Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Manipulation af genfunktioner i mexicansk Cavefish

Published: April 22, 2019 doi: 10.3791/59093

Summary

Vi beskriver tilgange til manipulering af gener i den evolutionære modelsystem Astyanax mexicanus. Tre forskellige teknikker er beskrevet: Tol2-medieret transgenese, målrettede manipulation af genomet ved hjælp af CRISPR/Cas9 og knockdown ytringsfriheden ved hjælp af morpholinos. Disse værktøjer bør lette den direkte undersøgelse af gener, der ligger til grund for variationen mellem overflade - og hulen-boligen former.

Abstract

Cave dyr giver en overbevisende system for at undersøge den evolutionære mekanismer og genetiske grundlag bag ændringer i mange komplekse træk, herunder øjet degeneration, albinisme, søvn tab, Hyperfagi og sensoriske forarbejdning. Arter af cavefish fra hele verden vist en konvergent evolution morfologiske og adfærdsmæssige træk på grund af delte miljøbelastning mellem forskellige grotte systemer. Forskellige cave arter er blevet undersøgt i laboratoriet indstilling. Den mexicanske tetra, Astyanax mexicanus, med seende og blinde former, har givet unik indsigt i biologiske og molekylære processer bag udviklingen af komplekse træk og er godt klar som en spirende modelsystem. Mens kandidat gener regulering udviklingen af forskellige biologiske processer er blevet identificeret i A. mexicanus, har evnen til at validere en rolle for enkelte gener været begrænset. Anvendelsen af transgenese og gen-redigering teknologi har potentialet til at overvinde denne store forhindring og til at efterforske de mekanismer, der ligger til grund for udviklingen af komplekse træk. Her, beskriver vi en anden metode til at manipulere genekspression i A. mexicanus. Metoder omfatter brug af morpholinos, Tol2 transgenese, og gen-redigering systemer, er almindeligt anvendt i zebrafisk og andre fisk modeller, for at manipulere genfunktion i A. mexicanus. Disse protokoller indeholder detaljerede beskrivelser af timet avl procedurer, indsamling af befrugtede æg, injektioner og udvælgelse af genetisk modificerede dyr. Disse metodiske tilgange giver mulighed for undersøgelse af de genetiske og neurale mekanismer bag udviklingen af forskellige træk i A. mexicanus.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Siden Darwins Arternes oprindelse1, har forskere fået dybtgående indsigt i hvordan træk er formet evolutionært som svar på definerede miljømæssigt og økologisk pres, takket være hule organismer2. Den mexicanske tetra, A. mexicanus, består af eyed forfædres 'overflade' befolkning, der bebor floder i hele Mexico og det sydlige Texas og mindst 29 geografisk isolerede befolkninger af afledte cave morphs bebo Sierra del Abra og andre områder af nordøstlige Mexico3. En række af grotte-associerede træk er blevet identificeret i A. mexicanus, herunder ændret iltforbrug, depigmentering, tab af øjne, og ændret fodring og fouragering adfærd4,5,6, 7,8,9. A. mexicanus præsenterer en kraftfuld model for at undersøge mekanismerne på konvergent evolution på grund af en veldefineret evolutionære historie, en detaljeret beskrivelse af økologiske miljø og tilstedeværelsen af selvstændigt udviklet cave populationer10,11. Mange af de hule-afledte træk, der er til stede i cavefish, herunder øjet tab, sove tab, øget fodring, tab af skolegang, reduceret aggression, og reduceret stress svar, har udviklet sig flere gange gennem uafhængige oprindelse, ofte udnytter forskellige genetiske veje mellem caves8,12,13,14,15. Dette gentages evolution er en kraftfuld aspekt af A. mexicanus system og kan give indsigt i den mere generelle spørgsmål om hvordan genetiske systemer kan være rystet til at generere tilsvarende fænotyper.

Mens anvendelsen af genteknologi for mekanistisk undersøgelse af genfunktioner har været begrænset i mange fiskearter (herunder A. mexicanus), danne de seneste fremskridt i zebrafisk grundlag for genetisk teknologiudvikling i fisk 16,17,18,19,20. Adskillige værktøjer er meget udbredt i zebrafisk for at manipulere genekspression, og gennemførelsen af disse procedurer har længe blevet standardiseret. For eksempel, injektion af morpholino oligos (MOs) på stadiet encellede selektivt blokerer RNA og forhindrer oversættelse til et korte tidsmæssige vindue under udvikling21,22. Desuden gen-redigering metoder, såsom grupperet regelmæssigt interspaced korte palindromiske gentagelser (CRISPR) / CRISPR-forbundet protein 9 (Cas9) og transkription aktivere-lignende effektor nukleasen (TALEN), giver mulighed for generation af definerede sletninger eller i nogle tilfælde, indsættelser gennem en rekombination i genomer19,20,23,24. Transgenese bruges til at manipulere stabil genekspression eller funktion i en celletype specifikke måde. Tol2 systemet er brugt effektivt til at generere transgene dyr af coinjecting transposase mRNA med en Tol2 DNA plasmid indeholder et transgen25,26. Tol2 system udnytter Tol2 transposase af medaka til at generere stabile kønscelleoverførsel indsætninger af transgene construct17. Generere Tol2 transgenics indebærer coinjecting et plasmid som indeholder en transgen flankeret af Tol2 integrering websteder og mRNA for Tol2 transposase17. Dette system er blevet brugt til at generere et array af transgene linjer i zebrafisk og dets anvendelse har for nylig udvidet til yderligere emergent modelsystemer, herunder cichlider, killifish, Hundestejle, og mere for nylig, den mexicanske cavefish27, 28,29,30.

Mens cavefish er et fascinerende biologisk system for informative mekanismer af trait evolution, har sin fulde kapacitet som en evolutionær model ikke blevet fuldt udnyttet. Dette er delvis på grund af manglende evne til at manipulere genetiske og cellulære funktion direkte31. Kandidat gener regulering komplekse træk er blevet identificeret ved hjælp af kvantitative træk loci (QTL) undersøgelser, men valideringen af disse kandidat gener har været vanskelige32,33,34. For nylig, forbigående knockdown ved hjælp af morpholinos, gen redigering bruger CRISPR og TALEN, og brugen af Tol2-medieret transgenese har været brugt til at undersøge det genetiske grundlag bag en række træk35,36,37 ,38. Implementering og standardisering af disse teknikker vil give mulighed for manipulationer, at afhøre de molekylære og neurale fundament for biologiske egenskaber, herunder manipulation af genfunktioner, mærkning af definerede cellepopulationer, og udtryk for funktionelle journalister. Der henviser til, at en vellykket gennemførelse af disse genetiske værktøjer til at manipulere gen eller cellulære funktion er blevet påvist i emergent modelsystemer, er detaljerede protokoller stadig mangler i A. mexicanus.

A. mexicanus har kritisk indsigt i mekanismerne i evolution som reaktion på et skiftende miljø og præsentere mulighed for at identificere nye gener, der regulerer forskellige træk. En række faktorer tyder på, at A. mexicanus er en ekstremt tractable model for anvendelse af etablerede genomisk værktøjer i øjeblikket tilgængelig i etablerede genetiske modeller, herunder evnen til at let fastholde fisk i laboratorier, store kuld størrelse, gennemsigtighed, sekventeret genom og definerede adfærdsmæssige assays39. Her, beskriver vi en metode til anvendelse af morpholinos, transgenese og gen redigering i overfladen og cave populationer af A. mexicanus. Den bredere anvendelse af disse værktøjer i A. mexicanus muliggør en mekanistisk undersøgelse af de molekylære processer bag udviklingen af udviklingsmæssige, fysiologiske og adfærdsmæssige forskelle mellem cavefish og overflade fisk.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Morpholino oligo design

Bemærk: Sekvenser for A. mexicanus er tilgængelige via nationale Center for bioteknologi Information (NCBI) genet og NCBI SRA (https://www.ncbi.nlm.nih.gov), samt fra Ensembl genom browser (https://www.ensembl.org). Når du udformer en morpholino til brug i både overflade - og hulen-boligen former, er det afgørende at identificere eventuelle genetiske variation mellem morphs i denne fase, så disse genetiske regioner kan undgås som mål for morpholinos. Enhver polymorfe variation inden for et morpholino målwebsted kan føre til ineffektive bindende. Designet er magen til andre fisk systemer, såsom zebrafisk, og har tidligere vist sig at arbejde effektivt i A. mexicanus21,36,40.

  1. Design af blokering af oversættelse morpholinos
    Bemærk: Blokering af oversættelse morpholinos blokere oversættelse ved at binde sig til endogene startsted og hindre translationel maskiner fra bindende mRNA-sekvensen gennem sterisk hinderance.
    1. Identificere mål gen starter med ATG start site kodning regionen.
    2. Optage de første 25 basepar af target sekvensen ved at kopiere og indsætte sekvensen i en tekst editor eller lab notesbog.
    3. Bruger enten online software (f.eks. http://reverse-complement.com) eller manuel oversættelse, generere det omvendte supplement af target sekvens. Gemme den resulterende omvendt supplement i en teksteditor eller lab notesbog.
    4. Bestil en morpholino med den omvendte supplement sekvens fra et firma, der genererer morpholino oligonukleotider. Se Tabel af materialer for virksomheder.
  2. Design af splice-blokerende morpholinos
    Bemærk: Splice-blokerende morpholinos blokere, splejsning, og dermed forhindre dannelsen af et modent mRNA-molekyle. Dette giver en alternativ metode til knockdown når start steder ikke er veldefineret, eller en mere optimal tilgang, når valideringen af knockdown via Polymerasekædereaktionen (PCR) ønskes. Denne fordel af splice-blokerende morpholinos (over ATG-blokerende MOs) er at exon udstødelse eller intron integration kan vurderes let med reverse transkriptase (RT)-PCR og størrelse forskelle visualiseret på en gel. RT-PCR og gel elektroforese at afgøre morpholino effektivitet bør ske ved hjælp af standard laboratorieprocedurer.
    1. Identificere pre-mRNA sekvensen af target-genet. Udnytte tilgængelige oplysninger fra A. mexicanus genom via NCBI eller Ensembl for at bestemme intron-exon grænser33.
    2. Målrette exon-intron (splice donor) eller intron-exon grænse (splice acceptor) websteder for intron optagelse eller exon udstødelse.
      Bemærk: Spliceosome mål normalt en "GU" sekvens (U1 target) i intron på 5' splejsning websted og en "AG" sekvens på 3' (U2 målet) intronic splejsning websted. Under normale forhold binde spliceosome U1 og U2 underenheder disse målwebsteder på pre-mRNA-sekvensen for ordentlig splejsning at forekomme. Men, hvis nogen af disse mål sekvenser er blokeret af en morpholino, spliceosome vil gå videre til den næste tilgængelige U1 eller U2 site, forårsager en intron udstødelse eller exon i mRNA-sekvensen. Dette vil indebære planlægning/optimering, afhængigt af arten af target gen21. Generelt, blokerer et internt U1 websted omdirigerer splice til den næste tilgængelige U1 site, forårsager en exon excision. Alternativt forårsager blokering første eller sidste splice krydset en intron optagelse fordi der er ingen andre websted at omdirigere splice til. Bruge sekvens software til at forudsige effekten af forskellige udelukkelser versus optagelser. Forudsigelser kan oplyse potentielle frameshifts eller for tidligt stop kodon, der angiver en mere effektiv målwebstedet til mRNA forstyrrelser.
    3. Når målwebstedet er identificeret, skal du registrere sin sekvens i en tekst editor eller lab bog. Sørg for målwebstedet er 25 med basepar (bp) lange.
    4. Bruger enten online software (f.eks. http://reverse-complement.com) eller manuel oversættelse, generere det omvendte supplement af target sekvens. Optage sine sekvens i en tekst editor eller lab bog.
    5. Bestil en morpholino med den omvendte supplement sekvens fra et firma, der genererer morpholino oligonukleotider. Se Tabel af materialer for eksempel virksomheder.

2. Morpholinos til injektion

Bemærk: Flere koncentrationer eller mængder af MO injektion skal udføres for at fastslå den optimale koncentration at injicere. Typiske injektioner mængder er 400-800 pg af MO. Morpholino knockdown effekt kan vedvare i op til 6 dage postinjection.

  1. Opnå den stock morpholino. Den stock morpholino ankommer frysetørret. Fugte det med steril H2O før brug på den ønskede stock koncentration (f.eks. 4 mM). Opbevares ved-20 °C indtil brug.

3. CRISPR gRNA design, in vitro-transskription og forberedelse

  1. CRISPR gRNA design
    Bemærk: gRNAs blev genereret ved hjælp af tidligere publicerede forskning af Varshney et al.40 og Wierson et al.41.
    1. Bruger en genom-browser, identificere den kodende region af genet af interesse. Ved hjælp af genomisk sekvensen, identificere gRNA target sekvens i en exon ved at søge efter en 20 bp nukleotid target sekventering begynder med GG og efterfulgt af en PAM sekvens (NGG). En region af genet efter start (ATG) vil blive rettet.
      Bemærk: Hvis en target sekvens med GG på 5'-enden blev ikke fundet i den ønskede exon genet, en eller begge af G's kan erstattes for de første og anden nukleotider i 5' slutningen af sekvensen. Men to G's skal indarbejdes i oligo, da disse er nødvendige for T7 transskription.
    2. Designe og bestille en gen-specifikke oligonukleotid (oligo A: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). Tilføj den gen-specifikke 20 bp gRNA target sekvens (fed) uden PAM sekvens mellem en T7 promotor sekvens (rød) og en overlapning sekvens plejede at anneal at en anden oligonukleotid (blå). Bind og forstærke (Se trin 3.2.1) denne oligo A og en anden oligo (oligo B: 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') til at generere gRNA skabelonen bruges til transskription.
      Bemærk: Oligo B er den samme for hver reaktion og behøver kun bestilles 1 x.
  2. gRNA forberedelse og transskription
    1. Bind og forstærke oligos. Omfatter de følgende primere for at forstærke gRNA for at øge udbyttet: 5'-TAATACGACTCACTATA-3' (T7 primer) og 5'-GATCCGCACCGACTCGGTG-3' (gRNA primer 3'). Udføre en PCR ved hjælp af Thermococcus kodakaraensis (KOD) polymerase.
      Bemærk: For begge primere i oligo A og oligo B anbefales 10 cykler for et godt udbytte. En detaljeret protokol kan findes i Wierson et al.41.
    2. Transskribere gRNA ved hjælp af kommercielt tilgængelige in vitro-transskription kits (Se Tabel af materialer). Dette sker gennem ændringer at fabrikanten's protokol udgivet af Klaassen et al.42.
    3. Bundfald, vaske, og pelleten gRNA, som beskrevet af Klaassen et al.42.
      Bemærk: GRNA skal være genopslemmes i RNase-fri vand for at forhindre nedbrydning.
    4. Optage gRNA, hvilket kan fastslås ved hjælp af et spektrofotometer koncentration. Vurdere kvaliteten af RNA ved at køre 2 µL på en agarosegel. Alikvot RNA til at undgå at fryse/tø og gemme det på-80 °C indtil umiddelbart før injektionerne.
  3. Cas9 forberedelse og transskription
    1. Cas9 mRNA kan blive transskriberet ved hjælp af kommercielt tilgængelige in vitro-transskription kits (Se Tabel af materialer) som tidligere beskrevet43. Bruge nls-Cas9-nls version43.
    2. Koncentration af gRNA registreres og vurdere dens kvalitet ved at køre 2 µL på en agarosegel. Alikvot RNA til at undgå nedbrydning, der opstår gennem flere fryse-tø cykler, og gemme alikvoter ved-80 °C.

4. forberedelse af Tol2 konstruktioner, Tol2 transposase og transgenese

  1. Forberede Tol2 transgen konstruktioner til injektion.
    Bemærk: Vi har med succes udnyttet offentliggjort/tilgængelige zebrafisk og medaka konstruktioner i A. mexicanus. Disse konstruktioner er fuldt funktionel i A. mexicanus, sandsynligvis på grund af det høje niveau af sekvens Homologi (henvise til arkivet AddGene og zebrafisk informationsnet [ZFIN] databaser til rådighed konstruktioner). Zebrafisk promotor fragmenter har udtrykt transgener i de forventede væv når det bruges i A. mexicanus.
    1. Erhverve Tol2 konstruktioner eller generere plasmid med et væv-specifikke promotor, ønskede transgenet og Tol2 våben (Se Kwan et al.44). Ved modtagelsen, sekvens konstruktion for at validere plasmidet.
    2. Udfører en midiprep for konstruktioner ifølge producenten's retningslinjer. Elueres den endelige plasmid i RNase-fri H2O, bestemmes koncentrationen med et spektrofotometer, fortyndet koncentrationen til 100-300 ng /μL, og delprøve og store konstruktioner ved-20 °C.
  2. Fordøje Tol2 transposase plasmid, og syntetisere mRNA.
    1. Få en kopi af Tol2 transposase plasmid (pc'er-zT2TP) som en skabelon til at generere Tol2 mRNA45.
    2. Midiprep stk-zT2TP konstruere ifølge producenten's retningslinjer. Elueres det i en lav volumen af RNase-fri vand eller buffer (~ 50 μL). Gemme alikvoter ved-20 °C.
    3. Fordøje det Tol2 plasmid ved hjælp af en begrænsning enzym.
      1. Udføre en restriktion digest på 10 µg af cirkulære pc'er-zT2TP plasmid ved hjælp af tabel 1.
      2. Split reaktion i 2-50 μL reaktioner og inkuberes reaktioner natten over ved 37 °C i en termisk cycler.
      3. Den følgende dag, inaktivere enzymet ved at opvarme det til 65 °C i 20 min.
      4. Rense lineariseret plasmid umiddelbart efter digest, ved hjælp af kommercielt tilgængelige PCR rensning kits (Se Tabel af materialer) pr. producenter' retningslinjer. Elueres plasmid i 15 μl af RNase-fri H2O og bestemme koncentrationen af produktet ved hjælp af et spektrofotometer.
      5. Køre 1 μL af fordøjet plasmid og 1 μL af uslebne plasmid på en 1,5% Agarosen gel for at bekræfte lineariseret plasmid.
    4. Udføre en in vitro-transskription af Tol2 mRNA.
      1. Udnytte 1 µg for lineariserede pc'er-zT2TP plasmid som en skabelon for transskription. Følg fabrikantens's retningslinjer for in vitro-transskription (Se Tabel af materialer) som beskrevet i tabel 2.
      2. Der inkuberes ved 37 °C i en termisk cycler pr. producent's retningslinjer.
      3. Tilføj 1 µL af DNase, der inkuberes ved 37 °C i en termisk cycler pr. producent's retningslinjer.
      4. Udføre lithium chlorid nedbør pr. transskription kit protokol. Resuspenderes RNA i ~ 20-30 μL af RNase-fri H2O.
      5. Bestemme koncentrationen af produktet ved hjælp af et spektrofotometer og optage RNA kvalitet.
      6. Fortyndes produkt at ~ 100-300 ng/µL og prøve det i 5-10 μL prøver at undgå gentagne fryse-tø. Opbevar dem ved-80 °C indtil brug.
        Bemærk: Det er muligt at kontrollere 1-2 µL af renset Tol2 mRNA for smøre/band med gelelektroforese.

5. microinjections

  1. Udarbejdelse af generelle værktøjer for injektioner
    Bemærk: Fremgangsmåderne i dette afsnit er beskrevet i detaljer af Kowalko et al.46, og et overblik med mindre ændringer er præsenteret her.
    1. Generere injektion plader ved at hælde varm 3% Agarosen opløst i fisk system vand i en 100 mL petriskål. Omhyggeligt placere et æg indsprøjtning skimmel i den frisk hældte Agarosen at gøre wells for fisk, æg. Læg siden af formen i agar i en 45° vinkel og derefter langsomt sænke det til Agarosen; langsomt sænke skimmel i en vinkel undgår luft at få fanget under formen. Forsigtigt fjerne formen når Agarosen er størknet. Pladerne kan opbevares, forseglet, ved 4 °C i op til 1 uge.
    2. Pull nåle fra borsilikatglas kapillærer til injektion i en elektrode/nål puller ifølge producenten's retningslinjer. Denne protokol vil variere pr. pipette puller; dog kan en nål-trækker eksempelprogram findes i tabel 3.
      Bemærk: Optimering af nålen er vigtigt for injektioner, da nåle, der er alt for længe vil bøje, snarere end rent trænge ind i ægget.
    3. Gøre store-bore glas pipetter til æg overførsel ved at bryde standard glas pipetter, så åbningen er store nok til at æggene. Ved hjælp af en bunsenbrænder, polsk brudt slutningen af glasset ved at udsætte i slutningen af det brudte pipetter til flammen, indtil det er glat.
  2. Avl setup
    Bemærk: Der er mange forskellige protokoller, der bruges til avl A. mexicanus. For en detaljeret protokol, se Borowsky39. Starte opsætningen avl 1 uge før injektionerne.
    1. På dag 1, placere to eller tre hunner og tre til fire mænd i en enkelt 10 gallon tank vedligeholdes på 24 ± 1 °C.
    2. På dag 1-7, øge fodring ~ 3 x en dag. Sikre, at kosten indeholder levende fødevarer, såsom sort orme og artemia.
    3. Dag 6, tilføje en enkelt tank varmer indstillet til 27 °C. Lab tank temperaturer kan variere; Dette vil derfor en stigning på 2-3 °C i forhold til den normale tank temperatur.
    4. Om aftenen den dag 7, som er om aftenen (zeitgeber [ZT] 9-11) af injektion nat, grundigt ren tanke med en vand-gennemblødt svamp og fjerne eventuelle overskydende mad eller belægninger med et finmasket net eller en sifon.
    5. Om natten den dag 7, begynder at kontrollere for overflade fiskeæg på ZT15 og fortsætte med at tjekke hver 15-30 min. indtil ZT18. For cavefish, begynder at kontrollere for æg på ZT17 og fortsætte med at tjekke hver 15-30 min. indtil ZT20.
      Bemærk: Gange er baseret på en 14:10 h lys: mørke cyklus ved hjælp af zeitgeber tid. Avl gange er skøn og individuelle øvelser skal bestemme nøjagtige tidspunkter. Det er afgørende at indsamle æg, snart efter de er udgivet/befrugtet for at injicere dem på én celle stadium.
  3. Samling af enkelt-celle stadium æg
    1. Natten hvor forventes avl, undersøge tankene hver 15-30 min og monitor for æg i bunden af tanken. Æg vises gennemskinnelig, måling ca 1 mm i diameter.
    2. Bruge en finmasket fisk netto at indsamle æg og overføre dem til en glasskål fyldt med frisk fisk system vand. Undersøge æg under et mikroskop for at bekræfte, at æggene er på én-celle stadium.
    3. Bruge glas pipetter, overføre én celle æg til injektion plader. Glas pipetter er nødvendige på dette stadium, som æggene vil holde sig til plast.
    4. Ved hjælp af en pipette, omhyggeligt frigive æg i wells af Agarosen injektion plade fra afsnit 5.1. Fylde rækkerne af forvarmet (stuetemperatur) injektion plade med det maksimale antal æg (30-40 pr. række og op til fem rækker). Fuld rækker hjælpe med at holde æggene fra flytning under injektioner. Holde æggene hydreret på injektion pladen med en lille mængde af fisk system vand indtil ydelse af injektionerne.
  4. Pico-injektion setup og generelle injektion optimization retningslinjer
    1. Opfyldning injektion nåle ved hjælp af enten gel-loading pipette tips der passer inde i kapillær eller ved hjælp af standard mikropipette tips og tilføje en 2-4 µL bolus til slutningen. Når nålen er fyldt, skal du bruge pincet til at trimme det overskydende længde fra injektion nålen.
    2. Udføre microinjections ved hjælp af en nål, monteret i en micromanipulator, tilsluttet en picoliter microinjector.
    3. Indstille injektion til 0,03 s og trykket ud ved ~0.0 psi. Indsprøjtning pres vil variere i overensstemmelse hermed med mindre forskelle mellem nåle, så Optimer for at opnå en ~1.0 nL injektion bolus.
      Bemærk: Indsprøjtning pres er ofte i rækken af ~ 10-30 psi.
    4. Standardisere bolus injektion af indsprøjtning i mineralsk olie og måle bolus størrelse med et dias mikrometer til at opnå en ~ 1-1,5 nL Injektionsvolumen. Justere indsprøjtning pres (psi) for at øge eller mindske bolusvolumen.
    5. Trække vand ud af toppen af æg ved hjælp af en lab væv.
      Bemærk: Astyanax æg chorion er lidt sværere at trænge ind end zebrafisk æg. Vi finder, at trække vand ud af toppen af æggene hjælper lette nål indtrængen i ægget. Plade optimering kan give mulighed for ~ 200 æg på en enkelt plade.
    6. Bruge micromanipulator at trænge ind i hvert æg med nålen, og indsprøjtes direkte i æggeblomme. Når placeret i æggeblomme, injicere ægget ved at trykke på inject knap eller injektion fodpedal.
      Bemærk: En fuld plade kan injiceres i ~ 15 min. De enkelt-celle stadium varer ~ 40 min.
  5. Injektion af morpholinos
    Bemærk: Mængden af morpholino nødvendigt for knockdown uden at forårsage toksicitet skal optimeres pr. gen mål; dog en koncentration af 400 pg er et godt sted at starte.
    1. Forbered morpholino, så at 400 pg af morpholino vil blive injiceret pr. æg. Optø morpholino på is. Injektion løsning består af morpholino (på den ønskede koncentration), RNase-fri H2O eller Danieau's løsning, og phenol red (10% af det endelige rumfang). For eksempel, se tabel 4.
    2. Injicér 1 nL per embryon.
  6. CRISPR injektioner
    1. Forberede RNA, så 25 pg af gRNA og 300 pg af Cas9 mRNA samlede vil blive injiceret per embryon. For en stikprøve CRISPR/Cas9 injektion blanding, se tabel 5.
    2. Injicere 2 nL af gRNA/Cas9 mRNA per embryon direkte ind i embryoet.
  7. Injektion af Tol2 transposase og Tol2-flankeret plasmid til transgenese
    1. Optø transposase mRNA og Tol2 plasmid på is. Kombiner Cas9 mRNA (på 25 ng/µL), ønskede Tol2 konstruktion (på 25 ng /μL), og phenol rød (10% af det endelige rumfang) i RNase-fri vand. For en stikprøve Tol2 transgenese injektion blanding, se tabel 6.
    2. Holde indsprøjtning løsning og nåle på isen for at undgå nedbrydning af mRNA. Injicér 1 nL i volumen per embryon.

6. opdræt og screening injiceres fisk

  1. Injiceres fisk dyrehold
    1. Efter at æggene er indsprøjtet, straks overføre dem til glas skåle (10 x 5 cm) fyldt med fisk system vand ~ 200 mL. Æg er nemt skylles ved at dyppe injektion plader i skåle fyldt med fisk vand og skylle æg med en pipette.
    2. Placer ~ 50-80 injiceres embryoner pr skål og bag dem ved 22-24 °C.
    3. Ren skåle med injicerede fisk 2 x om dagen for at fjerne døde embryoner og ændre ~ 20% af vand på daglig basis.
    4. Yderligere opdræt er udført i henhold til tidligere publicerede protokoller39.
  2. Screening af morpholino-indsprøjtning enkeltpersoner
    1. Visualisere dyr under et stereomikroskop at screene for fænotyper. Effekten af morpholinos kan vare op til ~ 5 dage postinjection21.
    2. Foranstaltning adfærdsmæssige fænotyper på 4 dage postinjection.
  3. Screening for CRISPR indels
    1. Design primere til at forstærke genomisk DNA omkring mål-webstedet. Design primere, således at target PCR produkt er omkring 100-125 bp.
      Bemærk: For eksempel til oca2 locus, området omkring gRNA mål-webstedet blev forstærket med fremad primer 5'-CTCCTCTGTCAGGCTGTGC-3' og den omvendte primer 5'-GAAGGGGATGTTGTCTATGAGC-3' til en PCR produkt længde 105 bp.
    2. Ofre embryoner eller fin klip voksne fisk efter institutionelle animalske protokol.
    3. Indsamle embryoner eller dissekeret finner i PCR rør og udtrække DNA og udføre PCR'er. prøven PCR-protokoller for gen-specifikke primere kan findes i Ma et al.35.
    4. At vurdere for mutagenese, køre 5 vil µL PCR produkt på en 3% agarosegel på 70 V for 3 h. Wild-type (nonmutagenized) DNA resultere i en PCR produkt som et særskilt band. Mutant DNA vil resultere i en smeary band på gelen.
    5. For at bestemme rækkefølgen af muterede alleler, TA klon PCR produktet ifølge producenten's instruktioner, vælge kolonier, og miniprep kulturer. Sende den resulterende DNA til sekvensering.
    6. For at etablere og vedligeholde linjer af fisk sender mutante alleler, krydse voksen injiceres fisk til wild-type fisk, og skærmen 5-10 embryoner til at bestemme, hvis nogen af afkommet bære en mutant allel af følgende trin 6.3.1-6.3.6-genet.
      Bemærk: Forskellige F1 individer fra samme F0 grundlægger fisk kan bære forskellige mutationer. Sikre mutant linjer er sekventeret for at opnå mutationer forudsagt for at producere alleler, der er uden for rammen.
    7. Identificere fisk med en mutant allel af PCR ved hjælp af smeary band assay (trin 6.3.1-6.3.6) eller ved at designe allel-specifik PCR-primere, der vil forstærke mutant og vildtype bands (figur 2 c).
    8. Når en linje af fisk er etableret, homozygose mutante alleler at teste for recessive fænotyper.
  4. Screening for transgene positive personer
    Bemærk: Ved hjælp af konstruktioner, der indeholder en fluorescerende maker anbefales at strømline screening for transgene positive personer. Dog standard PCR screening-metoder kan anvendes til at screene for transmission.
    1. Visualisere væv-specifikke fluorescerende proteiner i F0 fisk så tidligt som 2 dage postinjection, med et epifluorescensmikroskop dissekere anvendelsesområde.
      NOTE: Udtrykket i F0 larver er mosaik, og positive personer kan have en række udtryk fænotyper.
    2. Holde positive personer som F0 grundlægger fisk.
    3. Når F0s bliver kønsmodne, backcross stiftende fisk til nontransgenic personer stammer fra den samme befolkning/lab lager. Skærm F1 afkom ved hjælp af den samme protokol, som beskrevet i trin 6.2.
      NOTE: Udtrykket i F1 larver er ensartet og sikrer sammenhæng mellem F1 søskende.
    4. Da Tol2 integration er ikke websted-medieret og integration kan variere blandt grundlæggerne, Vælg F1 søskende afledt en enkelt F0 grundlægger og interbreed positivt at udtrykke F1 søskende for at generere F2s. Dette afkom vil danne grundlag for en stabil linje.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Flere bestande af hulen-boligen A. mexicanus Vis reduceret søvn og øget vågenhed/aktivitet i forhold til deres overflade-bolig artsfæller14. Hypocretin/orexin (HCRT) er en yderst velbevarede neuropeptid, som virker til at øge vågenhed, og afvigelser i HCRT pathway forårsager narkolepsi hos mennesker og andre pattedyr47,48. Vi har tidligere vist, at hulen A. mexicanus har øget udtryk for HCRT peptid, tyder på, at en øget udtryk for dette peptid kan ligge til grund for tabet af søvn i cavefish38. MO knockdown hcrt udtryk giver en kraftfuld tilgang til direkte undersøger effekten af øget hcrt udtryk mægle tabet af søvn i cavefish.

For at undersøge forholdet mellem hcrt udtryk og søvn, designet vi en oversættelse-blokerende morpholino. MO mål de første 25 bp af exon, herunder ATG starte websted (figur 1A,B). Som kontrol udnyttet vi en kommercielt tilgængelig scrambled MO kontrol (figur 1B). Ved at bruge BLAST algoritme NCBI, bekræftede vi, at der er ingen off target effekter til enten MO hele genom (data ikke vist). A. mexicanus overflade fisk og Pachón cavefish blev avlet og deres æg blev indsamlet og derefter sprøjtet med 400 pg af MO i en 1 nL-volumen på én-celle stadium (figur 1 c,D). Fisken blev hævet til 4 dpf og derefter målt til aktivitet og søvn adfærd.

Cave A. mexicanus sprøjtet med kontrolelementet MO udstillet betydeligt mere bevægeapparatet aktivitet og reduceret søvn over en 24-timers periode i forhold til overflade fisk også injiceres med røræg MO (figur 1E,F), hvilket tyder på nogen effekt af den kontrollere morpholino injektioner, som resultaterne er konsistente med tidligere offentliggjorte aktivitet og søvn mønstre i hver morphotype (t = 5.021, df = 88, p < 0,0001). Injektion af HCRT-MO havde ringe effekt på søvn i overflade fisk i forhold til kontrol-indsprøjtning fisk (t = 0,17, df = 88, p > 0,99). Derimod haft hcrt knockdown via MO indsprøjtning en betydelig effekt på søvn i hulen-boligen fisk. Pachón cavefish larver viste mindre end en firedoblet reduktion i bevægeapparatet aktivitet, og sover næsten to gange mere end kontrol Pachón larver (figur 1E,F; t = 2.694, df = 88, p < 0,05). En sammenligning af bevægeapparatet aktivitet og søvn i MO-knockdown overflade - og hulen-boligen fisk viste sammenlignelige bevægelse og søvn beløb (figur 1E, F). Disse data giver et direkte link mellem hcrt udtryk og søvn tab og give en metode til at afhøre de biologiske mekanismer for tab af søvn i de evolutionært afledte hulen-boligen morphs.

Tab af pigmentering kendetegnende for hulen organismer, og flere hulen-boligen Astyanax populationer viser tabet af pigmentering. Albinisme i Molino og Pachón cavefish er kortlagt ved hjælp af QTL kortlægning til en genomisk region, der indeholder gen, okulær albinisme 2 (oca2), hvilket tyder på mutationer i oca2 ligge til grund for albinisme i cavefish6.

For at validere oca2 som de sygdomsfremkaldende locus for albinisme i Pachón cave morphs, udnyttet vi CRISPR/Cas9 gen redigering til at mutere denne region i overfladen fiskebestande. Da exon 21 udgår i Molino fisk6, designet vi en gRNA at målrette denne region af genet (figur 2A). Genomisk sekvensen, herunder gRNA target sekvens og PAM (fed), er 5'-GGTCATGTGGGTCTCAGCTTTGG-3 '. Dette mål sekvens (uden PAM sekvens) blev brugt til at generere en gRNA for målrettede mutagenese. Overflade opdrættere blev foretaget arbejdskammerat, og de resulterende embryoner blev indsamlet på én-celle stadium. Én-celle stadium embryoner blev sprøjtet med Cas9 mRNA og målretning af gRNA oca2, og injiceret dyrene blev hævet til voksenalderen43. De injicerede voksne var lavet til at parre til wild-type overflade fisk, og embryoner fra disse Kors var genotypebestemmes at bestemme kønsceller transmission, ved hjælp af primere fra trin 6.3.1. Vi sekventeret en mutant oca2 allel og identificeret en Kim-linje-overføres 2 bp sletning i oca2 (figur 2B,C). For at lette genotypebestemmelse designet vi allel-specifikke primere til at identificere vildtype og mutante alleler (figur 2D) og genotypebestemmes fisk, ved hjælp af PCR efterfulgt af gelelektroforese (figur 2E). Vi incrossed overflade fisk heterozygous for denne oca2 mutant allel. De resulterende afkom var pigmenteret eller albino (figur 2F-jeg). Pigmenterede personer var wild-type eller heterozygous på oca2 locus, mens albino personer var homozygot mutant (figur 2E). Disse data giver en direkte forbindelse mellem oca2 -gen locus og albinisme i A. mexicanus cavefish.

Utallige adfærd såsom søvn, fodring og stress afviger i A. mexicanus cavefish i forhold til overflade artsfæller, men de underliggende neuronal determinanter mellem morphs forbliver uklart. Hele-hjerne calcium imaging giver en kraftfuld fordomsfri tilgang til at undersøge sammenhænge mellem ændrede neurale aktivitet og ændrede adfærd. Vi genereret overflade fisk og cavefish med en nær allestedsnærværende neuronal udtryk for genetisk kodet calcium indikator, GCaMP6s, reagenser udbredt i zebrafisk forskning. ELAV-lignende neuron-specifik RNA-bindende protein 3 (elavl3) er udtrykt endogent i nyligt differentieret neuroner i hele centralnervesystemet49 og har været anvendt i zebrafisk for at drive udtryk af proteiner i hele størstedelen af nervesystemet50. Vi opnåede en Tol2 konstruktion indeholdende ~2.8 kb zebrafisk elavl3 promotor transskription opstrøms af genetisk kodet calcium indikator GCaMP6s (en fusion af grøn fluorescerende proteiner [normal god landbrugspraksis], calmodulin og M13, en peptid sekvens fra myosin lys-kæde kinase), flankeret på 5' og 3' ender med Tol2 sites (Tol2 -elavl3:GCaMP6s-Tol2)51.

A. mexicanus overflade fisk og Molino cavefish blev avlet, og de resulterende embryoner blev coinjected på det enkelt celle stadium med 25 ng/μl af Tol2 -elavl3:GCaMP6s-Tol2 konstruktion og 25 ng/μl Tol2 transposase mRNA (figur 3A). På 24 – 48 dpf, blev larver screenet for en forbigående neuronal udtryk for GCaMP6s. Disse injiceres (F0) embryoner med et udtryk af GCaMP6s var rejst til voksenalderen og backcrossed med vildtype voksne stammer fra den samme slægt af overflade fisk eller cavefish. De resulterende F1 voksne blev screenet for en stabil udtryk af GCaMP6s udtryk, og disse larver blev opretholdt til at generere stabile linjer (figur 3B,C). Fordi hver F1 voksen med en stabil udtryk har sandsynligvis integreret Tol2 -elavl3: GCaMP6s-Tol2 på forskellige genomisk websteder, hver F1 er udpeget en anden allel. Brug denne fremgangsmåde, har vi skabt stabile F1s overflade fisk og Molino cavefish populationer (figur 3B,C), således gør det muligt live calcium imaging for at afdække forskelle i neuronal aktivitet mægle adfærdsmæssige ændringer i hulen miljø (figur 3 C,D). Yderligere, denne tilgang lægger fundamentet for udtryk for mange ekstra transgener til at karakterisere og manipulere genfunktion i A. mexicanus.

Figure 1
Figur 1: Morpholino knockdown af Hcrt reducerer aktivitet og øger søvn i cavefish. (A) Oversættelse-blokerende morpholino mål de første 25 bp af Hcrt kodende sekvens, herunder ATG startsted. (B) Hcrt morpholino oligo (MO) og styringsforløb. (C) justering af ~ 200 encellede æg på Agarosen æg forme til indsprøjtning. (D) mikroinjektion af 1.0 nL af injektion blanding med phenol rød indikator for visualisering. Skalalinjen = 0,5 mm. (E) Morpholino knockdown af Hcrt reducerer aktivitet (samlet distance rejste) af Pachón cavefish (t = 5.021, df = 88, p < 0,0001) men ikke af overflade fisk (t = 1.318, df = 88, Pedersen > 0.72). (F) Knockdown øger søvn i Pachón cavefish (t = 2.694, df = 88, p < 0,05) men har ingen effekt på overfladen fisk (t = 0,17, df = 88, p > 0,99). Skalalinjen = 1 mm. Fejllinjer i paneler E og F betegne standard fejlen af middelværdien. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: CRISPR gen-redigering af oca2 introducerer albinisme i overflade-bolig A. mexicanus. (A) skematisk af oca2 kodende regioner og guide RNA (gRNA) målretning exon 21 til CRISPR-medieret gen redigering. (B) sekventering kromatogram af vildtype Oca2 + og (C) mutant Oca2 - alleler. Det røde felt i panelet B angiver den 2 bp sekvens, som mangler i den mutant Oca2 - allel afbildet i panelet C. (D) målrettet CRISPR introducerer en 2 bp sletning, forstyrrende Oca2 funktion. Primere er designet til den genotypiske screening af 2 bp sletning i F0 afkom. (E) PCR og gel elektroforese af Oca2 i wild-type overflade fisk (band størrelse = 134 bp) og F0 CRISPR-indsprøjtning afkom (band størrelse = 133 bp). Enkeltpersoner homozygote eller heterozygous for vildtype variant af Oca2 (Oca2 +) er pigmenteret, mens F0s homozygot for 2 bp sletning (Oca2 -) harbor albinisme. (F) hele kroppen billeder af wild-type overflade fisk og (G) af overflade fisk med CRISPR-medieret albinisme. Skalalinjen = 5 mm. (H og I) Magnified udsigt over hovedet på individer afbildet i paneler F og G, henholdsvis. Skalalinjen = 2 mm. venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: Tol2 transgenese af pan-neuronal GCAMP6s muliggør den live imaging af hjerneaktivitet i A. mexicanus. (A) Tol2-medieret transgenese i A. mexicanus. Coinjection af Tol2 mRNA og Tol2 -elav3l: GCAMP6s-Tol2 plasmid integrerer GCAMP6s transgenet i F0 grundlæggerne. Tilbagekrydsning for den oprindelige bestand af wild-type fisk udbytter F1 individer med en stabil pan-neuronal udtryk for GCAMP6s. (B og C) de resulterende afkom er screenet for en stabil udtryk ved hjælp af dissektion og konfokal mikroskopi. Stabil TgAsty(elav3l: GCaMP6s) F1 enkeltpersoner er blevet fastlagt for både overflade-(afbildet i panelet B) og hulen-boligen morphotypes (afbildet i panelet C). Skalalinjen = 200 μm.  Venligst klik her for at se en større version af dette tal.

Reagens Volumen eller beløb
10,0 μg af pc'er-zT2TP plasmid DNA X μl
NEB CutSmart Buffer 10,0 μl
Opdag-HF enzym 2.0 μl
Nukleasen-fri H2O X μl
BSA 1,0 μl
I alt 100 μl

Tabel 1: Begrænsning udtog af Tol2 plasmid.

Reagens Volumen eller beløb
1,0 μg af lineariseret pc'er-zT2TP plasmid DNA X μl
10 x reaktion buffer 2.0 μl
2 x NTP/CAP 10,0 μl
SP6 enzym mix 2.0 μl
RNase-fri H2O X μl
I alt ≤20 μl

Tabel 2: In vitro syntese af Tol2 mRNA.

Indstillingens navn Indstillingsværdien
Varme 510
Trække 55
Hastighed 100
Tid 40
Pres 500
Rampe 534

Tabel 3: Prøve pipette-trækker protokol. 

Reagens Volumen eller beløb
Morpholino (fryser stock @ 4mM) 1,0 μl
Nukleasen-fri H2O eller Danieaus løsning 17,0 μl
Phenol rød 2.0 μl
I alt 20 μl

Tabel 4: Morpholino injektion blanding.

Reagens Volumen af beløb
gRNA (slutkoncentration arbejde @ 100ng/μl) 1 μl
Cas9 mRNA (slutkoncentration arbejde @ 1200ng/μl) 1 μl
RNase-fri H2O 2 µl
I alt 4 μl

Tabel 5: Prøve CRISPR/Cas9 injektion blanding.

Reagens Volumen af beløb
Tol2 plasmid (slutkoncentration arbejde @ 25ng/μl) X μl
Tol2 mRNA (slutkoncentration arbejde @ 25ng/μl) X μl
Phenol rød 1,0 μl
RNase-fri H2O X μl
I alt 15 µl

Tabel 6: Prøve Tol2 transgenese injektion blanding

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Her, leverer vi en metode for at manipulere genfunktion ved hjælp af morpholinos, CRISPR/Cas9 gen redigering og transgenese metode. Rigdommen af genteknologi og optimering af disse systemer i zebrafisk vil sandsynligvis give mulighed for overførsel af disse værktøjer til A. mexicanus med lethed52. De seneste resultater har brugt disse metoder i A. mexicanus, men de forbliver underudnyttede i undersøgelsen af forskellige morfologiske, udviklingsmæssige og adfærdsmæssige træk i dette system30,36,42 , 53.

Morpholinos har været meget anvendt i zebrafisk forskning til knockdown udtryk af gener. Fremgangsmåde er letkøbt og resulterer i en robust knockdown ytringsfrihed. Off-target effekter har dog været bredt dokumenteret22,53; således, dyr, hvor morpholinos har været injiceres til bør overvåges nøje for eventuelle uventede fænotyper22,55. Når det er muligt, skal resultaterne fra morpholino knockdown valideres ved hjælp af andre metoder, f.eks CRISPR/Cas9-medieret knockout tilgange. Mens morpholinos giver mulighed for robust knockdown af genekspression, er morpholino-medieret knockdown forbigående. Således er analysere voksen fænotyper ikke muligt, når du bruger denne metode.

CRISPR/Cas9-medieret mutagenese tilbyder direkte manipulation af specifikke gener. Yderligere, i modsætning til morpholino-medieret knockdown, CRISPR/Cas9 mutagenese giver mulighed for analyse af mutant fænotyper ind i voksenalderen. For at forhindre off target effekter af CRISPR/Cas9, mutant linjer bør være outcrossed flere generationer, og når det er muligt, mere end én allel fremstillet og testet. CRISPR/Cas9-systemet også giver mulighed for at udnytte gen-redigering metoder at banke-alleler eller til at producere særlige genetiske ændringer. CRISPR/Cas9-systemet har været brugt i zebrafisk at producere præcise integrationer af eksogene DNA og generere præcis punktmutationer19,20,56,57,58, 59. med sekventering af cavefish genom, er det nu muligt at identificere single nucleotide polymorphisms (SNPs) eller andre subtile genetiske ændringer mellem overflade fisk og cavefish befolkninger33. Anvendelsen af CRISPR/Cas9 gen redigering giver mulighed for at udveksle alleler mellem overflade fisk og cavefish, eller mellem forskellige populationer af cavefish, at undersøge rollen, som disse genetiske ændringer i forskellige udviklingsprocesser.

Transgenese tilgange er beskrevet i denne protokol giver en enkel og kraftfuld metode for gevinst af funktion studier og til at generere værktøjer til at ændre biologiske processer genetisk. Tol2 systemet er meget udbredt i zebrafisk forskning, og vi har vist, at det er ligeledes stærkt i A. mexicanus. Desuden demonstrerede vi en transgene konstruktion genereret i zebrafisk, der bruger en zebrafisk promotor og sammenfatter endogene udtryk i A. mexicanus. Vi har fundet fire andre promotorer isoleret fra zebrafisk at drive væv-specifikke udtryk som forventet i A. mexicanus (data ikke vist). Da zebrafisk initiativtagere sammenfatte deres bevarede udtryk mønstre i A. mexicanus, tyder dette på, at mange af de genetiske værktøjer kan overføres direkte fra zebrafisk til A. mexicanus uden behov for ændringer med A. mexicanus evalueringsudvalget. Desuden med fremskridt i sekventering teknologier i A. mexicanus33, vil de transgene tilgange beskrevet her tillade en stærk fremtid for undersøgelse af smagsforstærkere og projektledere, der kan spille en rolle i variationen mellem overflade og hule former. Endelig, de kraftfulde værktøjer til genetisk manipulation af biologiske processer, der har gjort zebrafisk værdifulde er lige så vigtige i A. mexicanus60,61,62,63. Forskelle i forskellige adfærdstræk, såsom søvn, fodring, stress og aggression, mellem A. mexicanus overflade - og hulen-boligen former har været udførligt dokumenteret12,14,15 ,38,64, men den underliggende neuronal korrelerer ikke er godt forstået. Værktøjer som Tg(elavl3:GCaMP6s) vil tillade en dissektion af, hvordan forskelle i neuronal aktivitet hjerne-wide korrelerer med forskelle i adfærd og tilbyder et unikt indblik i hvordan hjernen har ændres evolutionært.

Tilsammen, er A. mexicanus klar til at blive en førende model for at undersøge udviklingen i en række forskellige morfologiske og adfærdsmæssige træk. De forskellige forskelle i komplekse biologiske processer i A. mexicanus skabe en platform for undersøger genetiske mekanismer af trait evolution. Anvendelse af værktøjer til at manipulere genfunktion kan hjælpe med at udvikle denne organisme i en model, der kan anvendes til at undersøge biologiske sygdomme relateret til øjet degeneration, Neuro-udviklingsmæssige abnormiteter og søvnløshed.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Forfatterne takke Sunishka Thakur for hendes hjælp i genotypebestemmelse og imaging oca2 mutant fisk afbildet i figur 2. Dette arbejde blev støttet af National Institutes of Health (NIH) award R21NS105071 til A.C.K. og E.R.D., National Science Foundation (NSF) award 1656574 til A.C.K. og NSF award 1754321 J.K. og A.C.K.

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
Manipulation af genfunktioner i mexicansk Cavefish
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter