol

1. 매체 준비

  1. 세포 배양 매체 (혈 청에 포함 된 매체)을이 글의 MEM 분말의 4.7 g 증류수 500 mL를 추가 합니다. 20 분 하 고 실내 온도에 보통 쿨에 대 한 120 ° C에 고압. 소 태아 혈 청에 추가 (최종 농도: 10%), L-글루타민 (2mm), 페니실린 스 (1%), 나트륨 중 탄산염 (1.125 g/L). 1 개월에 4 ° C에서 저장 합니다.
  2. 소 태아 혈 청 하지 않고 단계 1.1에서 설명 된 대로 바이러스 전파에 대 한 혈 청 자유로운 매체를 준비 합니다. 1 개월에 4 ° C에서 저장 합니다.
  3. 상 패 분석 결과 대 한이 글의 메모리 매체 (비 포함 된 페 놀 레드) 100 mL 압력가 마로 소독 하 여 소독. 실내 온도에 냉각 하 고 2% 추가 매체를 하자 FBS, 2% 페니실린 스, L-글루타민, 4mm와 2.25 g/L NaHCO3. 4 ° c.에 게
  4. 상 패 분석 결과 대 한 압력솥으로 2.5 %agarose 젤 100 mL 소독. 젤 패 시험 실시 당일 준비. 물 욕조에 47 ° C에 젤을 저장 합니다.

2. 세포 배양

  1. 액체 질소 용기에서 MA104 셀 라인을 포함 하는 cryotube를 제거 합니다. 세포를 해 동 37 ° C에서 물 욕조에는 cryotube를 놓습니다. T75 플라스 크에서 혈 청에 포함 된 매체의 20 mL에 세포 현 탁 액 1 mL를 추가 합니다. 2 또는 3 일 동안 37 ° C, 5% CO2 배양 기에 플라스 크를 품 어.
    참고: 현 탁 액에서 최종 셀 농도 약 106 셀/mL 이다.
  2. 일단 셀 단층 80 %confluency 도달는 상쾌한을 제거 하 고 Dulbecco의 PBS (인산 염 버퍼 식 염 수) x 1의 5 mL로 두 번 셀을 세척.
  3. 0.05% 트립 신-EDTA의 4 mL 플라스 크에 추가 하 고 플라스 크에서 세포를 분리 하려면 5 분 동안 37 ° C에서 품 어. 15 mL 튜브를 5 분 동안 190 x g에서 원심 분리기 세포 현 탁 액을 전송 합니다.
  4. 삭제는 상쾌한 고 중간에 준비 1.1 포함 하는 혈 청 1 mL에 수송과 세포 (106 셀) resuspend. 약에서 resuspended 셀을 희석 매체와.
  5. 6-잘 (패 분석 결과) 또는 (대 한 셀 바인딩 분석 결과), 24-잘 접시의 각 음을 각각 희석된 세포 현 탁 액 3 mL를 추가 합니다. 2 ~ 3 일에 대 한 포화 증기에서 37 ° C, 5% CO2 인큐베이터에 접시를 품 어.
    참고: T75 플라스 크 샘플 볼륨 상쾌한 (1 mL)의 총 표면에 뜨는 볼륨 (30 mL)에 비해 무시 될 수 있기 때문에 시간 코스 샘플을 수집 하는 게 적당 하다. 한편,는 일반적으로 6-잘 접시를 사용 하 여 수행 상 패 분석 결과 각 상쾌한에 바이러스의 감염 titer 측정 됩니다. 24 잘 플레이트 세포 바인딩 분석 결과 대 한 활용 됩니다.

3. 특정 성장 율으로 타 바이러스의

참고: 붉은 털으로 타 바이러스 (RRV, 유전자 형: G3P[3]) RRV 신속 하 고 쉽게 MA104 셀과 플 라크를 형성 수 있습니다 때문에이 프로토콜에서 이용 된다.

  1. 해 동 장소-80 ° c에서 37 ° C에 물 목욕 저장 혈 청 자유로운 매체에 바이러스 중지 (107 pfu/mL) 1 mL를 포함 하는 관. 돼지 췌 장에서 바이러스 정지 (최종 트립 신 농도 4 µ g/mL) 그리고 소용돌이의 1 mL 1 µ µ g/L 트립 신을 추가 합니다. 30 분에 대 한 포화 증기에서 37 ° C, 5% CO2 에서 바이러스 정지를 품 어.
    참고: 트립 신 다른 소스에서 사용할 수 있습니다, 그러나로 infectivity에 영향 사전에 테스트할 필요가 있다.
  2. 혈 청 무료 매체 조정 0.1 pfu/셀 감염 (MOI)의 다양성을 활성화 바이러스 정지 희석.
  3. 추가 희석된 바이러스 서 스 펜 션의 1 mL MA104 셀 라인 (80% 합칠) T75 플라스 크에 셀 (2.1) 도금 후에 3 일, 1 시간 동안 37 ° C에서 품 어 하 고 부드럽게 흔들어 플라스 크 매 15 분.
  4. 그런 다음, 30 mL 플라스 크에 돼지 췌 장에서 trypsin의 0.13 µ g/mL를 포함 하는 혈 청 무료 매체의 추가. 포화 증기에서 37 ° C, 5% CO2 플라스 크를 품 어.
  5. 0, 6, 12, 18, 24에 플라스 크에서 상쾌한의 1 mL 및 36 (또는 48) h 후 감염 (hpi)를 수집 하 고는 피 펫을 사용 하 여 1.5 mL 튜브에 상쾌한 대체.
  6. 동결 (-80 ° C)를 실시 하 고 37 ° C 사이클에서 세 번 물 욕조에 녹아. 다음 4 ° c.에서 10 분 동안 12600 x g 에서 튜브 원심 상쾌한을 수집 합니다.
  7. 소 주 0.2 µ m 필터 셀 일부를 제거 하는 상쾌한을 필터링 합니다. 바이러스 titer 측정 하기 위한 패 분석 실험에 적용까지 표면에 뜨는-80 ° C 냉장고에 저장 합니다.
  8. 37 ° c.에 물 목욕에서 수집 된 상쾌한 (3.5 단계)를 포함 하는 튜브를 배치 10 희석된 샘플의 1 mL를 4 µ g/mL의 트립 신을 추가 하 고 30 분 동안 37 ° C에서 품 어.
  9. 3.8에 30 분 인큐베이션 기간 동안 시작 시간 코스 샘플 (3.5 단계)에서 얻은 바이러스 titer 측정 하기 위한 패 분석 결과 씻어 6 잘 플레이트 1 x PBS의 2 mL와 두 번의 MA104 셀 포함 하는 혈 청 매체를 제거한 후.
  10. 직렬 혈 청 무료 매체 incubated 샘플을 희석 하 고 각 우물에 희석된 샘플의 1 mL를 접종. 37 ° C, 5% CO2 포화 증기, 아래에서 90 분 동안 접시를 품 어 그리고 부드럽게 흔들어 접시 마다 15 분.
  11. 부 화, 후 6 잘 플레이트에서는 inoculum을 제거 합니다. (1.3 단계)에서 준비 하는 중간에 4 µ g/mL의 트립 신을 추가 합니다. 부드럽게 하지만 즉시 각 음을 agarose 젤 (비율은 1:1) 혼합 매체의 3 mL를 추가 합니다.
  12. (Agarose 젤 고체까지) 10 분 이상 실 온에서 접시를 유지 하 고 포화 증기에서 37 ° C, 5% CO2 에서 2 일 동안 품 어.
    참고: 우물의 가장자리에서 agar와 혼합 매체를 붓는 다.
  13. 각 음을 1 x PBS에 희석 0.015% 중립 빨강 솔루션의 1 mL을 추가 하 고 포화 증기에서 37 ° C, 5% CO2 에서 품 어. 3 h 후 염료를 제거 하 고 포화 증기에서 37 ° C, 5% CO2 1 일 품 어.
  14. 다음 날, 각 잘에서 플 라크의 수를 세 고 계산 pfu/mL. 신중 하 게 패 분석 결과 패 숫자를 보장 하기 전에 셀 합류를 확인 하십시오.

4. 셀 바인딩 분석 결과

참고: 이 프로토콜은 Gilling의 보고서13을 기반으로 합니다.

  1. (2.1에서 같은 방식으로)에 돼지 췌 장 (최종 트립 신 농도 4 µ g/mL) 바이러스 정지 그리고 소용돌이의 1 mL에 1 µ µ g/L 트립 신을 추가 합니다. 조정 1 pfu/셀의 나 혈 청 자유로운 매체와 바이러스 정지 희석.
  2. 다음, MA104 셀 Tris 버퍼 식 염 수 1ml와 24-잘 접시에 두 번 세척 (TBS; 2.53 g/L 트리 스 베이스, 6.54 g/L NaCl, KCl, 0.3 g/L 0.046 g/l Na2HPO4 증류수 1 L에 도달).
  3. 셀, 24-잘 접시의 각 잘 희석된 바이러스 정지의 100 µ L를 접종 하 고 부드러운 떨고 모든 15 분으로 90 분, 4 ° C에서 품 어.
  4. 바이러스 inoculum을 제거 하 고 세척 tbs.의 1 mL로 두 번 셀 더블-좌초 (ds) RNA는로 타 바이러스의 추출, 추가 PBS x 1의 140 µ L 및 RNA 추출 버퍼의 560 µ L ( 재료의 표참조) 각 잘 하. 피 펫 (10 x에 대 한 때까지 또는 연 무 또는 버퍼에 있는 세포의 오염 나타나지 않습니다)와 적절 하 게 믹스.
  5. 회복 후 제조업체의 프로토콜에 따라 이중 좌초 RNA (dsRNA), 1.5 mL 튜브 dsRNA 추출 dsRNA, 변성 다음 즉시 얼음에 튜브를 배치 하 고 2 이상의 품 어 5 분 동안 95 ° C에서 열 블록에 포함 된 배치 분입니다.
  6. 반전 녹음 방송을 사용 하 여는 cDNA를 합성 키트 ( 재료의 표참조). 혼합물 (표 1)의 16 µ l을 포함 하는 PCR 튜브에 변성된 바이러스 성 RNA 솔루션의 4 µ L을 추가 하 고 거품 생성을 하지 피 펫으로 신중 하 게 혼합. 튜브 아래로 회전 합니다.
  7. 표 2에 표시 된 조건 하에서 열 cycler와 반전 녹음 방송을 수행 합니다. cDNA 즉시 사용 하지 않으면 최대 1 년 동안-20 ° C에서 cDNA를 포함 하는 PCR 튜브를 저장 합니다.
  8. 정량 PCR를 위한 뇌관을 사용 하 여 (앞으로 5'-ACCATCTACACATGACCCTC-3', 역; 5'-GGTCACATAACGCCCC-3')14 와 프로브를 끄는 삽입 (정량 프로브; 5'-/ 팸/ATGAGCACA/끄는/ATAGTTAAAAGCTAACACTGTCAA/TAMRA/3 '), 대상에 963-NSP3로 타 바이러스의 게놈 세그먼트의 1049 지역 (ST3 스트레인, 은행: X81436).
    참고: 끄는 쩡 외.14 에 의해 설계 된 프로브 삽입 됩니다.
  9. 표준 플라스 미드를 직렬로 희석 (10 106 복사본/mL을1 ) PCR과 정량 혼합 (표 3)에 물을 학년 고 정량 다음 표 4에 대 한 마스터 믹스 (20 µ L/샘플).
  10. 96-잘 PCR 격판덮개의 우물을 마스터 믹스 20 µ L을 추가 하 고 10 번 pipetting으로 cDNA 샘플의 5 µ L 또는 표준 플라스 미드의 5 µ L를 혼합. 표 4에 표시 된 조건에 따라 정량 시스템의 반응을 시작 합니다.
  11. MA104 세포 표면에 바인딩된로 타 바이러스 게놈을 계산 하려면 Ct 값과 표준 플라스 미드의 알려진된 게놈 수 사이의 선형 회귀를 수행 하 고 샘플의 게놈 수 예상 합니다. 다음 그 초기 inoculum (G0)에 virion 숫자 바인딩 셀 (Gt)의 비율을 계산 합니다.

Representative Results

특정 성장 속도 플 라크-정화 RRV 긴장의 셀 바인딩 분석 결과 대 한 두 개의 프로토콜에 대 한 개요는 각각 그림 1A2A에 표시 됩니다.

특정 성장 율에 대 한 분석 결과, 마지막 바이러스 titer T75 플라스 크에 전파할 때 10 이상7 pfu/mL에 도달 합니다. 최대 농도 107 pfu/mL 보다 낮은 경우에, MA104 셀 confluent 될 않을 수 있습니다 또는 RRV는 트립 신에 의해 잘 활성화 되지. 일부 성장 모델 감염 단위 데이터를 사용 하 여 특정 성장 율 추정을 위한 사용할 수 있습니다. 이 프로토콜에서 수정된 Gompertz 모델12 ; 예를 들어 고용
Equation

여기서 N0 (104 pfu/mL이이 연구에서)과 Nt (104 108 pfu/mL) 0와 t 바이러스 감염 titer (pfu/mL)는 (예: 0, 6, 12, 18, 24, 36) hpi, 각각, A는 점근 값 [로그 (N/N0 )] (예: 3 ~ 4), μ 특정 성장 율 [1/h] e는 네이피어의 상수 이며, λ는 지연 기간 [h]. 모델 매개 변수 관찰 및 모델 값의 차이의 제곱의 합을 최소화 하는 분석 소프트웨어의 해 찾기 함수에 의해 얻을 수 있습니다. 그림 1B에서 예제에서 특정 한 성장 율 (μ) 0.197 [1/h] 추정 되며 지연 기간 (λ) 6.61 [h] 초기 titer (고정 단계에서 수정 Gompertz 모델과 상대 바이러스 titer를 최소 제곱 메서드를 적용 하 여 로그 스케일) (A)는 3.15 [로그 (N/N0)]. 우리 총, 6로 타 바이러스 복제를 테스트 하 고 특정 성장 율의 추정된 값 0.27 [1/h] 0.19에서 ranged. 이 값은 신뢰할 수 있는의 결정 값 모델 피팅 계수 0.98 보다 더 있기 때문에 추정.

RRV virions 셀 표면에 바인딩 했다 약 103 복사본/mL (바인딩 효율은 약 1%) 셀 바인딩 분석 결과 (그림 2B)에 대 한 24-잘 접시를 사용 하는 경우. 분석 결과 일반적으로 모든 샘플에 대 한 세 번을 수행 하 고 복사본 수에 큰 차이 샘플에서 관찰, 트립 신에 의해 RRV의 부족-세탁기 활성화 등 몇 가지 문제가 발생할 수 있습니다. Ct 값 정량 초과 약 36.0 바람직 이며 우리의 정량 상태에서 검출 한계 미만 이어야 하 고 여겨진다.

볼륨 1 / 반응
PrimeScript 버퍼 x 5 4.0 Μ L
PrimeScript RT 효소 나 혼합 1.0 Μ L
올리고 dT 프라이 머 1.0 Μ L
임의 6 메 4.0 Μ L
이온을 제거 된 증류수 6.0 Μ L
ssRNA 샘플 4.0 Μ L
20.0 Μ L

표 1: 마스터는로 타 바이러스 게놈의 cDNA 합성에 대 한 구성 믹스.

온도 [℃] 시간
37 15 분
42 15 분
85 5 s
4

로 타 바이러스 게놈의 cDNA 합성 표 2: 반응 조건입니다.

볼륨/1 반응
섞은 Taq 12.5 Μ L
앞으로 뇌관 (10 µ M) 0.5 Μ L
반전 뇌관 (10 µ M) 0.5 Μ L
프로브 (10 µ M) 0.5 Μ L
참조 염료 II 0.5 Μ L
이온을 제거 된 증류수 5.5 Μ L
cDNA 샘플 5.0 Μ L
25 Μ L

표 3: 마스터는로 타 바이러스 게놈의 양이 많은 PCR에 대 한 구성 믹스.

온도 [℃] 시간
95 5 분
94 20 s 45 주기
60 1 분
72 5 분

로 타 바이러스 게놈의 양이 많은 PCR에 표 4: 반응 조건입니다.

Figure 1
그림 1:로 타 바이러스 성장 추정과로 타 바이러스의 성장 곡선의 도식 개요. (A)로 타 바이러스의 감염 단위 패 분석 실험으로 측정 됩니다. (B) 곡선 (파란색 선)는 우리의 실험실 (흰색 원)에서 관찰 된 데이터 수정된 Gompertz 모델에서 직선 근사 줄. 특정 성장 율 [μ]; [h-1], 0.197 지연 기간 (λ); 6.61 [h], 초기 titer (로그 눈금)에 고정 단계에서 상대 바이러스 titer (A); 3.15 [로그 (N/N0)]. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 도식 개요 및 우리의 실험실에 있는 플 라크에서 정화 5 RRV 긴장의 셀 바인딩 분석 결과의 대표적인 결과. (A) A 셀 문화 접시와로 타 바이러스 접종 억제 세포로 바이러스 침공 4 ° C에서 incubated입니다. 부 화 후에 셀에 언바운드 바이러스 성 입자를 제거, 바운드 바이러스 입자에서 발생 하는 실시간 정량 Pcr과 세포 표면에는 게놈의 수 계량. (B) 셀 바인딩 결과 분석 결과 바인딩 했다 그는 inoculum에 바인딩된 바이러스 성 입자의 비 효율 (%)로 표시 됩니다. 대담한 바: 중간, 월말 상자: 사분 위 수 편차, 라인의 끝: 최대 및 최소. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Discussion

특정 성장 속도 측정 하기 위한 우리의 프로토콜 이전의 것 들 보다 쉽습니다 그리고 그들의 세포 문화 시스템 아직 설립 하지 않는 한 다른 바이러스에 대 한 적응 시킬 수 있다. 이 연구에서는 사용 하는 RRV (G3P[3]) MA104 셀 라인을 사용 하 여 때이 긴장 패 인간의 rotaviruses 보다 쉽게 형성할 수 있기 때문에. 일부 인간로 긴장이 셀 라인에서 플 라크를 형성할 수 없습니다. 따라서, 상 패 분석 결과, 대신 초점 형성 단위 (: FFU) 분석 결과15 또는 중간 조직 문화 감염 복용량 (TCID50) 분석 결과 적용할 수 있는 많은 타 바이러스 긴장16. 특정 성장 율을 결정 하기 위한 제시 프로토콜 다른 바이러스 종류에 사용할 수 있습니다 하지만 바이러스 설립된 셀 문화 시스템 설립에 적합 하지 않습니다. 특정 성장 율에 대 한 실험을 시작 하기 전에 미리 알고 있는 때 바이러스 감염 titer가 증가 하기 시작 하 고 예비 테스트에서 고정 단계에 도달. 너무 많은 패 경우 패 분석 결과 바이러스 샘플의 희석 비율을 변경한 후 다시 실시 한다. 지 수 성장 단계의 기울기 고정 단계에 도달 하는 적절 한 시간 포인트 놓쳤다면 과소평가 될 수 있기 때문에 샘플을 수집 하는 시간 후 감염 (hpi)도 중요 하다. 수정된 Gompertz 모형에 의해 근사에서 결정 계수 해야 항상 계산 되며 체크. 체력 수정된 Gompertz 모델을 낮은 경우에, 다른 성장 모델 수정된 로지스틱 모델12 바람직 있을 수 있습니다.

매체 또는 바이러스 inoculum을 제거 하는 경우 셀을 처리, 상 패 분석 결과 대 한 세척 또는 agarose 젤에 대 한 PBS 즉시에 추가 되어야 합니다 각 셀 건조에서를 방지 하기 위해 셀 문화 접시의 잘. 동시에 부드럽게 PBS 또는 우물에서 분리 하지 셀 agarose 붓고 해야 합니다. 이 단계는 모두 분석 실험 (단계 3.9와 3.11)에서 가장 중요 한. 상 패 분석 결과 너무 많은 샘플 있으면 좋습니다 agarose 젤 (100ml 각 최대 권장) 여러 중간 병으로 정기 agarose 이후 사용 직전 젤은 룸에서 약 10 분 이내 경화 될 때까지 병을 따뜻하게 유지 온도입니다. 트립 신 높은 온도17에 취약 이기 때문에, trypsin 솔루션 매체 및 agarose 적절 하 게 냉각 후 상 패 분석 결과 대 한 추가 되어야 합니다.

셀 바인딩 분석 결과에서 바이러스 바인딩 셀에 대 한 외피 세포의 침입을 방지 하기 위해 4 ° C에서 수행 되어야 합니다. Gilling의 방법13에 따르면 셀 부드러운 떨고는 필요한 모든 15 분 동안 보육 낮은 온도에서 건조 하는 경향이 있다. 여기에 활용 하는 RNA 추출 키트는 다른 키트에 대 한 대체 수 있습니다. 실시간 정량에서 표준 곡선의 기울기는 약 3.3, 이어야 한다 고 결정 계수는 0.98 보다 더 해야한다. 세포에 있는 바이러스의 지역화를 시각화 하기 위해 형광 현미경에 비해, 분석 결과 더 신속 하 고 바이러스에 형광 물질의 바인딩이 필요 하지 않습니다 때문에 사용 하기 쉽습니다.

최근, 인간의 장 enteroid (히), 유사한 세포 구성과 기능 전시 인간의 위장 상피로로 타 바이러스 전파18사용할 수 있게 했다. 히 사용 특정 성장 속도로 타 바이러스의 비 culturable 긴장의 셀 바인딩 능력 평가를 통해 수 있습니다 있습니다. 또한, 여기에 설명 된 두 실험 모두 고기19에 약물 효과의 평가에 적용할 수 있습니다. 여기에 제시 된 프로토콜 양적 표현 형으로 타 바이러스 변종이 다양 한 조건에서의 매개 변수 값의 변화를 논의 하기 위해 가능 하 게.

Disclosures

저자는 공개 없다.

Acknowledgments

이 작품은 "위생 가치 체인:: 디자인 위생 시스템으로 에코 커뮤니티 가치 시스템" 프로젝트, 인간과 자연 (RIHN, 프로젝트 No.14200107)에 대 한 ResearchInstitute에 의해 지원 되었다.

Materials

Name Company Catalog Number Comments
7500 Real Time PCR System Applied Biosystems qPCR
Agar-EPI Nakalai Tesque, Inc 01101-34 Plaque assay
Disodium Hydrogenphosphate Wako Pure Chemical Corporation 194-02875 Cell binding assay
Eagle's MEM "Nissui" One Nissui Pharmaceutical Co., Ltd _05900 Cell culture
Eagle's MEM "Nissui" Two Nissui Pharmaceutical Co., Ltd _05901 Plaque assay
EasYFlask 75 cm2 Thermo Scientific 156499 Cell culture
Fetal bovine Serim, qualified, USDA-approved regions Gibco 10437028 Cell culture and Plaque assay
Forward / Reverse primers Eurofins Genomics qPCR
L-Glutamine, 200 mM Solution Gibco 2530081 Cell culture and Plaque assay
Neutral Red Wako Pure Chemical Corporation 140-00932 Plaque assay
PBS (-) "Nissui" Nissui Pharmaceutical Co., Ltd _05913 Cell culture and Plaque assay
Penicillin-Streptomycin, Liguid Gibco 15140122 Cell culture and Plaque assay
Potassium Chloride Wako Pure Chemical Corporation 163-03545 Cell binding assay
Premix ExTaq (Perfect Real Time) TAKARA Bio Inc. RR039A qPCR
PrimeScriptTN RT reagent Kit (Perfect Real Time) TAKARA Bio Inc. RR037A cDNA synthesis
PrimeTime qPCR Probes Medical and Biological Laboratories Co., Ltd. qPCR
QIAamp Viral RNA Mini Kit QIAGEN 52904 RNA extraction
Sodium Bicarbonate Wako Pure Chemical Corporation 199-05985 Cell culture and Plaque assay
Sodium Chloride Wako Pure Chemical Corporation 198-01675 Cell binding assay
Tissue culture plates 24-well plate TPP 92024 Cell binding assay
Tissue culture plates 6-well plate TPP 92006 Plaque assay
Trizma base SIGMA-ALDRICH T1503 Cell binding assay
Trypsin from porcine pancrease SIGMA-ALDRICH T0303-1G Activate for rotavirus
Trypsin-EDTA (0.05 %), phenol red Gibco 25300054 Cell culture
Vertical 96-Well Thermal Cycler Applied Biosystems cDNA synthesis

DOWNLOAD MATERIALS LIST

References

  1. Domingo, E. Rna Virus Mutations. Annual review of microbiology. 51, 151-178 (1997).
  2. Gouvea, V., Brantly, M. Is rotavirus a population of reassortants? Trends in Microbiology. 3, 159-162 (1995).
  3. Rachmadi, A. T., Kitajima, M., et al. Free-chlorine disinfection as a selection pressure on norovirus. Applied and Environmental Microbiology. 84, (2018).
  4. Ghosh, S., Kobayashi, N. Whole-genomic analysis of rotavirus strains: current status and future prospects. Future Microbiology. 6, 1049-1065 (2011).
  5. Tate, J. E., Burton, A. H., Boschi-Pinto, C., Steele, A. D., Duque, J., Parashar, U. D. 2008 estimate of worldwide rotavirus-associated mortality in children younger than 5 years before the introduction of universal rotavirus vaccination programmes: A systematic review and meta-analysis. The Lancet Infectious Diseases. 12, 136-141 (2008).
  6. Franco, M. A., Angel, J., Greenberg, H. B. Immunity and correlates of protection for rotavirus vaccines. Vaccine. 24, 2718-2731 (2006).
  7. Santos, N., Hoshino, Y. Global distribution of rotavirus serotypes/ genotypes and its implication for the development and implementation of an effective rotavirus vaccine. Reviews in Medical Virology. 15, 29-56 (2005).
  8. Matthijnssens, J., Heylen, E., Zeller, M., Rahman, M., Lemey, P., Van Ranst, M. Phylodynamic analyses of rotavirus genotypes G9 and G12 underscore their potential for swift global spread. Molecular Biology and Evolution. 27, 2431-2436 (2010).
  9. Mukhopadhya, I., Murdoch, H., et al. Changing molecular epidemiology of rotavirus infection after introduction of monovalent rotavirus vaccination in Scotland. Vaccine. 35, 156-163 (2017).
  10. Londrigan, S. L., Hewish, M. J., Thomson, M. J., Sanders, G. M., Mustafa, H., Coulson, B. S. Growth of rotaviruses in continuous human and monkey cell lines that vary in their expression of integrins. Journal of General Virology. 81, 2203-2213 (2000).
  11. Hewish, M. J., Takada, Y., Coulson, B. S. Integrins a2b1 and a4b1 can mediate SA11 rotavirus attachment and entry into cells. Journal of Virology. 74, 228-236 (2000).
  12. Zwietering, M. H., Jongenburger, I., Rombouts, F. M., van't Riet, K. Modeling of the bacterial growth curve. Applied and Environmental Microbiology. 56, 1875-1881 (1990).
  13. Gilling, D. H., Kitajima, M., Torrey, J. R., Bright, K. R. Mechanisms of antiviral action of plant antimicrobials against murine norovirus. Applied and Environmental Microbiology. 80, 4898-4910 (2014).
  14. Zeng, S. Q., Halkosalo, A., Salminen, M., Szakal, E. D., Puustinen, L., Vesikari, T. One-step quantitative RT-PCR for the detection of rotavirus in acute gastroenteritis. Journal of Virological Methods. 153, 238-240 (2008).
  15. Rolsma, M. D., Gelberg, H. B., Kuhlenschmidt, M. S. Assay for evaluation of rotavirus-cell interactions: identification of an enterocyte ganglioside fraction that mediates group A porcine rotavirus recognition. Journal of Virology. 68, 258-268 (1994).
  16. Brüssow, H., Hilpert, H., Walther, I., Sidoti, J., Mietens, C., Bachmann, P. Bovine milk immunoglobulins for passive immunity to infantile rotavirus gastroenteritis. Journal of Clinical Microbiology. 25, 982-986 (1987).
  17. Outzen, H., Berglund, G. I., Smalås, A. O., Willassen, N. P. Temperature and pH sensitivity of trypsins from Atlantic salmon (Salmo salar) in comparison with bovine and porcine trypsin. Comparative Biochemistry and Physiology - B Biochemistry and Molecular Biology. 115B, 33-45 (1996).
  18. Saxena, K., Blutt, S. E., et al. Human Intestinal Enteroids: a New Model To Study Human Rotavirus Infection, Host Restriction, and Pathophysiology. Journal of Virology. 90, 43-56 (2016).
  19. Yin, Y., Bijvelds, M., et al. Modeling rotavirus infection and antiviral therapy using primary intestinal organoids. Antiviral Research. 123, 120-131 (2015).
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kadoya, S. s., Sano, D. Assays for the Specific Growth Rate and Cell-binding Ability of Rotavirus. J. Vis. Exp. (143), e58821, doi:10.3791/58821 (2019).More

Kadoya, S. s., Sano, D. Assays for the Specific Growth Rate and Cell-binding Ability of Rotavirus. J. Vis. Exp. (143), e58821, doi:10.3791/58821 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter