Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

drosophila melanogaster में वायरल संक्रमण और मेजबान वायरस बातचीत के विश्लेषण की स्थापना

doi: 10.3791/58845 Published: March 14, 2019
* These authors contributed equally


इस प्रोटोकॉल का वर्णन कैसे वायरस-मेजबान बातचीत का विश्लेषण करने के लिए नैनो-इंजेक्शन विधि और बुनियादी तकनीकों का उपयोग drosophila melanogaster में वीवो में वायरल संक्रमण स्थापित करने के लिए ।


वायरस फैलने महामारी रोगों का एक प्रमुख कारण है । इस प्रकार, वायरस और मेजबान के बीच बातचीत को समझने की रोकथाम और वायरल संक्रमण के उपचार के बारे में हमारे ज्ञान का विस्तार करने के लिए बहुत महत्वपूर्ण है । फल मक्खी drosophila melanogaster एंटीवायरल कारकों के लिए स्क्रीन करने के लिए सबसे कुशल और उत्पादक मॉडल जीवों में से एक साबित हो गया है और वायरस की जांच-मेजबान बातचीत, शक्तिशाली आनुवंशिक उपकरण के कारण और अत्यधिक संरक्षित जन्मजात प्रतिरक्षा सिग्नलिंग मार्ग । यहां वर्णित प्रक्रिया वायरल संक्रमण स्थापित करने और वयस्क मक्खियों में प्रणालीगत एंटीवायरल प्रतिक्रियाओं को प्रेरित करने के लिए एक नैनो-इंजेक्शन विधि को दर्शाता है । इस विधि में वायरल इंजेक्शन खुराक का सटीक नियंत्रण उच्च प्रयोगात्मक पुनरुद्दयता सक्षम बनाता है । इस अध्ययन में वर्णित प्रोटोकॉल मक्खियों और वायरस, इंजेक्शन विधि, जीवित रहने की दर विश्लेषण, वायरस लोड माप, और एक एंटीवायरल मार्ग मूल्यांकन की तैयारी में शामिल हैं । मक्खियों की पृष्ठभूमि द्वारा वायरल संक्रमण के प्रभाव प्रभाव यहां उल्लेख किया गया था । इस संक्रमण विधि प्रदर्शन करने के लिए आसान है और मात्रात्मक repeatable; यह वायरस-होस्ट बातचीत में शामिल मेजबान/वायरल कारकों के लिए स्क्रीन पर लागू किया जा सकता है और वायरल संक्रमण के जवाब में जन्मजात प्रतिरक्षा संकेतन और अन्य जैविक रास्ते के बीच crosstalk को काटना ।


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

उभरते वायरल संक्रमण, विशेष रूप से आर्बोवायरस द्वारा, जैसे चिकुनगुनिया वायरस1, डेंगू वायरस, पीला बुखार वायरस2 और ज़िकावायरस3, महामारियां पैदा करके सार्वजनिक स्वास्थ्य के लिए एक बड़ा खतरा रहा है 4. इस प्रकार, वायरस की एक बेहतर समझ-मेजबान बातचीत महामारी नियंत्रण और मनुष्यों में वायरल रोगों के उपचार के लिए तेजी से महत्वपूर्ण हो गया है । इस लक्ष्य के लिए, और अधिक उपयुक्त और कुशल मॉडल वायरस संक्रमण अंतर्निहित तंत्र की जांच करने के लिए स्थापित किया जाना चाहिए ।

फल मक्खी, drosophilamelanogaster (डी. melanogaster), वायरस की जांच करने के लिए एक शक्तिशाली प्रणाली प्रदान करता है-मेजबान बातचीत5,6 और मानव वायरल रोगों का अध्ययन करने के लिए सबसे कुशल मॉडलों में से एक साबित हो गया है7 , 8 , 9. अत्यधिक संरक्षित एंटीवायरल संकेतन रास्ते और अतुलनीय आनुवंशिक उपकरण मानव एंटीवायरल अध्ययन के लिए वास्तविक प्रभाव के साथ महत्वपूर्ण परिणाम का उत्पादन करने के लिए एक महान मॉडल मक्खियों बनाते हैं । इसके अलावा, मक्खियों को प्रयोगशाला में बनाए रखने के लिए आसान और सस्ता कर रहे हैं और उपन्यास विनियामक कारकों की बड़े पैमाने पर स्क्रीनिंग के लिए सुविधाजनक हैं6,10 वायरस और मेजबान में संक्रमण के दौरान.

चार प्रमुख अत्यधिक संरक्षित एंटीवायरल रास्ते (उदाहरणके लिए, आरएनए हस्तक्षेप (rna) मार्ग11, जंमू कश्मीर-स्टेट मार्ग12, NF-κb मार्ग, और autophagy मार्ग13) अच्छी तरह से drosophila में अध्ययन कर रहे है हाल ही में साल6. rnai मार्ग एक व्यापक एंटीवायरल तंत्र है जो वायरस संक्रमण के सबसे प्रकार को दबा सकता है6,14. डिकर-2 (dcr-2) या अरगोनौटे 2 (AGO2) जैसे जीन में उत्परिवर्तन द्वारा इस मार्ग के विघटन से बढ़ी हुई वायरस टिटर और मेजबान मृत्यु दर15,16,17हो सकती है । जीजैक-स्टेट मार्ग को डिसस्टोविरिडी परिवार और कीटों में फ्लैव्रिडी परिवार से वायरस द्वारा संक्रमण के नियंत्रण में फंसाया गया है, उदाहरणके लिए, मक्खियों में ड्रोसोफिला सी वायरस (डीसीवी)16 और पश्चिम नील नदी वायरस (wnv) और डेंगू वायरस में मच्छर18,19. drosophila टोल (मानव nf-κb मार्ग के लिए homologous) और प्रतिरक्षा की कमी (imd) रास्ते (मानव nf-κb और tnf मार्ग के समान) दोनों वायरस के आक्रमण से बचाव में शामिल हैं20,21, 22. autophagy वायरल संक्रमण है, जो अच्छी तरह से drosophila23,24में विशेषता है के विनियमन में शामिल एक और संरक्षित तंत्र है । इस प्रकार, इन मार्गों के उपन्यास नियामक कारकों की पहचान और इन एंटीवायरल सिग्नलिंग और अन्य जैविक रास्ते, जैसे चयापचय, उम्र बढ़ने, तंत्रिका प्रतिक्रिया और इतने पर के बीच विदारक crosstalk, आसानी से drosophila में स्थापित किया जा सकता है प्रणाली.

हालांकि drosophila में सबसे अच्छी तरह से स्थापित वायरल संक्रामक मॉडल आरएनए वायरस द्वारा प्रेरित कर रहे हैं, अकशेरुका इंद्रधनुषी वायरस 6i (IV-6) द्वारा संक्रमण और कल्लिथिआ वायरस25मक्खियों में डीएनए वायरस के अध्ययन के लिए संभावित दिखाया है, 26. इसके अलावा, वायरस को ड्रॉसोफिलाके संक्रमण की अनुमति देने के लिए भी संशोधित किया जा सकता है, जैसे इन्फ्लूएंजा वायरस9। इसने ड्रॉसोफिला स्क्रीनिंग प्लेटफॉर्म के आवेदन को काफी विस्तार दिया है । इस प्रक्रिया में, हम एक उदाहरण के रूप में dcv का उपयोग करने का वर्णन कैसे drosophilaमें एक वायरल संक्रामक प्रणाली विकसित करने के लिए । dcv लगभग ९३०० न्यूक्लियोटाइड के एक सकारात्मक भावना एकल असहाय आरएनए वायरस है, 9 प्रोटीन27एन्कोडिंग. D. melanogasterके एक प्राकृतिक रोगज़नक़ के रूप में, dcv मेजबान के दौरान शारीरिक, व्यवहार और बेसल प्रतिरक्षा प्रतिक्रिया का अध्ययन करने के लिए एक उपयुक्त वायरस के रूप में माना जाता है-वायरस बातचीत और सह-विकास28. इसके अतिरिक्त, अपनी तेजी से मृत्यु दर जंगली प्रकार मक्खियों में संक्रमण के बाद29मेजबान में प्रतिरोधी या अतिसंवेदनशील जीन के लिए स्क्रीन करने के लिए उपयोगी dcv बनाता है ।

हालांकि, drosophilaमें वायरल संक्रमण का अध्ययन करते समय चिंता के कई पहलू हैं । उदाहरण के लिए, सहजीवी जीवाणु wolbachia के लिए drosophila और मच्छर30,31,३२में आरएनए वायरस के प्रसार के एक व्यापक स्पेक्ट्रा को बाधित करने की क्षमता है । हाल के साक्ष्य एक संभव व्यवस्था है जिसमें wolbachia ब्लॉक sindbis वायरस (sinv) methyltransferase Mt2 अभिव्यक्ति की मेजबानी में३३के माध्यम से संक्रमण से पता चलता है । इसके अतिरिक्त, कीड़ों की आनुवंशिक पृष्ठभूमि भी वायरल संक्रमण के लिए महत्वपूर्ण है । उदाहरण के लिए, जीन में प्राकृतिक बहुरूपता, pastrel (पीएसटी), drosophilaमें dcv संक्रमण के लिए संवेदनशीलता निर्धारित करता है३४,३५, whilst के loci ubc-E2H और CG8492 क्रिकेट पक्षाघात वायरस (crpv) और झुंड हाउस वायरस (fhv) संक्रमण, क्रमशः३६में शामिल हैं ।

विशेष तरीके से वायरस-मक्खियों में मेजबान बातचीत स्थापित करने के लिए, इस तरह के drosophila सेल लाइनों में मेजबान सेलुलर घटकों के लिए एक उच्च throughput स्क्रीन के रूप में अनुसंधान प्रयोजनों के अनुसार चुना जाना चाहिए३७,३८, मौखिक संक्रमण आंत-विशिष्ट एंटीवायरल प्रतिक्रिया का अध्ययन करने के लिए22,३९,४०, सुई चुभन४१,४२ या नैनो इंजेक्शन प्रणालीगत प्रतिरक्षा को उत्तेजित करने के लिए उपकला बाधाओं गुजर द्वारा जवाब. नैनो इंजेक्शन एक नियंत्रित एंटीवायरल प्रतिक्रिया और एक शारीरिक घाव४३के लिए प्रेरित करने के लिए वायरल खुराक को ठीक से नियंत्रित कर सकता है, इस प्रकार उच्च प्रयोगात्मक पुनरुत्पादन की गारंटी४४। इस अध्ययन में, हम drosophilaमें वायरस-मेजबान बातचीत का अध्ययन करने के लिए एक नैनो इंजेक्शन विधि का वर्णन, मक्खियों के महत्व पर प्रकाश डाला ' पृष्ठभूमि प्रभाव.

Subscription Required. Please recommend JoVE to your librarian.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ध्यान दें: प्रयोग शुरू करने से पहले, सेल लाइनों और मक्खी के शेयरों का उपयोग अन्य रोगजनकों द्वारा दूषित नहीं होना चाहिए, विशेष रूप से वायरस जैसे कि dcv, एफएचवी, ड्रोसोफिला एक्स वायरस (dcv), और एवियन नेफ़्टिस वायरस (आंव) । आदर्श रूप में, आरएनए अनुक्रमण या एक सरल पीसीआर आधारित पहचान संदूषण10,४५का पता लगाने के लिए उपयोग किया जाता है । यदि संदूषण हुआ, सेल लाइनों और मक्खी स्टॉक किसी भी अधिक इस्तेमाल नहीं किया जाना चाहिए जब तक वे पूरी तरह से४६decontaminated कर रहे हैं ।

1. वायरस और उड़ान भरने की तैयारी

  1. वायरस प्रोपेगेशन और संग्रह
    नोट: drosophila S2 * कोशिकाओं dcv के प्रसार और टाइट्रेट करने के लिए उपयोग किया जाता है । S2 * सेल लाइन स्वर्गीय स्टेज D. melanogaster भ्रूण की एक प्राथमिक संस्कृति से ली गई है । इस सेल लाइन अच्छी तरह से पहले४७वर्णित किया गया है ।
    1. 1 x 107 व्यवहार्य कोशिकाओं के घनत्व में एक 10 सेमी सेल संस्कृति पकवान में एक ढीला, अर्द्ध-आसंन monolayer के रूप में, अतिरिक्त सह2के बिना 25 डिग्री सेल्सियस पर श्नाइडर के drosophila माध्यम में S2 * कोशिकाओं हो जाना/एमएल । S2 * कोशिकाओं के लिए पूर्ण माध्यम का उपयोग करें: श्नाइडर drosophila मध्यम युक्त 10% हीट निष्क्रिय fbs, १०० इकाइयों/एमएल पेनिसिलिन और १०० μg/एमएल स्ट्रेप्टोमाइसिन ।
      नोट: स्वस्थ कोशिकाओं को एक गोल आकार दिखाना चाहिए और समरूप आकार प्रदर्शित करना चाहिए ।
    2. एक 25 ° c पानी स्नान में-८० डिग्री सेल्सियस से dcv स्टॉक को जल्दी से गल । s2 * कोशिकाओं को सीधे सेल संस्कृति व्यंजन (विकास क्षेत्र: ५५ सेमी2) के लिए पूर्ण माध्यम के 10 मिलीलीटर के साथ s2 * कोशिकाओं को वायरस समाधान के 1 मिलीलीटर जोड़ने के द्वारा moi = ०.०१ में dcv के साथ
    3. 3 से 5 दिनों के लिए 25 डिग्री सेल्सियस पर कोशिकाओं को सेते हैं । जब वायरस संग्रह के लिए तैयार है, कोशिका आकारिकी असामान्य है (कोशिका आकार धुंधला लग रहा है) और संस्कृति माध्यम सेल मलबे का संकेत काले कणों से भरा है.
    4. एक 15 मिलीलीटर ट्यूब में पूरे सेल संस्कृति को पाइपर अप और डाउन करके जमा करें और-८० डिग्री सेल्सियस (एक वर्ष तक) फ्रीज करें ।
      ध्यान दें: dcv को समय की लंबी अवधि के लिए संग्रहित किया जा सकता है-८० डिग्री सेल्सियस संक्रामकता की कम हानि के साथ, एक साल तक के लिए ।
    5. एक 25 डिग्री सेल्सियस पानी स्नान में सेल संस्कृति को लगातार मिलाते हुए और फिर ६,००० एक्स जी पर सेंट्रेसेज, 15 मिनट के लिए 4 डिग्री सेल्सियस पर । एक बाँझ 15 मिलीलीटर ट्यूब और भंवर में सतह पर तैरनेवाला लीजिए । प्रति ट्यूब वायरस समाधान के २०० μl तक aliquot ।
      नोट: वायरस aliquots 4 डिग्री सेल्सियस पर अप करने के लिए 3 दिनों की छोटी अवधि के लिए और अप करने के लिए 1 वर्ष के लिए-८० डिग्री सेल्सियस पर संग्रहीत किया जा सकता है । दोहराया फ्रीज-गल चक्र से बचा जाना चाहिए । यह हमेशा एक बार में सभी aliquot का उपयोग करने के लिए बेहतर है ।
    6. 5 यादृच्छिक वायरस-युक्त ट्यूबों का निर्धारण करने के लिए औसत वायरस ऊतक संस्कृति संक्रामक खुराक (TCID50) द्वारा एक cytopathic प्रभाव (सीपीई) परख (tcid५०= ०.७ पट्टिका बनाने इकाई [pfu] के 1 इकाई) निर्धारित करने के लिए ।
      नोट: सीपीई वायरल आक्रमण की वजह से मेजबान कोशिकाओं में संरचनात्मक परिवर्तन को संदर्भित करता है । संक्रमित वायरस मेजबान कोशिका के lysis का कारण बनता है या जब सेल४८को पुन: उत्पन्न करने में असमर्थता के कारण बिना lysis के मर जाता है ।
      1. 1 दिन पर, तैयार S2 * कोशिकाओं को pipetting द्वारा इकट्ठा । कक्ष संख्या की गणना । 4 मिनट के लिए ३०० एक्स जी के लिए सेंट्रेसेज सेल और सुपरनांट को त्यागें । 1 x 106 कोशिकाओं के घनत्व के लिए कोशिकाओं को पतला S2 * कोशिकाओं के लिए पूर्ण माध्यम के साथ के रूप में 1.1.1 कदम में वर्णित है ।
      2. बीज 1 x 105 S2 * कोशिकाओं (१०० μl) प्रति अच्छी तरह से फ्लैट-नीचे ९६-अच्छी तरह से थाली (~ 30% कन्फ्लुएंसी) ।
      3. S2 * कोशिकाओं के लिए पूर्ण माध्यम के साथ dcv स्टॉक के सीरियल 10 गुना dilutions प्रदर्शन । अच्छी तरह से ५० μl dilutions जोड़ें । अच्छी तरह से नकारात्मक नियंत्रण के रूप में वर्गीकृत करने के लिए वायरस के बिना संस्कृति माध्यम के ५० μl जोड़ें ।
        नोट: प्रत्येक कमजोर पड़ने की दर के लिए, 8 कुओं का इस्तेमाल किया गया. ठेठ dcv उपज के आसपास है के रूप में 108-109 pfu/एमएल, कमजोर पड़ने चाहिए ~ 10-5-10-10 कवर ।
      4. 4 दिन पर, एक 20x या 40x उद्देश्य के साथ एक उज्ज्वल क्षेत्र खुर्दबीन के साथ सीपीई का निरीक्षण । वर्गीकृत एक अच्छी तरह से जिसमें कोशिकाओं मंदता देखो और मध्यम एक "सकारात्मक अच्छी तरह से" के रूप में टुकड़े से भरा है, और एक अच्छी तरह से जिसमें सेल आकारिकी "नकारात्मक अच्छी तरह से" के रूप में सामांय है ।
      5. मार्क सीपीई सकारात्मक या नकारात्मक कुओं के साथ + या –, क्रमशः. रीड और मुंच विधि४९द्वारा वायरस tcid५० की गणना करें ।
    7. परिशोधन पैन में सभी दूषित सामग्री और दस्ताने का निपटान । यदि वायरस वांछित tcid५०तक नहीं पहुंच सकता है, तो 4 डिग्री सेल्सियस पर 1 ज के लिए ६८,००० एक्स जी पर अपकेंद्री करके वायरस समाधान के १०० मिलीलीटर को ध्यान केंद्रित करें ।
      नोट: प्रयोग के उद्देश्य के आधार पर, 102 से 106 TCID50 इकाइयों से खुराक की एक सीमा वायरस के संक्रमण के लिए इस्तेमाल किया जा सकता है । आम तौर पर, हम 3 x 106 TCID50 इकाइयों का उपयोग करें ।
    8. सतह पर तैरनेवाला छोड़ें और 1 मिलीलीटर में Tris-HCl बफ़र (10 मिमी, pH ७.२) को फिर से निलंबित करें । प्रति ट्यूब और स्टोर-८० डिग्री सेल्सियस पर वायरस समाधान के aliquot 20 μl. 5 यादृच्छिक ट्यूबों उठाओ औसत वायरस tcid५० फिर से निर्धारित करने के लिए ।
  2. संक्रमण के लिए फ्लाई तैयारी
    नोट: सहजीवी बैक्टीरिया wolbachia कीड़ों में कई प्रकार के आरएनए वायरस के संक्रमण को दबा सकते हैं30,31,३२,३३,४१. इस प्रकार, यह वीवो३३में मेजबान वायरस के संक्रमण का अध्ययन करने से पहले मक्खियों से wolbachia को पुज करने के लिए आवश्यक है ।
    1. ४०० μl के ५० μg/mL टेट्रासाइक्लिन (७०% इथेनॉल में) से 4 ग्राम ताजा मानक कॉर्नभोजन फ्लाई फूड (1 एल के भोजन को जोड़कर टेट्रासाइक्लिन युक्त मक्खी भोजन तैयार करें, इसमें से ७७.७ जी ऑफ कॉर्नभोजन, ३२.१९ जी ऑफ यीस्ट, १०.६ जी का आगर, ०.७२६ जी का cacl2 , ३१.६२ ग्राम सुक्रोज का, ६३.३ ग्राम ग्लूकोज का, 2 ग्राम पोटेशियम का सोरो और 15 मिलीलीटर का 5% C88हे3) । अच्छी तरह से मिक्स और 4 डिग्री सेल्सियस पर भोजन जगह इथेनॉल लुप्त हो जाना ।
      नोट: इथेनॉल की एक उच्च खुराक मक्खी प्रजनन क्षमता को प्रभावित कर सकता है, इसलिए इस कदम को न सोएं ।
    2. भोजन को कमरे के तापमान पर गर्म करें और नए नत्थी किए गए वयस्क मक्खियों (20 महिलाओं और 10 पुरुषों) शीशी में डाल दिया । एक सामान्य प्रकाश/अंधेरे चक्र के तहत 25 डिग्री सेल्सियस, ६०% आर्द्रता पर मक्खियों नस्ल ।
      नोट: आम तौर पर, यह करने के लिए पर्याप्त अंडे देना मक्खियों के लिए 3-4 दिन लगते हैं । बहुत सारे अंडे लार्वा के विकास को रोकते हैं और टेट्रासाइक्लिन दक्षता कम करते हैं ।
    3. इकट्ठा नए नत्थी किए गए वयस्क मक्खियों (3 ~ 5 दिनों के भीतर) सह2के एक प्रकाश प्रवाह के तहत, और चरण को दोहराएं ~ 1.2.1-1.2.2 । आम तौर पर, wolbachiaके पूरी तरह से उंमूलन के लिए 3 पीढ़ियों से कम की आवश्यकता है ।
    4. टेट्रासाइक्लिन उपचार के साथ 3 पीढ़ियों के बाद, wolbachia संक्रमण परीक्षण के लिए सह2 के एक प्रकाश प्रवाह के तहत 5 मक्खियों को इकट्ठा । डबल-आसुत जल (ddh2O) और कुछ ०.५ मिमी बाँझ सिरेमिक मोती एक १.५ मिलीलीटर ट्यूब में एक homogenizer का उपयोग कर के २५० μl के साथ 1 मिनट के लिए मक्खियों पीस । एक और २५० μl 2x बफर एक (०.२ एम Tris-HCl, पीएच ९.०; ०.२ एम edta; 2% sds) के नमूने और भंवर के लिए जोड़ें ।
      नोट: चूंकि एसडीएस मनका आंदोलन में बाधा होगा, 1x बफर एक सीधे मक्खियों पीसने के लिए इस्तेमाल नहीं किया जा सकता है । यदि मक्खियों में लाल आंखें हैं, तो पीसने से पहले सिर निकालें, क्योंकि यह डीएनए उत्पाद के रंग को प्रभावित कर सकता है ।
    5. -८० डिग्री सेल्सियस पर नमूनों फ्रीज (एक वर्ष के लिए रखने के लिए). जल्दी से नमूना-८० डिग्री सेल्सियस से एक 25 ° c पानी स्नान में भंग तक गल । 30 मिनट के लिए ७० डिग्री सेल्सियस पर नमूनों को सेते हैं ।
    6. 15 मिनट या उससे अधिक समय के लिए बर्फ पर 5 एम koac, भंवर और सेते के १९० μl जोड़ें ।
    7. १३,००० एक्स जी पर सेंट्रेसेज नमूने कमरे के तापमान पर 5 मिनट के लिए, सतह पर तैरनेवाला इकट्ठा करने और उन्हें नए ट्यूबों के लिए स्थानांतरण ।
    8. बेहतर गुणवत्ता के साथ डीएनए प्राप्त करने के लिए 1.2.7 कदम दोहराएं ।
    9. प्रत्येक नमूने के लिए isopropanol के ७५० μl जोड़ें और धीरे हाथ से कई बार पलटने. 5 मिनट के लिए कमरे के तापमान पर सेते हैं ।
    10. १३,००० एक्स जी पर 5 मिनट के लिए कमरे के तापमान पर अपकेंद्रिकी नमूने और supernatant त्यागें । ट्यूब के नीचे सफेद जीनोमिक डीएनए पेलेट रहेंगे ।
    11. छर्रों के लिए ७०% इथेनॉल की 1 मिलीलीटर जोड़ें, 5 मिनट के लिए १३,००० एक्स जी पर सेंटरेज, और supernatant त्यागें । जब तक यह पारदर्शी न हो जाए तब तक डीएनए को हवा-सूखी ।
    12. ddh2हे के १०० μl में डीएनए भंग, यूवी तुलना अवशोषण स्पेक्ट्रोफोटोमेट्री द्वारा अनुमापन डीएनए एकाग्रता और १०० एनजी/μl के लिए डीएनए पतला ।
    13. पीसीआर रिएक्शन (एक 20 μl प्रणाली में, सामग्री की तालिकादेखें) के लिए डीएनए के २०० एनजी का प्रयोग करें । निम्न प्रोग्राम द्वारा पीसीआर निष्पादित करें: 15 मिनट के लिए ९५ ° c; ४५ एस के लिए ९५ डिग्री सेल्सियस के ३६ चक्र, ५० ° c के लिए ४५ s, और ७२ ° c के लिए 1 मिनट; और एक थर्मल cycler में एक अंतिम विस्तार कदम (1 मिनट के लिए ७२ डिग्री सेल्सियस) ।
      नोट: wolbachia के आधार पर 16s rrna, निंनलिखित primers का उपयोग करें: 5 ' tgaggaagataatgacgg 3 ' (आगे) और 5 ' cctctatcctctttcaacc 3 ' (रिवर्स) । wsp के लिए, प्राइमर्स 5 ' cattggtgttggtgttggtg 3 ' (आगे) और 5 ' accgaaataacgagctccag 3 ' (रिवर्स) थे ।
    14. पीसीआर उत्पादों का विश्लेषण 1% एगारोस जेल इलेक्ट्रोफोरोसिस के साथ करें । wolbachia के 16s rrna और wsp के पीसीआर उत्पाद का आकार क्रमशः २०० बीपी और ६०० बीपी के आसपास है ।
    15. रियर wolbachia मानक cornmeal फ्लाई खाद्य पर मुफ्त मक्खी शेयर । लीजिए 3-5 दिन नव नत्थी किए गए पुरुष संक्रमण के लिए मक्खियों ।
      नोट: टेट्रासाइक्लिन उपचार आंतों माइक्रोबायोटा संरचना को भी प्रभावित कर सकता है, जो बाद में मेजबान में एंटीवायरल प्रतिक्रियाओं को प्रभावित करता है । हम अनुशंसा करते हैं कि सभी मक्खियों को एक ही टेट्रासाइक्लिन उपचार प्राप्त करना चाहिए । मुक्त रखें wolbachia-नि: शुल्क मक्खियों के लिए मानक शर्तों के तहत बढ़ती 3 पीढ़ियों के लिए आंत microbiota बहाल ।
  3. पाश्चरेल जीनोटाइपिंग
    नोट: आनुवंशिक पृष्ठभूमि में एस या के आर के विकल्पी पीएसटी जीन की उपस्थिति drosophilaमें dcv संक्रमण को प्रभावित करने के लिए सूचित किया गया है३४,३५. यह विशेष रूप से dcv संक्रमण के लिए, पीएसटी जीनोटाइप की जांच करने के लिए आवश्यक है । वहां पीएसटी में कुछ snps कि वायरस के संक्रमण को प्रभावित कर सकते हैं, मेजर snps 512c/ तापमान प्रवणता पीसीआर एक त्वरित विधि के लिए पीएसटी जीनोटाइप की पहचान है ।
    1. ऊपर वर्णित के रूप में फ्लाई जीनोमिक डीएनए निकालें (कदम 1.2.4-1.2.15).
    2. का प्रयोग करें १०० टेंपलेट के रूप में डीएनए के एनजी, 512c प्राइमर, 5 ' cagcatggtgtccatgaagtc 3 ' (फॉरवर्ड) और 5 ' acgtgatcaatgctgaaagt 3 ' (रिवर्स) के लिए आर एलील का पता लगाने, 512c प्राइमर, 5 ' cagcatggtgtccatgaagtc 3 ' (आगे) और 5 ' acgtgatcaatgctgaaagt 3 ' (रिवर्स) का पता लगाने के लिए एस एलल.
    3. Tm सेट (पिघलने तापमान) ढ़ाल निम्नानुसार: ५४ ° c, ५४.७ ° c, ५५.५ ° c, ५८ ° c, ५९.७ ° c, ६२.२ ° c, ६३.७ ° c, और ६४ ° c (४५ प्रत्येक तापमान पर एस) ।
      नोट: पीसीआर चेन रिएक्शन के 30 चक्रों की सिफारिश की जाती है (20 μl सिस्टम) ।
    4. १००-बीपी पीसीआर उत्पाद को 2% एगारोस जेल इलेक्ट्रोफोरेसिस द्वारा विज़ुअलाइज़ कीजिए ।

2. ड्रॉसोफिला में वायरल इंफेक्शन

  1. नैनो इंजेक्शन से मक्खियों को संक्रमित और अस्तित्व assays प्रदर्शन करते हैं ।
    1. इंजेक्शन सुई तैयार करने के लिए केशिकाओं खींचो, वापस-तेल के साथ इंजेक्शन सुई को भरने और इंजेक्शन के रूप में पहले से५०वर्णित इकट्ठा.
    2. एनेस्थेटाइज़ सह2के एक प्रकाश प्रवाह के तहत पैड पर मक्खियों । इंनोकुलेट वायरस समाधान के ५०.६ nL के इंट्रा-थोरैसिक इंजेक्शन४४ द्वारा मक्खियों (१०० पीफू, Tris-एचसीएल बफर, पीएच ७.२ के साथ पतला) । मक्खियों (प्रति शीशी 20 मक्खियों) के कम से 3 शीशियों सुई ।
      नोट: इंजेक्शन समय लेने वाली है (आम तौर पर १०० प्रति घंटे मक्खियों) और dcv प्रतिकृति बहुत तेजी से है, तो यह बहुत नीचे एक शीशी (20 मक्खियों) परिष्करण एक बार ट्यूब पर सटीक समय लिखने के लिए महत्वपूर्ण है । बफर केवल इंजेक्शन एक नकली नियंत्रण के रूप में सेट है । आमतौर पर, पुरुष वयस्क मक्खियों को पसंद कर रहे हैं, के रूप में परिणाम अधिक स्थिर और जब संभोग और प्रजनन के दौरान हार्मोनल विविधताओं के बाद से महिलाओं का उपयोग कर रहे है की तुलना में पुनरुत्पादन कर रहे है महिलाओं५१के readout को प्रभावित
    3. एक सामान्य प्रकाश/डार्क साइकिल के तहत 25 डिग्री सेल्सियस, ६०% आर्द्रता पर इंजेक्शन मक्खियों बढ़ाएँ । आपूर्ति दैनिक ताजा भोजन के साथ मक्खियों और मृत मक्खियों की संख्या रिकॉर्ड ।
    4. न्यूनतम 3 जैविक प्रतिकृति प्रदर्शन और अस्तित्व वक्र साजिश ।
    5. उत्तरजीविता डेटा के सांख्यिकीय विश्लेषण के लिए, सांख्यिकीय सॉफ्टवेयर द्वारा कापलान-मीयर उत्तरजीविता घटता है । P मानों की गणना करने के लिए लॉग-रैंक परीक्षण निष्पादित करें । उत्तरजीविता तालिका पर, प्रत्येक विषय के लिए जानकारी दर्ज करें । सॉफ्टवेयर तो हर समय में प्रतिशत अस्तित्व गणना करता, और भूखंड एक kaplan-meier अस्तित्व के भूखंड ।
      नोट: अतिरिक्त खमीर को शीशी में न डालें । नकली नियंत्रण के साथ तुलना में, डीसीवी-संक्रमित मक्खियों में कभी-कभार जलोदर होता है और अनाड़ी होते हैं, जो उन्हें चिपचिपा खमीर के प्रति संवेदनशील बनाते हैं । यह प्रारंभिक प्रयोग में अधिक समय अंक रिकॉर्ड करने के लिए एक समय सीमा जिस पर बड़े पैमाने पर मौत संक्रमित मक्खियों के लिए होगा पता लगाने के लिए बेहतर है । आम तौर पर, संक्रमित मक्खियों शायद ही कभी पहले दो दिनों के भीतर मर जाते हैं, यहां तक कि dcr-2 उत्परिवर्ती लाइनों के लिए । के लिए wolbachia मुफ्त डब्ल्यू१११८ (ब्लूमिंगटन ५९०५) dcv के १०० pfu से संक्रमित मक्खी, इस समय खिड़की के आसपास है 3-5 दिनों के बाद संक्रमण । फल मक्खियों कि ०.५ एच पोस्ट इंजेक्शन घंटे के भीतर मर एक विपत्ति के रूप में नहीं गिना जाना चाहिए क्योंकि वे सुई चोट से नहीं वायरल संक्रमण से मारा जा सकता है ।
  2. cpe परख द्वारा dcv लोड उपाय
    नोट: वायरल लोड इसी तरह वायरस स्टॉक (1.1.6 कदम) के टाइट्रेट करने के लिए मापा जाता है, लेकिन अतिरिक्त नमूना तैयारी की आवश्यकता है (2.2.1 कदम-2.2.4) ।
    1. 1 दिन पर, के रूप में चरण 2.1.1-2.1.2 में वर्णित पुरुष मक्खियों को संक्रमित. समूह 20 के समूहों में मक्खियों इंजेक्शन और उंहें वांछित समय (आमतौर पर 24 घंटे या 3 दिनों के लिए) के लिए ताजा मक्खी भोजन पर बढ़ रही है । दैनिक ताजा भोजन के साथ मक्खियों प्रदान करते हैं ।
    2. 2 दिन पर, बीज drosophila S2 के एक 10 सेमी सेल संस्कृति पकवान में लगभग 5 x106 के घनत्व के लिए 1x107 कोशिकाओं/एमएल के रूप में 1.1.1 कदम में वर्णित है ।
    3. 3 दिन पर, 5 मक्खियों लीजिए (सह2के एक प्रकाश प्रवाह के तहत) और 30 एस के लिए एक १.५ मिलीलीटर अपकेंद्री ट्यूब में उन्हें पीस २०० μl के साथ Tris बफर और सिरेमिक मोती homogenizer का उपयोग. -८० डिग्री सेल्सियस पर नमूनों की दुकान या तुरंत अगले कदम के लिए आगे बढ़ना.
    4. अच्छी तरह से नमूना भंवर । एक नया १.५ मिलीलीटर ट्यूब के लिए सतह पर तैरनेवाला फिल्टर करने के लिए एक 1 मिलीलीटर सिरिंज और ०.२२ μm फिल्टर का उपयोग करें । टाइट्रेट करना, के रूप में चरण में वर्णित के साथ आगे बढ़ें ।
  3. dcv लोड qrt द्वारा मापा-पीसीआर
    1. 1 दिन पर, ऊपर वर्णित के रूप में संक्रमित मक्खियों । समूह के इंजेक्शन पुरुष मक्खियों (20 मक्खियों/और वांछित समय के लिए ताजा मक्खी भोजन पर बढ़ने, आम तौर पर 24 घंटे या 3 दिनों के लिए । दैनिक ताजा भोजन के साथ मक्खियों प्रदान करते हैं ।
    2. 3 दिन पर,2 के एक प्रकाश प्रवाह के तहत 5 मक्खियों लीजिए १.५ मिलीलीटर ट्यूब में २०० μl के साथ lysis बफर और 20 सिरेमिक मोती (व्यास = ०.५ मिमी), 30 एस के लिए उच्च गति के साथ homogenizer द्वारा नमूनों पीस । प्रत्येक ट्यूब के लिए अतिरिक्त lysis बफर के ८०० μl जोड़ें और एस स्टोर -८० डिग्री सेल्सियस पर amples या तुरंत आरएनए निष्कर्षण और qrt-पीसीआर का संचालन ।
    3. rnase मुक्त युक्तियाँ, ट्यूबों और deionized तैयार, डाईएथिलपाइकार्बोनेट (depc) इलाज और ०.२२ μm झिल्ली-फ़िल्टर्ड पानी. क्लोरोफॉर्म के २०० μl जोड़ें (≥ ९९.५%) नमूना में और जोरदार हाथ से 15 एस के लिए हिला । पानी के चरण और कार्बनिक चरण स्पष्ट रूप से अलग कर रहे हैं जब तक 5 मिनट या कमरे के तापमान पर अब के लिए सेते ।
      नोट: chloroform अत्यंत खतरनाक है और देखभाल के साथ संभाला जाना चाहिए । ऐसे सैंपल का भंवर न करें, जिससे डीएनए प्रदूषित होने का खतरा बढ़ जाएगा ।
    4. 4 डिग्री सेल्सियस पर 15 मिनट के लिए १३,००० एक्स जी पर अपकेंद्रिका नमूने ।
    5. सतह पर तैरनेवाला के ४०० μl ले लीजिए और नए ट्यूबों के लिए सतह पर तैरनेवाला हस्तांतरण । एक ही मात्रा isopropanol (≥ ९९.५%) के साथ मिक्स, धीरे हाथ से 20 बार के लिए नमूने पलटे, और फिर 10 मिनट या कमरे के तापमान पर अब के लिए हाला ।
      नोट:-20 डिग्री सेल्सियस पर वर्षा आरएनए उपज में वृद्धि होगी ।
    6. 4 डिग्री सेल्सियस पर 10 मिनट के लिए १३,००० एक्स जी पर अपकेंद्रिका नमूने । ट्यूब के नीचे सफेद आरएनए छर्रों दिखाई दे रहे हैं ।
    7. सतह पर तैरनेवाला त्यागें और ७०% इथेनॉल के 1 मिलीलीटर (depc पानी में इथेनॉल) जोड़ें और rna धोने के लिए कुछ समय उलटना ।
    8. 4 डिग्री सेल्सियस पर 5 मिनट के लिए १३,००० एक्स जी पर अपकेंद्रिका नमूने । 5-10 मिनट के लिए सतह पर तैरनेवाला और सूखी आरएनए त्यागें; आरएनए पारदर्शी बनना चाहिए ।
    9. नमूने के लिए depc पानी के ५० μl जोड़ें, कुछ समय और भंवर के लिए पिपेट.
    10. आरएनए एकाग्रता के लिए 3 μl को लें । २६० एनएम पर आरएनए quantify । आम तौर पर, इस प्रोटोकॉल द्वारा निकाले गए आरएनए एकाग्रता लगभग 100-500 μg/μl है, जो cdna संश्लेषण के लिए उपयुक्त है ।
    11. cdna संश्लेषण के लिए आरएनए के 2 μg का उपयोग करें । १०० μl को ddh2O और स्टोर-20 डिग्री सेल्सियस के साथ नमूना को पतला करें ।
    12. निर्माता के निर्देशों के अनुसार qrt-पीसीआर प्रदर्शन और qrt-पीसीआर चलाते हैं ।
      नोट: dcv के cdna संश्लेषण के लिए, यादृच्छिक प्राइमरों हमारे हाथ में पाली एक प्राइमरी से ज्यादा बेहतर काम किया. डीसीवी एमआरएनए एक्सप्रेशन अंतर्जात रिबोसोमल प्रोटीन ४९ (rp49) एमआरएनए के लिए सामान्यीकृत है । इस भाग में प्रयुक्त ओलिगोन्यूक्लिओटाइड प्राइमर्स: rp49 5 ' agatcgtgaagcgcaccaag 3 ' (आगे) और 5 ' caccaggaacttcttgaatccgg 3 ' (रिवर्स); dcv, 5 ' tcatcggtatgcacattgct 3 ' (आगे) और 5 ' cgcataaccatgctcttctg 3 ' (रिवर्स); vago, 5 ' tgcaactctgggagagc 3 ' (आगे) और 5 ' aattgccctgcgtcagttt 3 ' (रिवर्स); वायरस-प्रेरित आरएनए 1 (वीर-1) 5 ' gatcccaattttcccatcaa 3 ' (आगे) और 5 ' gattacagctgggtgcacaa 3 ' (रिवर्स) ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इस खंड के परिणाम D. melanogasterके dcv संक्रमण के बाद प्राप्त कर रहे हैं । चित्रा 1 drosophilaमें वायरल संक्रमण के प्रवाह चार्ट से पता चलता है । मक्खियों इंट्रा-वक्ष इंजेक्शन रहे हैं, और फिर नमूने वायरल tcid५० और जीनोम आरएनए स्तर (चित्रा 1) की माप के लिए एकत्र कर रहे हैं । वायरस संक्रमण सेल lysis पैदा कर सकता है और सीपीई 3 दिनों के बाद संक्रमण (चित्रा 2a) में मनाया जाता है । cpe परख द्वारा मापा वायरस लोड है कि qpcr (चित्रा 2b) द्वारा मापा के साथ लाइन में है । जैसा कि चित्रा 3में दिखाया गया है, वोल्बाचिया ड्रोसोफिलामें डीसीवी संक्रमण को रोकता है । wol-16s rrna और wol प्राइमर्स wolbachia उपस्थिति का पता लगाने के लिए उपयोग किया जाता है (चित्रा 3a) और wolbachiaमुक्त मक्खियों काफी dcv संक्रमण (चित्रा 3a) के बाद अस्तित्व की दर में कमी दिखा । चित्रा 4 विशिष्ट primers का उपयोग ढाल पीसीआर द्वारा पीएसटी बहुरूपता सत्यापित करने के लिए कैसे पता चलता है. चित्रा 5 wildtype मक्खी में dcv संक्रमण की खुराक निर्भर प्रभाव से पता चलता है । चित्रा 5a में जीवित रहने की दर और वायरस लोड 3 दिनों के बाद संक्रमण चित्रा 5aमें दिखाया गया है । चित्रा 6 कि dcv संक्रमण Dcr2/rnai और जंमू एवं कश्मीर/स्टेट एंटीवायरल संकेतन रास्ते मेजबान५२में सक्रिय कर सकते है दर्शाता है । Dcr2/rnai मार्ग के रिपोर्टर जीन vago अभिव्यक्ति का अभिव्यक्ति स्तर ऊंचा है 3 दिनों के बाद संक्रमण (चित्रा 6a) । जंमू एवं कश्मीर-स्टेट मार्ग भी dcv संक्रमण है, जो रिपोर्टर जीन vir के अभिव्यक्ति स्तर से संकेत दिया है पर सक्रिय है -1 (चित्रा 6b) । चित्र 7 से पता चलता है कि Dcr2/rnai मार्ग drosophila५२में एंटीवायरल संक्रमण के लिए महत्वपूर्ण है । dcr-2 उत्परिवर्ती मक्खियों एक घटी हुई जीवित रहने की दर (चित्रा 7a) और एक वृद्धि हुई वायरस लोड (dcr संक्रमण के बादआंकड़ा 7a) है ।

Figure 1
चित्रा 1: drosophila संक्रमण और वायरस लोड विश्लेषण के प्रवाह चार्ट ।
नैनो इंजेक्शन द्वारा drosophila संक्रमण की स्थापना. स्कीमा चार्ट दिखाता है कि मक्खियों अंतर-वक्ष संक्रमित हैं और वायरस लोड cpe परख और qrt-पीसीआर द्वारा मापा जाता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

Figure 2
चित्रा 2: dcv लोड विश्लेषण.
cpe परख द्वारा मापा वायरस लोड कि qpcr द्वारा मापा के साथ लाइन में है । (a) S2 * कोशिकाओं एक अलग वायरस कमजोर पड़ने (५० μl) के साथ 3 दिनों के लिए 25 डिग्री सेल्सियस पर सुसंस्कृत हैं । 1 यूनिट इस्तेमाल किया वायरस के tcid५० है ४.२९ x 109 (के बराबर 3 x 109 pfu/ पहला पैनल, 10-3 कमजोर पड़ने; दूसरा पैनल, 10-7 कमजोर पड़ने; तीसरा पैनल, 10-10 कमजोरियां; आगे पैनल, w/ कक्ष एक और दो में कक्ष ठेठ सीपीई सकारात्मक phenotype दिखाएँ (सफेद तीर सेल मलबे संकेत मिलता है), और कक्ष तीन और चार में कोशिकाओं ठेठ नकारात्मक phenotype दिखाएँ. आंकड़ों में स्केल पट्टी दर्शाई गई है । () क्यूपीसीआर द्वारा डीसीवी लोड का मापन । सीरियल 10-dcv के गुना dilutions प्रदर्शन और S2 * सेल लाइन को संक्रमित । संक्रमित कोशिकाओं का कुल आरएनए निकाला जाता है और क्यूपीसीआर को dcv आरएनए स्तर को मापने के लिए किया जाता है । ग्रेडिएंट वायरल संक्रामक लोड (सीपीई परख द्वारा निर्धारित) कोशिकाओं में मिलान किया जाता है और सकारात्मक qpcr द्वारा माप से संबंधित (आर2= ०.९९९). कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

Figure 3
चित्रा 3: wolbachiaके साथ या बिना मक्खियों के वायरल संक्रमण ।
wolbachia संक्रमण drosophilaमें dcv प्रतिरोध करने के लिए योगदान देता है । () वोल-१६एस आरआरएनए और डब्ल्यूएसपी प्राइमर्स द्वारा वोल्बाचिया उपस्थिति का पता लगाया जाता है । G1, G2 और G3 का प्रतिनिधित्व अयस्कआरमक्खियों (ओरेगन-आर) (ब्लूमिंगटन 5) ने क्रमशः एक, दो और तीन पीढ़ियों के लिए टेट्रासाइक्लिन द्वारा इलाज किया । पीसीआर उत्पाद का आकार २०० बीपी (wol-16s rrna) और ६०० bp (wol) के आसपास है । () वोल्बाचिया मुक्त मक्खियों dcv संक्रमण के लिए और अधिक संवेदनशील हैं । 3-5 दिन पुराने पुरुष वयस्क मक्खियों १०० dcv के pfu के साथ इंजेक्शन रहे हैं । wolbachia मुक्त मक्खियों (ठोस लाइनें) दिखाने के लिए काफी wolbachia संरक्षित मक्खियों से अस्तित्व कम (डैश लाइंस) पर dcv संक्रमण । दो अलग wildtype लाइनों, अयस्कआर और डब्ल्यू१११८, अस्तित्व परख के लिए इस्तेमाल किया और इसी तरह का परिणाम दिखा रहे हैं । सभी त्रुटि पट्टियां मानक त्रुटि (एसई) का प्रतिनिधित्व करते हैं । * p < 0.05, * * p < 0.01, * * * p < 0.001, * * * * p < 0.0001, ns, महत्वपूर्ण नहीं है । कापलान – मीयर (B). कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

Figure 4
चित्रा 4: ग्रैडिएंट पीसीआर द्वारा पाश्चरेल जीनोटाइपिंग ।
pst बहुरूपता प्रवणता पीसीआर द्वारा सत्यापित है । ग्रैडिएंट पीसीआर को drosophila वयस्क में pst R (512c) और S (512c) एलील भेद करने के लिए किया जाता है । टीएम ढ़ाल एक हैं: ५४ डिग्री सेल्सियस, बी: ५४.७ डिग्री सेल्सियस, सी: ५५.५ डिग्री सेल्सियस, डी: ५८ डिग्री सेल्सियस, ई: ५९.७ डिग्री सेल्सियस, एफ: ६२.२ डिग्री सेल्सियस, जी: ६३.७ डिग्री सेल्सियस, एच: ६४ ° c ।  कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

Figure 5
चित्रा 5: जीवन रक्षा दर और अयस्कआर के dcv अनुमापांक dcv की एक अलग खुराक के साथ संक्रमित मक्खियों ।
अयस्कआरमक्खियों dcv के तीन अलग खुराक के साथ इंजेक्शन कर रहे हैं, 10 pfu/मक्खी, ५० pfu/मक्खी और १०० pfu/मक्खी । () उच्च संक्रामक खुराक से संक्रमित होने पर मक्खियों की जीवित रहने की दर काफी कम होती है । () संकेत मक्खियों के पूरे शरीर में dcv आरएनए स्तर qrt-पीसीआर द्वारा संकेत समय पर मापा जाता है और 10 pfu के करने के लिए सामान्यीकृत/ सभी त्रुटि पट्टियां मानक त्रुटि (एसई) का प्रतिनिधित्व करते हैं । * p < 0.05, * * p < 0.01, * * * p < 0.001, * * * * p < 0.0001, ns, महत्वपूर्ण नहीं है । कापलान-मीयर (ए) या एक तरफा anova (B) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

Figure 6
चित्रा 6: Dcr2/rnai और जंमू एवं कश्मीर/स्टेट एंटीवायरल सिग्नलिंग मार्ग dcv संक्रमण के बाद सक्रिय ।
अयस्कआरमक्खियों १०० dcv के pfu से संक्रमित थे । vago (A) और vir-1 (B) पूरे शरीर में व्यक्त mrna संकेत समय अंक पोस्ट संक्रमण पर qrt-पीसीआर द्वारा मापा जाता है । अभिव्यक्ति का परिवर्तन संक्रमण से पहले बेसल स्तर के लिए सामान्यीकृत है । सभी त्रुटि पट्टियां मानक त्रुटि (एसई) का प्रतिनिधित्व करते हैं । * p < 0.05, * * p < 0.01, * * * p < 0.001, * * * * p < 0.0001, ns, महत्वपूर्ण नहीं है । एक तरफा anova (ए, बी) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

Figure 7
चित्रा 7: dcr-2 उत्परिवर्ती dcr संक्रमण के प्रति संवेदनशील मक्खी ।
dcr-2 उत्परिवर्ती मक्खियों और उसके आनुवंशिक नियंत्रण डब्ल्यू१११८ मक्खियों dcr के १०० pfu से संक्रमित थे । () dcr-2 की कमी की जीवित रहने की दर मक्खियों और जंगली प्रकार (डब्ल्यू१११८) dcr संक्रमण के बाद मक्खियों । () संकेत मक्खियों के पूरे शरीर में dcv आरएनए स्तर qrt-पीसीआर द्वारा मापा जाता है 2 दिनों के बाद संक्रमण और डब्ल्यू१११८के लिए सामान्यीकृत । सभी त्रुटि पट्टियां मानक त्रुटि (एसई) का प्रतिनिधित्व करते हैं । * p < 0.05, * * p < 0.01, * * * p < 0.001, * * * * p < 0.0001, ns, महत्वपूर्ण नहीं है । कापलान-मीयर (ए) या छात्र का टी-टेस्ट (बी) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

Subscription Required. Please recommend JoVE to your librarian.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इस लेख में, हम कैसे नैनो इंजेक्शन का उपयोग कर वयस्क drosophila melanogaster में एक वायरल संक्रामक प्रणाली स्थापित करने के लिए पर एक विस्तृत प्रक्रिया प्रस्तुत करते हैं । प्रोटोकॉल उपयुक्त फ्लाई लाइनों और वायरस स्टॉक, संक्रमण तकनीकों, संक्रामक संकेतकों के मूल्यांकन और एंटीवायरल प्रतिक्रिया की माप की तैयारी शामिल हैं । हालांकि dcv एक वायरल रोगज़नक़ का एक उदाहरण के रूप में प्रयोग किया जाता है, वायरस के विभिंन प्रकार के दसियों सफलतापूर्वक drosophila प्रणाली में अध्ययन के लिए लागू किया गया है । इसके अलावा, सैकड़ों नियामक कारकों, या तो वायरस या मेजबान के, मक्खियों में बड़े पैमाने पर स्क्रीनिंग के माध्यम से पहचान की गई है । इस प्रकार, यह विधि उच्च अनुकूलनीय है और dcv/drosophila बातचीत करने के लिए सीमित नहीं है ।

सफलतापूर्वक प्रचार और उच्च अनुमापांक dcv फसल के लिए, कुछ सावधानियों लिया जाना चाहिए । कोशिकाओं को स्वस्थ होना चाहिए, एक उपयुक्त घनत्व पर सुसंस्कृत और समय पर काटा । सेल कल्चर वॉल्यूम को कम करना वायरस टिटर को काफी प्रभावित नहीं करता है । आमतौर पर, 107 moi में dcv से संक्रमित कोशिकाओं = 0.01 अंत में अनुमानित 108-109 dcv के tcid५० , जो vivo में और इन विट्रो प्रयोगों में सबसे की मांग को पूरा कर सकते है उपज जाएगा । वायरस लोड की माप के लिए इस प्रोटोकॉल में सीपीई परख और qrt-पीसीआर परख का वर्णन किया गया है । सीपीई परख किसी भी तरह मुश्किल है । सेल टीका के उपयुक्त घनत्व और सकारात्मक/नकारात्मक सीपीई भेदभाव के एक अनुभवी मानक एक त्वरित और सफल सीपीई परख की अनुमति देते हैं । इस प्रकार, हम एक आसान qrt-पीसीआर परख यहां उपलब्ध कराने में मदद cpe परख माहिर से पहले cpe परख में कटौती से कमजोर पड़ने बिंदु तय करते हैं ।

हालांकि, dcv वयस्क मक्खी और drosophila सेल लाइन के लिए एक बहुत शक्तिशाली वायरस है । केवल १०० pfu/मक्खी टीका 5 दिनों के भीतर जंगली मक्खियों का ५०% मार सकता है । एक अतिरिक्त संक्रमण खुराक जंगली प्रकार मक्खी और संभावित अतिसंवेदनशील लाइनों के बीच महत्व छाया हो सकता है । यह एक नई स्क्रीन की शुरुआत जब कम से दो संक्रमण खुराक लागू करने के लिए महत्वपूर्ण है. चूंकि drosophila की भारी मौत dcv की उच्च lethality की वजह से एक बहुत ही कम समय खिड़की में हो सकता है, प्रारंभिक प्रयोगों में अधिक बार मृत्यु संख्या रिकॉर्डिंग दृढ़ता से सिफारिश की है । डीसीवी संक्रमण के बाद, कुछ मक्खियों में कभी-कभार जलोदर सिंड्रोम होता है । विशेष रूप से, मक्खियों कि ०.५ एच पोस्ट संक्रमण के भीतर मर बाहर रखा जाना चाहिए, जो अनुचित सुई इंजेक्शन चोट के कारण हो सकता है ।

dcv की संक्रामक शक्ति भी कई मेजबान कारकों से प्रभावित है, जो एक प्रयोग शुरू करने से पहले विचार किया जाना चाहिए । wolbachia एक ऊर्ध्वाधर संचारित endosymbiont है कि मक्खियों३२में वायरस के संक्रमण पर काफी प्रभाव पड़ता है । मक्खी भोजन में टेट्रासाइक्लिन उपचार वोल्बाचिया संक्रमण को खत्म करने के लिए एक आम उपयोग की जाने वाली विधि है । हालांकि, इस विधि भी आंतों माइक्रोबायोटा संरचना, जो बारी में एंटीवायरल५३प्रतिक्रिया को प्रभावित कर सकते है बदल । कुछ अध्ययनों से इस तरह के ubc-e2h, cg8492 और pstके रूप में वायरस के संक्रमण३६, पर आनुवंशिक विचरण के महत्व पर बल दिया है. उदाहरण के लिए, सबसे जंगली प्रकार मक्खी लाइनों है पीएसटी विकल्पी है और picorna-वायरस की तरह के प्रति संवेदनशील हैं, जबकि सबसे उत्परिवर्ती लाइनों हम ब्लूमिंगटन स्टॉक सेंटर से परीक्षण किया है पीएसटी आर विकल्पी, इस प्रकार प्रतिरोधी phenotypes होने । यह बहुत बाहर पीएसटीके प्रभाव के शासन के लिए महत्वपूर्ण है, खासकर जब बाहर एक प्रतिरोध जंगली प्रकार नियंत्रण29के साथ तुलना जीन स्क्रीनिंग ।

प्रणालीगत वायरस के संक्रमण को प्रेरित करने के लिए नैनो-इंजेक्शन के अलावा, मक्खियों में वायरस के संक्रमण का अध्ययन करने के लिए अन्य तरीके उपलब्ध हैं । drosophila सेल लाइनों वायरस संक्रमण से संबंधित मेजबान सेलुलर घटक३७,३८बाहर स्क्रीन करने के लिए एक उच्च throughput विधि साबित हो गया है. हालांकि, एक में विट्रो प्रणाली हमेशा झूठी सकारात्मक की एक उच्च दर के साथ साथ है, जब vivo मेंपुष्टि । dcv भी drosophila मौखिक रूप से संक्रमित करने के लिए लागू किया जा सकता है, जबकि यह केवल एक प्रतिबंधित और मामूली संक्रमण ट्रिगर कर सकते हैं. 12 ज के भीतर केवल 20% लार्वा संक्रमित थे और 14% मृत्यु दर देखी गई थी, वयस्क मक्खियों में 20 दिनों में सिर्फ 25% मृत्यु दर22। ०.१५-mm-व्यास पिन के साथ मक्खियों चुभन वायरल संक्रमण सेट करने के लिए एक और तरीका है, लेकिन यह सही संक्रमण खुराक और मात्रात्मक दोहराव सुनिश्चित नहीं कर सकता । मक्खियों में आनुवंशिक हेरफेर द्वारा वायरल प्रोटीन overexpressing एक अच्छा तरीका vivo7में आणविक interactomes अध्ययन है । हालांकि, यह संक्रमण पर मेजबान में फिजियोलॉजी और पैथोलॉजी की वास्तविकता को चित्रित नहीं कर सकता है । इस बीच, नैनो इंजेक्शन विधि भी कमियां है, के रूप में यह संक्रमण का प्राकृतिक मार्ग नहीं है और सीधे एक मजबूत प्रणाली प्रतिरक्षा प्रतिक्रिया बस संक्रमण के बाद उत्तेजित कर सकते हैं, जो क्यूटिकल को दरकिनार, पहली एंटीवायरल रक्षा लाइन. संक्षेप में, विशिष्ट अनुसंधान उद्देश्य और उपलब्ध प्रयोगात्मक स्थिति विभिन्न तरीकों के बीच चुनाव में निर्णायक कारक हैं ।

Subscription Required. Please recommend JoVE to your librarian.


लेखकों का खुलासा करने के लिए कुछ नहीं है ।


हम आईपीएस में पूरी पैन लैब का शुक्रिया अदा करना चाहेंगे । Cas. हम प्रयोगात्मक सहायता के लिए डॉ lanfeng वांग (आईपीएस, कैस) और डॉ गोनालो कॉर्डोवा steger (springer प्रकृति), dr. जेसिका वर्गास (आईपीएस, पेरिस) और dr. Seng झू (आईपीएस, पेरिस) टिप्पणियों के लिए धन्यवाद । एल. पी. (XDA13010500) और एच टी (XDB29030300), चीन के राष्ट्रीय प्राकृतिक विज्ञान फाउंडेशन को एल पी (३१८७०८८७ और ३१५७०८९७) और जे वाई (३१६७०९०९) के लिए चीनी अकादमी ऑफ साइंसेज के सामरिक प्राथमिकता अनुसंधान कार्यक्रम से अनुदान द्वारा इस काम का समर्थन किया गया था । एल. पी कैस यूथ इनोवेशन प्रमोशन एसोसिएशन (२०१२०८३) के फेलो हैं ।


Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction



  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).
<em>drosophila melanogaster</em> में वायरल संक्रमण और मेजबान वायरस बातचीत के विश्लेषण की स्थापना
Play Video

Cite this Article

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).More

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter