Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Manipulering av gen funksjon i meksikansk Cavefish

Published: April 22, 2019 doi: 10.3791/59093

Summary

Vi beskriver metoder for manipulering av gener i den evolusjonære modellsystem Astyanax mexicanus. Tre ulike teknikker er beskrevet: Tol2-mediert transgenesis, målrettet manipulering av genomet bruker CRISPR/Cas9 og knockdown uttrykk ved hjelp av morpholinos. Disse verktøyene skal lette direkte etterforskning av gener underliggende variasjon mellom overflaten og hulen boligen skjemaer.

Abstract

Hulen dyr gir et spennende system for gransker evolusjonære mekanismer og genetisk baser underliggende endringer i mange komplekse egenskaper, inkludert øye degenerasjon, albinisme, sove tap, hyperphagia og sensorisk prosessering. Arter av cavefish fra hele verden vise en konvergent evolusjon av morfologiske og atferdsmessige egenskaper på grunn av delt miljøbelastningene mellom forskjellige hule systemene. Mangfoldig hule arter har blitt studert i laboratoriet innstillingen. Den meksikanske tetra, Astyanax mexicanus, med seende og blind skjemaer har unik innsikt i biologiske og molekylære prosesser underliggende utviklingen av komplekse trekk og er godt klar som en ny modell. Mens kandidat gener regulere utviklingen av ulike biologiske prosesser er blitt identifisert i A. mexicanus, er muligheten til å validere en rolle for enkelte gener begrenset. Programmet transgenesis og gen-redigering teknologi har potensialet å overvinne denne betydelig hinder og undersøke mekanismene bak utviklingen av komplekse trekk. Her beskriver vi en annen metode for å manipulere genuttrykk i A. mexicanus. Metoder omfatter bruk av morpholinos, Tol2 transgenesis, og gen-redigering systemer, vanligvis brukes i sebrafisk og andre fisk modeller, manipulere gen funksjon i A. mexicanus. Disse protokollene inneholder detaljerte beskrivelser av tidsbestemte avl prosedyrer, innsamling av befruktet egg, injeksjoner og valg av genmodifiserte dyr. Disse metodologiske tilnærmingsmåter vil tillate etterforskningen av genetiske og nevrale mekanismene bak utviklingen av forskjellige trekk i A. mexicanus.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Siden Darwins Origin of Species1fått forskere betydelig innsikt i hvordan trekk er formet evolusjonært svar på definerte miljøeffekter og økologiske press, takket være hule organismer2. Den meksikanske tetra, A. mexicanus, består av eyed forfedrenes 'overflate' populasjoner som bor elver i Mexico og sørlige Texas og minst 29 geografisk isolert bestander av avledede hule morphs bor Sierra del Abra og andre deler av nordøst Mexico3. En rekke hule-tilknyttede egenskaper har blitt identifisert i A. mexicanus, inkludert endrede oksygenforbruk, depigmentering, tap av øyne, og endret fôring og beite atferd4,5,6, 7,8,9. A. mexicanus presenterer en kraftig modell for å undersøke mekanismer for konvergent evolusjon en veldefinert evolusjonær historie, en detaljert karakterisering av økologiske miljøet og tilstedeværelsen av uavhengig utviklet seg hulen bestander10,11. Mange av de avledede hule egenskapene som finnes i cavefish, inkludert øye tap, sove tap, økt fôring, tap av skolegang, redusert aggresjon, og redusert stressresponser, har utviklet seg flere ganger gjennom uavhengige opprinnelse, ofte utnytte ulike genetisk veier mellom grotter8,12,13,14,15. Dette gjentas evolusjon er en kraftig del av A. mexicanus og kan gi innsikt i spørsmålet om hvordan genetiske systemer mer generelle kan være opprørt generere lignende fenotyper.

Mens anvendelsen av genetisk teknologi for mekanistisk etterforskningen av gen funksjon har blitt begrenset mange fiskearter (inkludert A. mexicanus), gir nylige fremskritt innen sebrafisk grunnlag for genetisk teknologiutvikling i fisk 16,17,18,19,20. Mange verktøy er mye brukt i sebrafisk for å manipulere genekspresjon, og gjennomføringen av disse prosedyrene har lenge blitt standardisert. For eksempel injeksjon av morpholino oligos (MOs) på encellede scenen selektivt blokkerer RNA og hindrer oversettelse for et kort timelige vindu under utvikling21,22. I tillegg gen-redigering tilnærminger, slik som clustered regelmessig interspaced kort palindromic gjentar (CRISPR) / CRISPR-assosiert protein 9 (Cas9) og transkripsjon aktivator som effektor nuclease (TALEN), tillater generering av definerte slettinger eller, i noen tilfeller, innsettinger gjennom en rekombinasjon i genomer19,20,23,24. Transgenesis brukes til å manipulere stabil genuttrykk eller funksjonen på en celle-type bestemt måte. Tol2 systemet brukes effektivt til å generere transgene dyr ved coinjecting transposase mRNA med en Tol2 DNA plasmider inneholder en transgene25,26. Tol2 systemet benytter Tol2 transposase av medaka å generere stabil germline innsettinger av transgene construct17. Genererer Tol2 transgenics innebærer coinjecting en plasmider inneholder en transgene flankert av Tol2 integrasjon områder og mRNA for Tol2 transposase17. Dette systemet har blitt brukt til å generere en rekke transgene linjer i sebrafisk og bruken har nylig utvidet til flere emergent modellsystemer, inkludert ciklider, killifish, Stingsild, og, mer nylig, den meksikanske cavefish27, 28,29,30.

Cavefish er et fascinerende biologiske system for Klargjørende mekanismer av egenskap evolusjon, har sin fulle kapasitet som en evolusjonær modell ikke blitt fullt utnyttet. Dette er delvis på grunn av en manglende evne til å manipulere genetiske og cellular fungere direkte31. Kandidat gener regulere komplekse egenskaper har blitt identifisert ved hjelp av kvantitative egenskap loci (QTL) studier, men validering av disse kandidat gener er vanskelig32,33,34. Nylig forbigående knockdown bruker morpholinos, gene redigering med CRISPR og TALEN, og bruk av Tol2-mediert transgenesis har blitt brukt til å undersøke genetisk grunnlag underliggende flere trekk35,36,37 ,38. Implementering og standardisering av disse teknikkene gjør manipulasjoner som forhøre molekylære og nevrale grunnlaget for biologiske egenskaper, inkludert manipulering av gen funksjon, merkingen av definerte celle populasjoner, og uttrykket av funksjonelle journalister. Mens den vellykkede implementeringen av disse genetiske verktøy for å manipulere genet eller cellulære funksjoner har blitt vist i emergent modellsystemer, er detaljert protokoller fortsatt mangler i A. mexicanus.

A. mexicanus gi viktig innsikt i mekanismer for utviklingen som svar på en endring miljøet og presentere mulighet til å identifisere romanen gener som regulerer ulike egenskaper. En rekke faktorer tyder på at A. mexicanus er en ekstremt tett modell for søker etablerte genomisk verktøy tilgjengelig i etablerte genetisk modeller, inkluderer evnen å lett vedlikeholde fisk i laboratorier, stor Foreldreomsorg og yngelens størrelse, åpenhet, sekvensert genomet og definerte opptreden analyser39. Her beskriver vi en metode for bruk av morpholinos, transgenesis og gene redigere overflaten og hule bestander av A. mexicanus. Bredere anvendelse av disse verktøyene i A. mexicanus vil tillate en mekanistisk undersøkelse molekylære prosesser underliggende utviklingen av utviklingsmessige, fysiologiske og behavioral forskjellene mellom cavefish og overflate fisk.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Morpholino oligo design

Merk: Sekvenser for A. mexicanus er tilgjengelig gjennom nasjonale senter for bioteknologi informasjon (NCBI) Gene og NCBI SRA (https://www.ncbi.nlm.nih.gov), samt fra Ensembl genomet leseren (https://www.ensembl.org). Når du utformer en morpholino for bruk i både overflaten og hulen boligen, er det avgjørende å identifisere alle genetisk variasjon mellom morphs på dette stadiet, slik disse genetisk områder kan unngås som mål for morpholinos. En polymorfisk variant i et morpholino målområde kan føre til ineffektiv bindende. Designen er lik andre fisk systemer, som sebrafisk, og har tidligere vist seg å fungere effektivt i A. mexicanus21,36,40.

  1. Utformingen av oversettelse-blokkering morpholinos
    Merk: Oversettelse-blokkerende morpholinos blokkere oversettelse ved binding til endogene startwebstedet og hindre translasjonsforskning maskiner fra bindende mRNA sekvensen gjennom steric hinderance.
    1. Identifisere mål genet starter med startwebstedet ATG koding regionen.
    2. Registrere første 25 base parene av målet sekvensen ved å kopiere og lime sekvensen i en tekst editor eller lab notatboken.
    3. Bruke online programvare (f.eks http://reverse-complement.com) eller manuell oversettelse, Generer det omvendte supplement av målet sekvensen. Lagre det resulterende omvendte supplement i et tekstredigeringsprogram eller lab notatboken.
    4. Bestill en morpholino med omvendt supplement sekvensen fra et selskap som produserer morpholino oligonucleotides. Se Tabellen for materiale for selskaper.
  2. Utformingen av skjøte blokkering morpholinos
    Merk: Splice blokkering morpholinos blokkere skjøting, og dermed hindre dannelse av et modent mRNA molekyl. Dette gir en alternativ metode for knockdown når start-nettsteder ikke er godt definert, eller en mer optimal tilnærming når validering av knockdown via polymerasekjedereaksjons (PCR) er ønsket. Denne fordelen av skjøte blokkering morpholinos (over ATG-blokkerende MOs) er at ekson utelukkelse eller intron inkludering lett kan vurderes med revers transkriptase (RT)-PCR og forskjeller visualisert på en gel. RT PCR og gel geleelektroforese å fastslå morpholino effekt bør gjøres ved hjelp av standard laboratorium prosedyrer.
    1. Identifisere pre-mRNA sekvensen av målet genet. Bruke tilgjengelig informasjon fra A. mexicanus genomet via NCBI eller Ensembl for å bestemme intron-ekson grenser33.
    2. Målrette ekson-intron (skjøte donor) eller intron-ekson grensen (skjøte acceptor) områder for intron inkludering eller ekson eksklusjon.
      Merk: Spliceosome normalt mål en "GU" sekvens (U1 mål) i intron på 5' skjøte området og en "AG" rekkefølgen på 3 (U2) intronic skjøte målområdet. Under normale forhold binde spliceosome U1 og U2 underenheter disse målområder på pre-mRNA rekkefølgen for riktig skjøting oppstår. Men hvis en av disse mål sekvensene er blokkert av en morpholino, vil spliceosome gå videre til neste tilgjengelige U1 eller U2 området, forårsaker en intron utelukkelse eller ekson i mRNA sekvensen. Dette vil innebære planlegging/optimalisering, avhengig av målet genet21. Vanligvis viderekobler blokkerer et internt U1 område skjøte til neste tilgjengelige U1 området, forårsaker en ekson excision. Eventuelt forårsaker blokkere første eller siste skjøte krysset en intron inkludering fordi det er ingen andre område å omadressere skjøte til. Bruk rekkefølgen programvare for å forutsi effekten av ulike utelukkelser versus Inneslutninger. Spådommer kan angi potensielle frameshifts eller tidlig stopp kodon, som indikerer en mer effektiv målområdet for mRNA avbrudd.
    3. Når webområdet er identifisert, kan du registrere rekkefølgen i en tekst editor eller lab. Kontroller at målområdet er 25 base parene (bp) lang.
    4. Bruke online programvare (f.eks http://reverse-complement.com) eller manuell oversettelse, Generer det omvendte supplement av målet sekvensen. Registrere rekkefølgen i en tekst editor eller lab bok.
    5. Bestill en morpholino med omvendt supplement sekvensen fra et selskap som produserer morpholino oligonucleotides. Se Tabellen for materiale for eksempel selskaper.

2. Morpholinos for injeksjon

Merk: Flere konsentrasjoner eller mengder MO injeksjon må utføres for å etablere den optimal konsentrasjonen for å injisere. Typisk injeksjoner mengdene er 400-800 pg av MO. Effekten av morpholino knockdown kan vare i opptil 6 dager postinjection.

  1. Få på lager morpholino. Den lager morpholino kommer lyofilisert. Hydrat den med sterilt H2O før bruk på ønsket lager konsentrasjonen (f.eks 4 mM). Lagre på-20 °C før bruk.

3. CRISPR gRNA design, i vitro transkripsjon og forberedelse

  1. CRISPR gRNA design
    Merk: gRNAs ble generert ved hjelp av tidligere publiserte undersøkelser av Varshney et al.40 og Wierson et al.41.
    1. Bruker en genomet nettleser, identifisere regionen koding av genet av interesse. Bruke genomisk sekvensen, identifisere gRNA målet sekvensen i en ekson ved å søke etter en 20 bp nukleotid målet sekvensering begynner med GG og etterfulgt av en PAM sekvens (NGG). Et område av genet etter starten (ATG) vil være målrettet.
      Merk: Hvis en mål sekvens med GG på 5' slutten ikke finnes i den ønskede ekson genet, en eller begge av G's kan erstattes for de første og andre nukleotider på 5' slutten av sekvensen. Imidlertid de to G's må innarbeides i oligo, da disse er nødvendig for T7 transkripsjon.
    2. Design og bestille en gen-spesifikke oligonucleotide (oligo A: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3 "). Legge til gen-spesifikke 20 bp gRNA målet sekvensen (uthevet) uten PAM rekkefølgen mellom en T7 promoter sekvens (rød) og en overlapping sekvens til anneal til en andre oligonucleotide (blå). Anneal og forsterke (se trinn 3.2.1) denne oligo A og en andre oligo (oligo B: 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3 ") til å generere gRNA malen som brukes for transkripsjon.
      Merk: Oligo B er den samme for hver reaksjon og trenger bare bestilles 1 x.
  2. gRNA forberedelse og transkripsjon
    1. Anneal og forsterke oligos. Inkluderer følgende primerne for å forsterke gRNA for å øke avkastningen: 5'-TAATACGACTCACTATA-3 "(T7 primer) og 5-GATCCGCACCGACTCGGTG-3" (3 gRNA primer). Utføre en PCR bruker Thermococcus kodakaraensis (kode) utvalg.
      Merk: For begge primere i oligo A og oligo B, 10 sykluser er anbefalt for en god avkastning. Du finner en detaljert protokoll i Wierson et al.41.
    2. Transkribere gRNA bruke kommersielt tilgjengelig i vitro transkripsjon kits (se Tabell for materiale). Dette gjøres gjennom endringer produsenten's protokollen publisert av Klaassen et al.42.
    3. Bunnfall, vaske og resuspend gRNA som beskrevet av Klaassen et al.42.
      Merk: GRNA må være resuspended i RNase-gratis vann for å hindre nedbrytning.
    4. Registrere konsentrasjonen av gRNA, som kan bestemmes ved hjelp av et spektrofotometer. Vurdere kvaliteten av det ved å kjøre 2 µL på en agarose gel. Aliquot RNA å unngå fryse/tine og lagre den på-80 °C til umiddelbart før injeksjoner.
  3. Cas9 forberedelse og transkripsjon
    1. Cas9 mRNA kan bli transkribert bruke kommersielt tilgjengelig i vitro transkripsjon kits (se Tabell for materiale) som beskrevet tidligere43. Bruk nls-Cas9-nls versjon43.
    2. Registrere konsentrasjonen av gRNA og vurdere kvaliteten ved å kjøre 2 µL på en agarose gel. Aliquot RNA å unngå nedbryting som oppstår gjennom flere fryse-opptining, og lagre dele på-80 °C.

4. forberedelse Tol2 konstruksjoner, Tol2 transposase og transgenesis

  1. Forberede Tol2 transgene konstruksjoner injeksjon.
    Merk: Vi har lykkes benyttet publisert/tilgjengelig sebrafisk og medaka konstruksjoner i A. mexicanus. Disse konstruerer er fullt funksjonell i A. mexicanus, sannsynligvis på grunn av høy sekvens homologi (se AddGene depotet og sebrafisk informasjonen nettverket [ZFIN] databaser for tilgjengelig konstruksjoner). Sebrafisk promoter fragmenter har uttrykt effekter av transgener i forventet vev i A. mexicanus.
    1. Kjøpe Tol2 konstruksjoner eller generere plasmider med en vev-spesifikke promoter, ønsket transgene og Tol2 armer (se Kwan et al.44). Ved mottak, sekvens konstruksjon for å validere plasmider.
    2. Utføre en midiprep for konstruksjoner ifølge produsenten's retningslinjer. Elute den endelige plasmider i RNase-fri H2O, bestemme konsentrasjonen med et spektrofotometer, fortynne konsentrasjonen til 100-300 ng /μL, og aliquot og store konstruksjoner på-20 °C.
  2. Fordøye Tol2 transposase plasmider og syntetisere mRNA.
    1. Få en kopi av Tol2 transposase plasmider (PC-zT2TP) som en mal for å generere Tol2 mRNA45.
    2. Midiprep PC-zT2TP konstruere ifølge produsenten's retningslinjer. Elute det i et lavt antall RNase-fritt vann eller bufferen (~ 50 μL). Lagre dele på-20 °C.
    3. Fordøye Tol2 plasmider bruker en begrensning enzym.
      1. Utføre en begrensning sammendrag på 10 µg av sirkulære PC-zT2TP plasmider bruke tabell 1.
      2. Delt reaksjonen inn 2-50 μL reaksjoner og ruge reaksjonene overnatting på 37 °C i en termisk cycler.
      3. På dagen kan du deaktivere enzymet ved å varme det til 65 °C for 20 min.
      4. Rense linearisert plasmider umiddelbart etter sammendraget, bruke kommersielt tilgjengelige PCR rensing kits (se Tabell for materiale) per produsenter' retningslinjene. Elute plasmider i 15 μL RNase-fri H2O og bestemme konsentrasjonen av produktet bruker et spektrofotometer.
      5. Kjør 1 μL fordøyd plasmider og 1 μL uncut plasmider på en 1,5% agarose gel for å bekrefte linearisert plasmider.
    4. Utføre en i vitro transkripsjon av Tol2 mRNA.
      1. Bruke 1 µg av lineær PC-zT2TP plasmider som en mal for transkripsjon. Følger produsentens's retningslinjer for i vitro transkripsjon (se Tabell for materiale) som beskrevet i tabell 2.
      2. Ruge på 37 °C i en termisk cycler per produsenten's retningslinjer.
      3. Legg 1 µL av DNase, ruge det på 37 °C i en termisk cycler per produsenten's retningslinjer.
      4. Utføre litium klorid nedbør per transkripsjon kit protokollen. Resuspend RNA pellet i ~ 20-30 μL RNase-fri H2O.
      5. Bestemme konsentrasjonen av produktet ved hjelp av et spektrofotometer og registrere RNA kvaliteten.
      6. Fortynne produktet ~ 100-300 ng/µL og aliquot det til 5-10 μL prøver å unngå gjentatte fryse-tine. Lagre dem på-80 °C før bruk.
        Merk: Det er mulig å sjekke 1-2 µL av renset Tol2 mRNA smøre/bandet med gel geleelektroforese.

5. microinjections

  1. Utarbeidelse av generelle verktøy for injeksjoner
    Merk: Prosedyrene i denne delen har blitt beskrevet i detalj av Kowalko et al.46, og en oversikt med mindre modifikasjoner er presentert her.
    1. Generere injeksjon plater ved pouring varm 3% agarose oppløst i fisk system vann i en 100 mL Petriskål. Forsiktig plassere en egg innsetting formen i den ferske helte agarose å gjøre brønner for fiskeegg. Plasser siden av mold i agar i 45° vinkel, og deretter sakte senke den i agarose; sakte senke mold skrått unngår luft får fanget under mold. Fjern forsiktig mold når agarose er styrket. Platene kan lagres, forseglet, på 4 °C i opptil 1 uke.
    2. Trekk nåler fra Borosilikatglass kapillærene for injeksjon i en elektrode/p avtrekker ifølge produsenten's retningslinjer. Denne protokollen vil variere per pipette avtrekker; Imidlertid kan en nål-rykk prøveprogrammet finnes i tabell 3.
      Merk: Optimalisere nålen er viktig for injeksjoner, som nåler som er for lange vil bøye snarere enn ren trenge egg.
    3. Gjøre stor bar glass Pipetter for egg overføringen ved å bryte målestokk barometer Pipetter så åpningen er stor nok for egg. Bruker en Bunsen brenner, polsk brutt slutten av glass ved å utsette slutten av de ødelagte Pipetter til flammen til det er glatt.
  2. Avl oppsett
    Merk: Det finnes mange forskjellige protokoller brukes til avl A. mexicanus. For en detaljert protokoll, kan du se Borowsky39. Starte avl oppsettet 1 uke før injeksjoner.
    1. På dag 1, plassere to til tre kvinner og tre til fire menn i en enkelt 10 gallon tank opprettholdt på 24 ± 1 °C.
    2. På dager 1-7, øke fôring ~ 3 x en dag. Sikre dietten inkluderer levende mat, som svart ormer og saltlake reker.
    3. På dag 6, legger du til en enkelt tank Varmeapparat satt til 27 °C. Lab tank temperaturene kan variere; Derfor blir dette en økning på 2-3 °C i forhold til normal tank temperaturen.
    4. På kvelden dag 7, som er kvelden (zeitgeber [ZT] 9-11) injeksjon natt, grundig rydde tankene med en vann-gjennomvåt svamp og fjerne alle overmål næringen eller rusk å bruke finmasket nett eller en siphon.
    5. Natt til dag 7, begynne å sjekke for overflate fiskeegg på ZT15 og fortsette å sjekke hver 15-30 min før ZT18. For cavefish, begynne å sjekke for egg på ZT17 og fortsetter å kontrollere hver 15-30 min før ZT20.
      Merk: Tidene er basert på en 14:10 h lys: mørke syklus med zeitgeber tid. Avl er estimater og personlige labs må finne ut nøyaktig. Det er viktig å samle egg snart etter at de er utgitt/befruktet for å injisere dem på enkelte celler scenen.
  3. Samling av encellede scenen egg
    1. Natten som forventes avl, undersøke tankene hver 15-30 min og skjermen for egg på bunnen av tanken. Egg vises gjennomsiktig, måler ca 1 mm i diameter.
    2. Bruk en finmasket fisk netto å samle egg og overføre dem til en glassbolle med fersk fisk system vann. Undersøke egg under et mikroskop for å bekrefte at egg på en celle scenen.
    3. Bruker glass Pipetter, overføre encellede egg til injeksjon platene. Glass Pipetter er nødvendig på dette stadiet som egg vil holde seg til plast.
    4. Bruker en pipette, nøye slipp egg i brønnene av agarose injeksjon plate fra delen 5.1. Fylle radene av prewarmed (ved romtemperatur) injeksjon plate med maksimalt antall egg (30-40 per rad, og opp til fem rader). Hele rader beskytte egg flyttes under injeksjoner. Flinging hydrert på injeksjon platen med en liten mengde fisk system vann før injeksjoner.
  4. Pico-injeksjon oppsettet og de generelle injeksjon optimalisering retningslinjer
    1. Etterfylle injeksjon nålene bruker enten gel-lasting pipette tips som passer inne i kapillær eller bruke standard brønnene tips og legge 2-4 µL bolus til slutten. Når nålen er fylt, bruk tang til å klippe overflødig lengden på injeksjon p.
    2. Utføre microinjections bruker en nål montert i en micromanipulator, koblet til en picoliter microinjector.
    3. Stilles injeksjon til 0,03 s og presset ut på ~0.0 psi. Injeksjon trykket varierer tilsvarende mindre forskjeller mellom nåler, så optimalisere for å oppnå en ~1.0 nL injeksjon bolus.
      Merk: Injeksjon press er ofte i størrelsesorden ~ 10-30 psi.
    4. Standardisere injeksjon bolusen injisere inn mineralolje og måle bolusen størrelse med en lysbilde mikrometer å oppnå en ~ 1-1,5 nL injeksjon volum. Stille injeksjon (psi) for å øke eller redusere bolusvolumet.
    5. Tegne vannet ut av toppen av eggene med en lab vev.
      Merk: Astyanax egg plasmocitara er litt vanskeligere å trenge enn sebrafisk egg. Vi finner at tegning vannet ut av toppen av eggene hjelper lette nål gjennomtrengning i egget. Plate optimalisering kan gi ~ 200 egg på en enkelt plate.
    6. Bruk micromanipulator å trenge hver egg med nålen, og injisere direkte i eggeplomme. Når posisjonert i eggeplomme, injisere egg ved å trykke på Sett inn-knappen eller injeksjon fotpedal.
      Merk: En full plate kan injiseres innen ~ 15 min. Encellede scenen varer ~ 40 min.
  5. Injeksjon av morpholinos
    Merk: Mengden morpholino nødvendig for knockdown uten å forårsake toksisitet må optimaliseres per genet målrette; men en konsentrasjon av 400 pg er et godt sted å begynne.
    1. Forberede morpholino slik at 400 pg av morpholino injiseres per egg. Tine morpholino på is. Injeksjon løsningen består av morpholino (på ønsket konsentrasjonen), RNase-fri H2O eller Danieau's løsning og fenol rødt (10% av det siste bindet). For et eksempel, se Tabell 4.
    2. Injisere 1 nL per fosteret.
  6. CRISPR injeksjoner
    1. Forberede RNA slik at 25 pg av gRNA og 300 pg av Cas9 mRNA totale injiseres per fosteret. Hvis et utvalg CRISPR/Cas9 injeksjon blanding, se tabell 5.
    2. Injisere 2 nL av gRNA/Cas9 mRNA per embryoet direkte til fosteret.
  7. Injeksjon av Tol2 transposase og Tol2-flankert plasmider for transgenesis
    1. Tine transposase mRNA og Tol2 plasmider på is. Kombiner Cas9 mRNA (på 25 ng/µL), ønsket Tol2 konstruksjon (på 25 ng /μL), og fenol rødt (10% av det siste bindet) i RNase-fritt vann. Hvis en prøve Tol2 transgenesis injeksjon blanding, se tabell 6.
    2. Holde injeksjon løsningen og nåler på is å unngå nedbrytning av mRNA. Sprøyte på 1 nL i volum per fosteret.

6. Stell og screening injisert fisk

  1. Injisert fisk dyrehold
    1. Etter eggene er injisert, øyeblikkelig overføre dem til glass boller (10 x 5 cm) fylt med ~ 200 mL fisk system vann. Egg er lett skylles av dipping injeksjon platene i boller fylt med vann og skylling eggene med en pipette.
    2. Plasser ~ 50-80 injisert embryo per bolle og bak dem på 22-24 °C.
    3. Rengjør skåler med injisert fisk 2 x per dag å fjerne døde embryoer og endre ~ 20% av vannet på daglig basis.
    4. Ekstra oppdrett utføres i samsvar med tidligere publiserte protokoller39.
  2. Screening av morpholino-injisert enkeltpersoner
    1. Visualisere dyr under en stereomicroscope til skjermen for fenotyper. Effekten av morpholinos kan vedvare opp til ~ 5 dager postinjection21.
    2. Måle atferdsmessige fenotyper på 4 dager postinjection.
  3. Screening for CRISPR indeler
    1. Design primere å forsterke genomisk DNA rundt målområdet. Utforme primere slik at målet PCR produktet er ca 100-125 bp.
      Merk: For eksempel for oca2 locus, regionen rundt gRNA målområdet ble forsterket bruker frem primer 5'-CTCCTCTGTCAGGCTGTGC-3 "og den omvendte primer 5'-GAAGGGGATGTTGTCTATGAGC-3" for PCR produktet lang 105 bp.
    2. Ofre embryo eller fin klipp voksne fisk i henhold til institusjonelle dyr protokollen.
    3. Samle embryo eller dissekert finnene i PCR rør og ekstra DNA og utføre PCRene. utvalg PCR protokoller for gen-spesifikke primere finnes i Ma et al.35.
    4. Å vurdere for mutagenese, kjøre 5 vil µL av PCR-produkt på en 3% agarose gel på 70 V for 3 h. vill-type (nonmutagenized) DNA resultere i et PCR-produkt som en distinkt band. Mutant DNA vil resultere i en smeary band på gel.
    5. For å bestemme rekkefølgen mutant alleler, TA klone PCR produktet ifølge produsenten's instruksjoner, plukke kolonier og miniprep kultur. Sende resulterende DNA for sekvenser.
    6. Å etablere og vedlikeholde linjer av fisk overføring mutant alleler, krysse voksen injisert fisk til vill-type fisk og skjermen 5-10 embryo å avgjøre hvis noen av avkommet bære en mutant allelet av genet følgende trinn 6.3.1-6.3.6.
      Merk: Ulike F1 personer fra samme F0 grunnlegger fisken kan bære ulike mutasjoner. Sikre mutant linjer er i rekkefølge for å få mutasjoner spådd for å produsere alleler som er utenfor rammen.
    7. Identifisere fisk bærer en mutant allelet PCR bruker smeary band analysen (trinn 6.3.1-6.3.6) eller utforme allel-spesifikke PCR primere som vil forsterke mutant og vill-type band (figur 2C).
    8. Når en linje av fisk er opprettet, homozygose mutant alleler å teste recessiv fenotyper.
  4. Screening for transgene positiv enkeltpersoner
    Merk: Bruke konstruksjoner som inneholder en fluorescerende maker anbefales å effektivisere screening for transgene positive individer. Men standard PCR screening metoder kan brukes til skjermen for overføring.
    1. Visualisere vev-spesifikke fluorescerende proteiner i F0 fisk så tidlig som to dager postinjection, med en epifluorescence dissekere omfang.
      Merk: Uttrykket i F0 Larvene er mosaikk, og positiv enkeltpersoner kan ha en rekke uttrykk fenotyper.
    2. Holde positive individer som F0 grunnlegger fisk.
    3. Når F0s nå modenhet, backcross grunnlegger fisk til nontransgenic personer fra samme befolkningen/lab aksjen. Skjermen F1 avkom bruker den samme protokollen som beskrevet i trinn 6.2.
      Merk: Uttrykket i F1 Larvene uniform og sikrer konsekvens mellom F1 søsken.
    4. Siden Tol2 er ikke området-mediert og integrering kan variere blant grunnleggerne, Velg F1 søsken avledet enkelt F0 grunnlegger og interbreed uttrykk for positive F1 søsken å generere F2s. Denne avkom vil være grunnlaget for en stabil linje.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Flere bestander av hule-bolig A. mexicanus viser redusert søvn og økt våkenhet/aktivitet i forhold til deres overflaten-bolig fra Art14. Hypocretin/orexin (HCRT) er en høyt konservert neuropeptide, som fungerer for å øke våkenhet, avvik i HCRT veien forårsake narkolepsi i mennesker og andre pattedyr47,48. Vi har tidligere vist at hule A. mexicanus økt uttrykk for HCRT peptid, antyder at det økt uttrykket for denne peptid kanskje ligger til grunn tap av søvn i cavefish38. MO knockdown hcrt uttrykk gir en effektiv tilnærming for direkte undersøker effekten av økt hcrt uttrykk formidling tap av søvn i cavefish.

For å undersøke forholdet mellom hcrt uttrykk og sove, utviklet vi en oversettelse-blokkerer morpholino. MO mål de første 25 bp av ekson, inkludert ATG starte sted (figur 1A,B). Som en kontroll utnyttet vi en kommersielt tilgjengelig kryptert MO kontroll (figur 1B). Ved hjelp av BLAST-algoritmen på NCBI, bekreftet vi at det er ingen off-målet effekter for enten MO i genomet (data ikke vist). A. mexicanus overflate fisk og Pachón cavefish ble avlet og egg var samlet og deretter injisert med 400 pg av MO i et 1 nL-volum på en celle scenen (figur 1 c,D). Fisken ble hevet til 4 dpf og deretter målt for aktivitet og sove atferd.

Hulen A. mexicanus injisert med kontrollen MO utstilt betydelig mer locomotor aktivitet og redusert sove over en 24-timers periode sammenlignet overflate fisk også injisert med eggerøre MO (figur 1E,F), tyder ikke effekten av den kontrollere morpholino injeksjoner som resultatene er konsistente med tidligere publiserte aktivitet og søvn mønstre i hver morphotype (t = 5.021, df = 88, p < 0,0001). Injeksjon av HCRT-MO hadde liten effekt på søvn i overflate fisk forhold til kontroll-injisert fisk (t = 0,17, df = 88, p > 0,99). Derimot hadde hcrt knockdown via MO injeksjon en betydelig effekt på søvn i hule-bolig fisk. Pachón cavefish larver viste mindre enn en firedobbelt reduksjon i locomotor aktivitet, og sover nesten to ganger mer enn kontrollere Pachón larver (figur 1E,F; t = 2.694, df = 88, p < 0,05). En sammenligning av locomotor aktivitet og sove i MO-knockdown overflate - og hule-bolig fisk avslørte sammenlignbare bevegelse og sove beløp (figur 1E, F). Disse dataene gi en direkte kobling mellom hcrt uttrykk og sove tap og gir en metode for å avhøre de biologiske mekanismene for tap av søvn i evolusjonært avledede hule-bolig morphs.

Pigmentering tap er et kjennetegn på hulen organismer, og flere hule-bolig Astyanax bestander demonstrere tap av pigment. Albinisme i Molino og Pachón cavefish er tilordnet med QTL-kartlegging en genomisk regionen inneholder genet, okulær albinisme 2 (oca2), tyder mutasjoner i oca2 ligger albinisme i cavefish6.

For å validere oca2 som forårsaker locus for albinisme i Pachón hule morphs, benyttet vi CRISPR/Cas9 gene redigering for å mutere denne regionen overflate fisk bestander. Siden ekson 21 slettes Molino fisk6, utviklet vi en gRNA mot denne regionen av genet (figur 2A). Genomic sekvensen, inkludert gRNA målet sekvensen og PAM (uthevet), er 5'-GGTCATGTGGGTCTCAGCTTTGG-3 ". Målet sekvensen (uten PAM sekvens) ble brukt til å generere en gRNA for målrettet mutagenese. Overflaten oppdrettere ble laget å mate, og de resulterende embryoene var samlet på én celle scenen. En celle scenen embryo ble injisert med Cas9 mRNA og gRNA målretting oca2og injisert dyrene ble reist til voksen43. De injiserte voksne ble gjort å mate å vill-type overflate fisk, og embryoer fra disse krysser var genotyped å bestemme bakterie-line overføring, bruke grunning fra trinn 6.3.1. Vi sekvensert en mutant oca2 allelet og identifisert en bakterie-line-overført 2 bp sletting i oca2 (figur 2B,C). For enkel genotyperingteknologi designet vi allel-spesifikke primere å identifisere vill-type og mutant alleler (figur 2D) og genotyped fisk, bruker PCR etterfulgt av gel geleelektroforese (figur 2E). Vi incrossed overflate fisk heterozygote for denne oca2 mutant allelet. Resulterende avkommet var pigmentert eller albino (figur 2F-jeg). Pigmentert personer var vill-type eller heterozygote på oca2 locus, mens albino personer var homozygous mutant (figur 2E). Disse dataene gi en direkte kobling mellom oca2 gene locus og albinisme i A. mexicanus cavefish.

Utallige atferd som søvn, fôring og stress forskjellige A. mexicanus cavefish i forhold til overflaten fra Art, men de underliggende neuronal determinantene mellom morphs fortsatt uklare. Hele-hjerne kalsium imaging gir en kraftig upartiske tilnærming for å undersøke sammenhenger mellom endret nevrale aktivitet og endret atferd. Vi generert overflate fisk og cavefish med en nær-allestedsnærværende neuronal uttrykk for genetisk kodet kalsium indikatoren, GCaMP6s, bruke reagensene som er mye brukt i sebrafisk forskning. ELAV-lignende Nevron-spesifikke RNA-bindende protein 3 (elavl3) er uttrykt endogenously i nylig differensiert nerveceller i sentralnervesystemet49 og har vært brukt i sebrafisk kjøre uttrykket av proteiner gjennom hele flertallet av nervesystemet50. Vi fikk en Tol2 konstruksjon som inneholder ~2.8 kb sebrafisk elavl3 promoter transkripsjon oppstrøms av indikatoren genetisk kodet kalsium GCaMP6s (en blanding av grønn fluorescerende protein [GFP], calmodulin og M13, et peptid rekkefølge fra myosin lys-kjeden kinase), flankert på 5' og 3 ender med Tol2 nettsteder (Tol2 -elavl3:GCaMP6s-Tol2)51.

A. mexicanus overflate fisk og Molino cavefish var bred, og de resulterende embryoene var coinjected på encellede scenen med 25 ng/μL av Tol2 -elavl3:GCaMP6s-Tol2 konstruksjon og 25 ng/μL Tol2 transposase mRNA (figur 3A). På 24 48 dpf ble Larvene vist for et forbigående neuronal uttrykk for GCaMP6s. De injiserte (F0) embryoene med et uttrykk for GCaMP6s ble reist til voksen og backcrossed med vill-type voksne avledet fra samme slektslinje overflate fisk eller cavefish. De resulterende F1 voksne ble vist for et stabilt uttrykk for GCaMP6s uttrykk, og disse Larvene ble opprettholdt generere stabil linjer (figur 3B,C). Fordi hver F1 voksen med en stabil uttrykk har trolig integrert Tol2 -elavl3: GCaMP6s-Tol2 på ulike genomisk steder, hver F1 angis en annen allelet. Bruker denne tilnærmingen, har vi generert stabile F1s for overflate fisk og Molino cavefish bestander (figur 3B,C), dermed muliggjør live kalsium for å avdekke forskjeller i neuronal aktivitet formidling atferdsendringer i hulen miljø (Figur 3 C,D). Videre, denne legger grunnlaget for uttrykk for mange flere effekter av transgener å karakterisere og manipulere genet funksjonen A. mexicanus.

Figure 1
Figur 1: Morpholino knockdown av Hcrt reduserer aktivitet og øker søvn i cavefish. (A) oversettelse-blokkerende morpholino mål de første 25 bp av Hcrt koding sekvens, inkludert ATG startwebstedet. (B) Hcrt morpholino oligo (MO) og kontroll sekvenser. (C) justering ~ 200 encellede egg på agarose egg former for injeksjon. (D) Microinjection 1,0 nL injeksjon blanding med fenol rød indikator for visualisering. Baren skala = 0,5 mm. (E) Morpholino knockdown av Hcrt reduserer aktiviteten (total distanse) av Pachón cavefish (t = 5.021, df = 88, p < 0,0001) men overflate fisk (t = 1.318, df = 88, p > 0.72). (F) Knockdown øker søvn i Pachón cavefish (t = 2.694, df = 88, p < 0,05) men har ingen effekt på overflate fisk (t = 0,17, df = 88, p > 0,99). Baren skala = 1 mm. Feilfeltene i paneler E og F betegne standardfeilen til gjennomsnittet. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: CRISPR gen-redigering av oca2 introduserer albinisme i overflaten-bolig A. mexicanus. (A) skjematisk av oca2 koding regioner og guide RNA (gRNA) målretting ekson 21 for CRISPR-mediert genet redigering. (B) sekvensering chromatogram av vill-type Oca2 + og (C) mutant Oca2 - alleler. Den røde boksen i B -panelet angir 2 bp sekvensen, som mangler i det muterte Oca2 - allelet avbildet i C-panelet. (D) målrettet CRISPR introduserer en 2 bp sletting, forstyrre Oca2 funksjon. Primere er utformet for genotypic screening av 2 bp sletting i F0 avkom. (E) PCR og gel geleelektroforese av Oca2 i vill-type overflate fisk (bandet størrelse = 134 bp) og F0 CRISPR-injisert avkom (bandet størrelse = 133 bp). Personer homozygous eller heterozygote for vill-type variant av Oca2 (Oca2 +) er pigmentert, mens F0s homozygous for 2 bp sletting (Oca2 -) havn albinisme. (F) hele kroppen bilder av vill-type overflate fisk og (G) overflate fisk med CRISPR-mediert albinisme. Baren skala = 5 mm. (H og jeg) Magnified visning av lederne for enkeltpersoner avbildet i paneler F og G, henholdsvis. Baren skala = 2 mm. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: Tol2 transgenesis av pan-nevrale GCAMP6s gjør live avbilding av hjerneaktiviteten hos A. mexicanus. (A) Tol2-mediert transgenesis i A. mexicanus. Coinjection Tol2 mRNA og Tol2 -elav3l: GCAMP6s-Tol2 plasmider integrerer GCAMP6s transgene i F0 grunnleggerne. Backcrossing til den opprinnelige lager av vill-type fisk gir F1 individer med en stabil pan-nevrale uttrykk for GCAMP6s. (B og C) resulterende avkom er vist for en stabil uttrykk med dissection og AC confocal mikroskopi. Stabil TgAsty(elav3l: GCaMP6s) F1 individer er etablert både overflaten-(avbildet i panelet B) og hule-bolig morphotypes (avbildet i panelet C). Baren skala = 200 μm.  Klikk her for å se en større versjon av dette tallet.

Reagens Volum eller beløp
10,0 μg av PC-zT2TP plasmider DNA X μL
NB CutSmart Buffer 10,0 μl
NotI HF enzym 2.0 μl
Nuclease-gratis H2O X μL
BSA 1.0 μl
Totalt 100 μl

Tabell 1: Begrensningen Sammendrag av Tol2 plasmider.

Reagens Volum eller beløp
1.0 μg av linearized PC-zT2TP plasmider DNA X μL
10 x reaksjon buffer 2.0 μl
2 x NTP/CAP 10,0 μl
SP6 enzym blanding 2.0 μl
RNase-gratis H2O X μL
Totalt ≤20 μl

Tabell 2: In vitro syntese av Tol2 mRNA.

Navnet Innstillingsverdi
Varme 510
Trekk 55
Hastighet 100
Tid 40
Trykk 500
Rampen 534

Tabell 3: Eksempel pipette-rykk protokollen. 

Reagens Volum eller beløp
Morpholino (fryser stock @ 4mM) 1.0 μl
Nuclease-gratis H2O eller Danieaus løsning 17,0 μl
Fenol rød 2.0 μl
Totalt 20 µL

Tabell 4: Morpholino injeksjon blanding.

Reagens Volumet av beløp
gRNA (siste arbeider konsentrasjon @ 100ng/μl) 1 μl
Cas9 mRNA (siste arbeider konsentrasjon @ 1200ng/μl) 1 μl
RNase-gratis H2O 2 μl
Totalt 4 μl

Tabell 5: Eksempel CRISPR/Cas9 injeksjon blanding.

Reagens Volumet av beløp
Tol2 plasmider (siste arbeider konsentrasjon @ 25ng/μl) X μL
Tol2 mRNA (siste arbeider konsentrasjon @ 25ng/μl) X μL
Fenol rød 1.0 μl
RNase-gratis H2O X μL
Totalt 15 μl

Tabell 6: Eksempel Tol2 transgenesis injeksjon blanding

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Her gitt vi en metode for å manipulere gen funksjon morpholinos, CRISPR/Cas9 gene redigering og transgenesis metodikk. Vell av genetisk teknologi og optimalisering av disse systemene i sebrafisk vil trolig tillate overføring av disse verktøyene i A. mexicanus med letthet52. Nyere funn har brukt disse metodene i A. mexicanus, men de forblir underutilized etterforskningen av ulike morfologiske, utviklingsmessige og atferdsmessige egenskaper i dette systemet30,36,42 , 53.

Morpholinos har vært mye brukt i sebrafisk forskning knockdown uttrykket av gener. Tilnærmingen er lettvinte og resulterer i en robust knockdown uttrykk. Men har off-målet effekter vært mye dokumentert22,53; dermed bør dyr der morpholinos er blitt injisert til nøye overvåket for noen uventede fenotyper22,55. Når resultatene fra morpholino knockdown skal valideres ved hjelp av andre metoder, som CRISPR/Cas9-mediert knockout tilnærminger. Morpholinos tillater robust knockdown av genuttrykk, er morpholino-mediert knockdown forbigående. Dermed er analysere voksen fenotyper ikke mulig når du bruker denne metoden.

CRISPR/Cas9-mediert mutagenese tilbyr direkte manipulasjon av bestemte gener. Videre, i motsetning til morpholino-mediert knockdown, CRISPR/Cas9 mutagenese innrømmer for analyse av mutant fenotyper i voksen alder. For å hindre off-målet effekter av CRISPR/Cas9, mutant linjer skal være outcrossed generasjoner, og når flere allelet skal være innhentet og testet. CRISPR/Cas9 systemet også gir utnytte gen-redigering tilnærminger til knock-alleler eller å produsere bestemte genetiske endringer. CRISPR/Cas9 systemet har vært brukt i sebrafisk å produsere presis integrasjoner av eksogene DNA og generere nøyaktige punktet mutasjoner19,20,56,57,58, 59. med sekvensering av cavefish genomet, er det nå mulig å identifisere single nukleotid (SNPer) eller andre subtile genetiske endringer mellom overflate fisk og cavefish bestander33. Anvendelse av CRISPR/Cas9 gene redigering gir deg mulighet å utveksle alleler mellom overflate fisk og cavefish, eller mellom forskjellige populasjoner av cavefish, å undersøke rollen av disse genetiske endringer i ulike utviklingsprosesser.

Transgenesis tilnærminger beskrevet i denne protokollen gir en enkel og kraftig metode for gevinst-av-funksjon studier og genererer verktøy til å endre biologiske prosesser genetisk. Tol2 systemet er mye brukt i sebrafisk forskning, og vi har vist at det er tilsvarende kraftig i A. mexicanus. Videre viste vi en transgene konstruere generert i sebrafisk som bruker en sebrafisk promoter og viser endogene uttrykk i A. mexicanus. Vi har funnet fire andre arrangører isolert fra sebrafisk stasjonen vev-spesifikke uttrykket som forventet i A. mexicanus (data ikke vist). Siden sebrafisk arrangører recapitulate sine bevarte uttrykk mønstre i A. mexicanus, tyder dette på at mange av genetisk verktøyene kan overføres direkte fra sebrafisk til A. mexicanus uten behov for modifisering med A. mexicanus promoterere. Dessuten, med fremskritt i sekvensering teknologi A. mexicanus33, transgene tilnærminger beskrevet her vil tillate en kraftig fremtid for etterforskningen av enhancers og arrangører som kan spille en rolle i variasjon mellom overflaten og hule skjemaer. Til slutt, de kraftige verktøyene for genetisk manipulering av biologiske prosesser som har gjort sebrafisk verdifulle er like viktig i A. mexicanus60,61,62,63. Forskjeller i ulike opptreden personlighetstrekk, slik som sove, fôring, stress, og aggresjon, mellom A. mexicanus overflaten og hulen boligen former er grundig dokumentert12,14,15 ,38,64, men den underliggende neuronal korrelerer ikke er godt forstått. Verktøy som Tg(elavl3:GCaMP6s) vil tillate en Disseksjon av hvordan forskjeller i neuronal aktivitet hjernen hele koordinere med forskjeller i virkemåten og tilbyr et unikt innblikk i hvordan hjernen har endres evolusjonært.

Samlet er A. mexicanus klar til å bli en ledende modell for undersøker utviklingen av en rekke morfologiske og atferdsmessige egenskaper. Variert forskjeller i sammensatte biologiske prosesser i A. mexicanus gir en plattform for å undersøke genetiske mekanismer av egenskap evolusjon. Bruk av verktøy for å manipulere gen funksjon kan bidra til å utvikle denne organismen til en modell som kan brukes for å undersøke biologiske sykdommer relatert til øye degenerasjon, neurodevelopmental unormalt og søvnløshet.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Forfatterne takker Sunishka Thakur for henne hjelp i genotyperingteknologi og tenkelig oca2 mutant fisken avbildet i figur 2. Dette arbeidet ble støttet av National Science Foundation (NSF) prisen 1656574 til A.C.K., NSF award 1754321 JK og A.C.K., og National Institutes of Health (NIH) award R21NS105071 A.C.K. og E.R.D.

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
Manipulering av gen funksjon i meksikansk Cavefish
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter