Förberedelse och genmodifiering av Nonhuman Primate hematopoetiska stamceller och stamceller
Summary
Målet med detta protokoll är att isolera ickemänskliga primater CD34+ celler från primade benmärg, gen-ändra dessa celler med lentiviral vektorer, och att förbereda en produkt för infusion i autologa värden. Totala protokoll längd är ca 48 h.
Abstract
Hematopoetiska stamceller och stamceller (HSPC) stamcellstransplantation har varit en hörnsten behandling för leukemi och andra cancerformer i nästan ett halvt sekel, ligger bakom den enda kända botemedlet av humant immunbristvirus (HIV-1) infektion och visar enorma löfte i behandling av genetiska sjukdomar såsom beta-thalassemi. Vår grupp har utvecklat ett protokoll till modell HSPC genterapin i icke-mänskliga primater (NHPs), tillåter forskare att optimera många av samma reagenser och tekniker som används i kliniken. Här, vi beskriver metoder för rening av CD34+ HSPCs och långsiktiga framhärdande hematopoetiska stamceller (HSC) delmängder från primade benmärg (BM). Identiska tekniker kan användas för rening av andra HSPC källor (t.ex. mobiliserade perifera stamceller [PBSCs]). Beskrivs är en 2 dagars protokoll där är celler renas, odlade, modifierad med lentivirus (LV) och förberett för infusion tillbaka i autologa värden. Nyckeln avläsning av framgång inkluderar renheten av CD34+ HSPC befolkning, renat HSPCs förmåga att bilda morfologiskt skilda kolonier i halvfasta media, och, viktigast av allt, gen ändring effektivitet. Den viktigaste fördelen att HSPC genterapi är förmågan att ge en källa till långlivade celler som ger upphov till alla typer av hematopoetiska celler. Som sådan, har dessa metoder använts till modell behandlingar för cancer, genetiska sjukdomar och infektionssjukdomar. I varje fall upprättas terapeutisk effekt genom att förbättra funktionen av distinkta HSPC avkomma, inklusive röda blodkroppar, T-celler, B-celler eller myeloisk delmängder. Metoder att isolera, ändra och förbereda HSPC produkter är direkt tillämpliga och översättningsbara till flera sjukdomar hos patienter.
Introduction
Stem cell genterapi är ett kraftfullt sätt att hantera en lång rad mänskliga sjukdomar. HSPC genterapi är en särskilt attraktiv inställning, på grund av (i) den relativa lätthet att samla dessa celler från patienter, ii) mängden kunskap som finns om cell surface fenotyper och ex vivo kultur parametrar, och, som fältet expanderar, eftersom iii) det presenterar forskare med en ständigt ökande verktygslåda av genen modifiering strategier anpassade till olika sjukdomar av intresse. Vi undersöker aktivt HSPC gen terapi metoder från flera vinklar, inklusive grundläggande vetenskapen av HSPC biologi, engraftment av gen-modifierat HSPCs i prekliniska in vivo modeller och ansökan till relevanta patientgrupper. Vi och andra har präglat cell surface fenotypen av funktionellt distinkta HSPC delmängder1,2,3, mobilisering och förbehandlingsregimer som maximerar HSPC avkastning och engraftment samtidigt minimera toxicitet4,5och genen modifiering och genredigering strategier som har skräddarsytts till ett brett utbud av maligna, genetiska och infektionssjukdomar6,7,8, 9,10. Funktion och engraftment av gen-modifierat HSPCs kan utvärderas i ett antal små – och stora-djur modeller, inklusive möss, hundar och NHPs. NHP modeller är särskilt fördelaktiga eftersom många reagenser, till exempel antikroppar specifika för HSPC cell ytproteiner som CD34 och CD90, kan användas omväxlande i mänskliga och NHP celler. Dessutom, i motsats till möss, stora djur som NHPs medge en närmare uppskattning av omfattningen av genmodifiering behövs för klinisk effekt. Slutligen NHPs är den gyllene standarden för modellering av mänskliga sjukdomar såsom HIV-1 infektion11 och en framväxande modellsystem för kandidat mot cancer och anti-hiv immunterapier12,13.
Syftet med detta protokoll är att beskriva metoder för rening, genetiskt modifiera och förbereda NHP HSPC infusion produkter. Även om inte omfattas av detta protokoll, har vi tidigare visat att dessa produkter engraft i autologa NHP värdar, ge upphov till alla hematopoetiska härstamningar och ge terapeutisk effekt i ett brett spektrum av sjukdom modeller1. Vi har också karakteriserat clonality av implantation HSPCs och byggt en plattform för att spåra kinetik, människohandel och fenotyp av individuella HSPCs och deras avkomma, följande autolog transplantation1,14. De metoder som presenteras här har utvecklats med följande mål: i) att isolera högt rena HSPCs och långsiktig implantation HSC delmängder, ii) att upprätthålla primitiva Förenta under ex vivo kultur och iii) effektivt gen-ändra antingen bulk HSPCs eller långsiktiga implantation HSC delmängder. Vi anställer magnetiska-assisted cell-sortering (Mac), samt fluorescens-aktiverad cell sortering (FACS), för att isolera fenotypiskt/funktionellt distinkta HSPC populationer, överensstämmer med metoderna för många grupper2,15, 16. Underhåll av primitiva Förenta i kultur (dvs minimera differentiering av dessa celler i engagerade stamfäder som ger upphov till fullt differentierade lymfoida och myeloida delmängder) är en viktig aspekt av det protokoll som beskrivs här. Även om vi tidigare karakteriserat strategier för att utöka HSPCs samtidigt behålla en primitiv fenotyp17,18, här beskriver vi ett protokoll som fokuserar på att upprätthålla Förenta via en minimal (48 h) och definieras ex vivo kultur.
Effektiv ändringen av HSPCs och HSC delmängder är ett centralt mål i detta protokoll. Bland flera metoder vi har rapporterat, två är överlägset den mest undersökta i kliniska prövningen: LV-medierad genmodifiering och nuclease-medierad gen redigering1,6,19. Genredigering strategier använder en av ett antal nuclease plattformar specifikt ändra en riktade gen av intresse, till exempel C-C chemokine receptor typ 5 (CCR5) för behandling av HIV infektion7,19 eller Bcl11A för behandling hemoglobinopathies6. Här fokuserar vi på LV-medierad genmodifiering, där transgena laster integrera semirandomly i genomet1,8,20. En viktig fördel av LV metoder är förmågan att leverera stora mängder genetiskt material (upp till 8 eller 9 kilobases). Även om genredigering strategier utvecklas för att rikta en transgen av intresse att integrera endast på en viss locus av homologa givare rekombination (HDR), kräver dessa metoder ytterligare utveckling in vitro och i små djurmodeller. Däremot har LV vektorer använts flitigt i NHPs och patienter21,22. Ännu viktigare, kan i protokollet som beskrivs här, som använder primas BM som börjar HSPC källa, enkelt och allmänt anpassas, till exempel isolera PBSCs. Som beskrivits ovan, dra vi nytta av den höga graden av genetisk likhet mellan NHPs och människor att använda reagenser som gäller för båda arterna. Slutligen, detta tillvägagångssätt har anpassats för att ändra andra hematopoetiska delmängder, nämligen T celler12,23,24; tillkomsten av effektiv T-cell immunterapi metoder har förlitat sig tungt på samma LV plattform utnyttjas i detta protokoll. Dessa metoder är lämpliga för alla forskare som är intresserade av antingen HSPC biologi eller LV-medierad genmodifiering. Exempelvis HSPC rening protokollet presenteras här kunde användas för att karaktärisera roman HSC-berikad delmängder, som tidigare beskrivits1,15,25. Likaså den LV transduktion metoder som presenteras här kan på motsvarande sätt tillämpas och utvecklas ytterligare för många andra celltyper och experimentella frågor, både i in vitro- och in vivo modeller.
Sammanfattningsvis presenterar vi metoder för att isolera och genetiskt modifiera NHP HSPCs. Dessa metoder kan lätt anpassas för andra arter och andra källor av HSPCs. Detta noggrant kontrollerats protokoll visar mycket lovande i modellering av effektiva behandlingar för många mänskliga sjukdomar.
Protocol
Representative Results
Discussion
LV vektor engineering är metoden bäst kännetecknas gen-ändra celltyper som CD34+ HSPCs, för efterföljande transplantation invivo. Protokollet beskrivs här är utformad för att maximera antalet gen-modifierat HSPCs som kvarstår långsiktiga i vivo, och ger kliniska fördelar för patienter med olika maligna, infektiös och genetiska sjukdomar. Även om genredigering strategier har dykt upp under det senaste decenniet, LV-modifierade celler är bäst studerade in vitro i djurmodeller och i patienter<sup…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Författarna vill tacka Helen Crawford för att förbereda detta manuskript, Jim Woolace för grafisk design, och Veronica Nelson och Devikha Chandrasekaran för att delta i utvecklingen av protokollet. Utvecklingen av detta protokoll stöds genom bidrag från NIH nationella institutet för allergi och infektionssjukdomar (R01 AI135953 och AI138329 till H.P.K.) och den nationella hjärta, Lung- och Blood Institute (R01 HL136135, HL116217, P01 HL122173 och U19 HL129902 till H.P.K.), samt NIH P51 OD010425 och, delvis genom NIH/NCI cancercentrum, Support Grant P30 CA015704. H.P.K. är en Markey molekylär medicin utredare och fick stöd som konstituerande mottagare av José Carreras/E. Donnall Thomas begåvad stolen för cancerforskning och Fred Hutch begåvad stolen för Cell- och Gene Therapy.
Materials
| Stemspam SFEM II ("HSPC") Media | StemCell | 09655 | |
| Hank's Balanced Salt Solution | Gibco | 14175095 | |
| Phosphate-Buffered Saline | Gibco | 14190-144 | |
| Penicillin/Streptomycin | Gibco | 15140-122 | |
| Dimethyl Sulfoxide | Sigma Aldrich | D2650-100 | |
| 100% Ethanol | Decon labs | M18027161M | |
| Cyclosporine | Sigma | 30024-25MG | |
| 500 mM EDTA | Invitrogen | 15575-038 | |
| Heat-Inactivated Fetal Bovine Serum | Sigma Aldrich | PS-0500-A | |
| CH-296/ RetroNectin (2.5 mL, 1 µg/µL) | TaKaRA | T100B | |
| Bovine Serum Albumin | Sigma | A7906-100g | |
| HEPES | Sigma | H9897 | |
| Rat anti-mouse IgM magnetic beads | Miltenyi Biotec | 130-047-301 | |
| Recombinant HumanStem Cell Factor (SCF) | Peprotech | 300-07 | |
| Recombinant Human Thrombopoietin (TPO) | Peprotech | 300-18 | |
| Recombinant Human FMS-like tyrosine kinase 3 (FLT-3) | Peprotech | 300-19 | |
| Protamine sulfate | Sigma | P-4505 | |
| 14 mL Polypropylene Round-Bottom Tube | Corning | 352059 | |
| Colony Gel 1402 | ReachBio | 1402 | |
| QuadroMACS Separators | Miltenyi Biotec | 130-090-976 | |
| MACS L25 Columns | Miltenyi biotec | 130-042-401 | |
| 10 mM PGE2 | Cayman Chemical | 14753-5mg | |
| TC-treated T-75 flasks | Bioexpress | T-3001-2 | |
| Non-TC-treated T-75 flasks | Thermo-Fisher | 13680-57 | |
| 20 ml syringes | BD Biosciences | 302830 | |
| 16.5 G needles | BD Precision | 305198 | |
| Syringe Tip Cap | BD Biosciences | 305819 | |
| QuickExtract DNA Solution | Epicentre | QE09050 | |
| 8-tube strip cap PCR Tubes | USA scientific | 1402-2708 | |
| 96-well Thermocycler | Thermo-Fisher | 4375786 | |
| Pre-Separation filters | Miltenyi Biotec | 130-041-407 | |
| Strainer, Cell; BD Falcon; Sterile; Nylon mesh; Mesh size: 70um; Color: white; 50/CS | fisher scientific | 352350 | |
| Ultracomp ebeads | eBioscience | 01-2222-42 | |
| MACSmix Tube Rotator | Miltenyi | 130-090-753 | |
| 3 mL Luer-Lock Syringes | Thermo-Fisher | 14823435 | |
| 35 mm x 10 mm cell culture dish | Corning | 430165 | |
| 60 mm x 15 mm cell culture dish | Corning | 430196 | |
| 150 mm x 25 mm cell culture dish | Corning | 430599 | |
| Non TC treated flasks | Falcon | 353133 | |
| Qiagen DNA extraction | Qiagen | 51104 | |
| PE Anti-Human CD90 (Thy1) Clone:5E10 | Biolegend | 328110 | |
| PE-CF594 Mouse Anti-Human CD34 Clone:563 | BD horizon | 562449 | |
| APC-H7 Mouse Anti-Human CD45RA Clone: 5H9 | BD Pharmingen | 561212 | |
| V450 Mouse Anti-NHP CD45 Clone:d058-1283 | BD Biosciences | 561291 | |
| Autologous Serum | Collected from autologous host and cryopreserved prior to mobilization and collection of CD34+ HSPCs | N/A | Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010). |
| Virus-Conditioned Media (VCM) | Kiem Lab, FHCRC Co-operative Center for Excellence in Hematology (CCEH) | N/A | Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010). |
| Anti-CD34 antibody, Clone 12.8 | Kiem Lab | N/A | Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010). |
| Lenti F primer: AGAGATGGGTGCGAGAGCGTCA | Integrated DNA Technologies | N/A | Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016). |
| Lenti R primer: TGCCTTGGTGGGTGCTACTCCTAA | Integrated DNA Technologies | N/A | Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016). |
| Actin F primer: TCCTGTGGCACTCACGAAACT | Integrated DNA Technologies | N/A | Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016). |
| Actin R primer: GAAGCATTTGCGGTGGACGAT | Integrated DNA Technologies | N/A | Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016). |
References
- Radtke, S., et al. A distinct hematopoietic stem cell population for rapid multilineage engraftment in nonhuman primates. Science Translational Medicine. 9 (414), (2017).
- Majeti, R., Park, C. Y., Weissman, I. L. Identification of a hierarchy of multipotent hematopoietic progenitors in human cord blood. Cell Stem Cell. 1 (6), 635-645 (2007).
- Notta, F., et al. Isolation of single human hematopoietic stem cells capable of long-term multilineage engraftment. Science. 333 (6039), 218-221 (2011).
- Hoggatt, J., et al. Rapid mobilization reveals a highly engraftable hematopoietic stem cell. Cell. 172 (1-2), 191-204 (2018).
- Chandrasekaran, D., Nakamoto, B., Watts, K. L., Kiem, H. P., Papayannopoulou, T. Modeling promising nonmyeloablative conditioning regimens in nonhuman primates. Human Gene Therapy. 25 (12), 1013-1022 (2014).
- Humbert, O., Peterson, C. W., Norgaard, Z. K., Radtke, S., Kiem, H. P. A nonhuman primate transplantation model to evaluate hematopoietic stem cell gene editing strategies for beta-hemoglobinopathies. Molecular Therapy. Methods & Clinical Development. 8, 75-86 (2018).
- Peterson, C. W., et al. Differential impact of transplantation on peripheral and tissue-associated viral reservoirs: Implications for HIV gene therapy. PLoS Pathogens. 14 (4), e1006956-e1006956 (2018).
- Zhen, A., et al. Long-term persistence and function of hematopoietic stem cell-derived chimeric antigen receptor T cells in a nonhuman primate model of HIV/AIDS. PLoS Pathogens. 13 (12), e1006753 (2017).
- Moffett, H. F., et al. Hit-and-run programming of therapeutic cytoreagents using mRNA nanocarriers. Nature Communications. 8 (1), 389 (2017).
- Burtner, C. R., et al. Intravenous injection of a foamy virus vector to correct canine SCID-X1. Blood. 123 (23), 3578-3584 (2014).
- Evans, D. T., Silvestri, G. Nonhuman primate models in AIDS research. Current Opinion in HIV and AIDS. 8 (4), 255-261 (2013).
- Taraseviciute, A., et al. Chimeric antigen receptor T cell-mediated neurotoxicity in nonhuman primates. Cancer Discovery. 8 (6), 750-763 (2018).
- McGary, C. S., et al. CTLA-4(+)PD-1(-) memory CD4(+) T cells critically contribute to viral persistence in antiretroviral therapy-suppressed, SIV-infected rhesus macaques. Immunity. 47 (4), 776-788 (2017).
- Beard, B. C., Adair, J. E., Trobridge, G. D., Kiem, H. P. High-throughput genomic mapping of vector integration sites in gene therapy studies. Methods in Molecular Biology. 1185, 321-344 (2014).
- Zonari, E., et al. Efficient ex vivo engineering and expansion of highly purified human hematopoietic stem and progenitor cell populations for gene therapy. Stem Cell Reports. 8 (4), 977-990 (2017).
- Doulatov, S., et al. Revised map of the human progenitor hierarchy shows the origin of macrophages and dendritic cells in early lymphoid development. Nature Immunology. 11 (7), 585-593 (2010).
- Fares, I., et al. Cord blood expansion. Pyrimidoindole derivatives are agonists of human hematopoietic stem cell self-renewal. Science. 345 (6203), 1509-1512 (2014).
- Gori, J. L., et al. Endothelial cells promote expansion of long-term engrafting marrow hematopoietic stem and progenitor cells in primates. Stem Cells Translational Medicine. 6 (3), 864-876 (2017).
- Peterson, C. W., et al. Long-term multilineage engraftment of autologous genome-edited hematopoietic stem cells in nonhuman primates. Blood. 127 (20), 2416-2426 (2016).
- Peterson, C. W., et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Molecular Therapy. Methods & Clinical Development. 3, 16007 (2016).
- Thompson, A. A., et al. Gene therapy in patients with transfusion-dependent beta-thalassemia. The New England Journal of Medicine. 378 (16), 1479-1493 (2018).
- Eichler, F., et al. Hematopoietic stem-cell gene therapy for cerebral adrenoleukodystrophy. The New England Journal of Medicine. 377 (17), 1630-1638 (2017).
- Paul, B., et al. Efficient enrichment of gene-modified primary T cells via CCR5-targeted integration of mutant dihydrofolate reductase. Molecular Therapy. Methods & Clinical Development. 5 (9), 347-357 (2018).
- Levine, B. L., Miskin, J., Wonnacott, K. Global manufacturing of CAR T cell therapy. Molecular Therapy. Methods & Clinical Development. 4, 92-101 (2017).
- Masiuk, K. E., et al. Improving gene therapy efficiency through the enrichment of human hematopoietic stem cells. Molecular Therapy. 25 (9), 2163-2175 (2017).
- Trobridge, G. D., et al. Efficient transduction of pigtailed macaque hematopoietic repopulating cells with HIV-based lentiviral vectors. Blood. 111 (12), 5537-5543 (2008).
- Beard, B. C., et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354 (2010).
- Horn, P. A., et al. Efficient lentiviral gene transfer to canine repopulating cells using an overnight transduction protocol. Blood. 103 (10), 3710-3716 (2004).
- Adair, J. E., et al. Semi-automated closed system manufacturing of lentivirus gene-modified haematopoietic stem cells for gene therapy. Nature Communications. 7, 13173 (2016).
- Kutner, R. H., Zhang, X. Y., Reiser, J. Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors. Nature Protocols. 4 (4), 495-505 (2009).
- Salmon, P., Trono, D. Production and titration of lentiviral vectors. Current Protocols in Human Genetics. 54 (1), (2007).
- Geraerts, M., Willems, S., Baekelandt, V., Debyser, Z., Gijsbers, R. Comparison of lentiviral vector titration methods. BMC Biotechnology. 6, 34 (2006).
- Kiem, H. P., et al. Improved gene transfer into baboon marrow repopulating cells using recombinant human fibronectin fragment CH-296 in combination with interleukin-6, stem cell factor, FLT-3 ligand, and megakaryocyte growth and development factor. Blood. 92 (6), 1878-1886 (1998).
- Morton, W. R., Knitter, G. H., Smith, P. M., Susor, T. G., Schmitt, K. Alternatives to chronic restraint of nonhuman primates. Journal of the American Veterinary Medical Association. 191 (10), 1282-1286 (1987).
- Noser, J. A., et al. Cyclosporine increases human immunodeficiency virus type 1 vector transduction of primary mouse cells. Journal of Virology. 80 (15), 7769-7774 (2006).
- Uchida, N., Hsieh, M. M., Washington, K. N., Tisdale, J. F. Efficient transduction of human hematopoietic repopulating cells with a chimeric HIV1-based vector including SIV capsid. Experimental Hematology. 41 (9), 779-788 (2013).
- Cornetta, K., Anderson, W. F. Protamine sulfate as an effective alternative to polybrene in retroviral-mediated gene-transfer: implications for human gene therapy. Journal of Virological Methods. 23 (2), 187-194 (1989).
- Goerner, M., et al. The use of granulocyte colony-stimulating factor during retroviral transduction on fibronectin fragment CH-296 enhances gene transfer into hematopoietic repopulating cells in dogs. Blood. 94 (7), 2287-2292 (1999).
- Dao, M. A., Hashino, K., Kato, I., Nolta, J. A. Adhesion to fibronectin maintains regenerative capacity during ex vivo culture and transduction of human hematopoietic stem and progenitor cells. Blood. 92 (12), 4612-4621 (1998).
- North, T. E., et al. Prostaglandin E2 regulates vertebrate haematopoietic stem cell homeostasis. Nature. 447 (7147), 1007-1011 (2007).
- Goessling, W., et al. Prostaglandin E2 enhances human cord blood stem cell xenotransplants and shows long-term safety in preclinical nonhuman primate transplant models. Cell Stem Cell. 8 (4), 445-458 (2011).
- Booth, C., Gaspar, H. B., Thrasher, A. J. Treating immunodeficiency through HSC gene therapy. Trends in Molecular Medicine. 22 (4), 317-327 (2016).
- Humbert, O., et al. Rapid immune reconstitution of SCID-X1 canines after G-CSF/AMD3100 mobilization and in vivo gene therapy. Blood Advances. 2 (9), 987-999 (2018).
