Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Манипуляции функции гена в мексиканской Cavefish

Published: April 22, 2019 doi: 10.3791/59093

Summary

Мы описываем подходы для манипулирования генов в системе Эволюционная модель Астианакт гракл. Описываются три различных методов: Tol2-опосредованной трансгенез, целенаправленные манипуляции генома используя ТРИФОСФАТЫ/Cas9 и сногсшибательно выражения с использованием морфолиновая. Эти инструменты должны облегчить прямое расследование генов, лежащие в основе различия между формами поверхности и пещера жилище.

Abstract

Пещерных животных обеспечивают убедительные системы для изучения эволюции механизмов и генетических основ лежащих в основе изменений в многочисленных сложных черты, включая глаз дегенерации, альбинизм, потеря сна, hyperphagia и сенсорной обработки. Виды cavefish от всего мира отображения конвергентной эволюции морфологических и поведенческих признаков из-за общих экологических проблем между различными пещерных систем. Были изучены различные пещеры видов в лабораторных условиях. Мексиканский tetra, гракл Астианакт, с нормальным зрением и слепых форм, предоставила уникальные идеи в молекулярных и биологических процессов, лежащих в основе эволюции сложных черты и хорошо готовы как формирующейся модели системы. В то время как в A. гракл был выявлен кандидат генов, регулирующих эволюцию различных биологических процессов, возможность проверки роли для отдельных генов был ограниченным. Приложение трансгенез и Джин редактирования технология имеет потенциал для преодоления этого значительные препятствия и изучить механизмы, лежащие в основе эволюции сложных черты. Здесь мы описываем различные методологии для манипулирования экспрессии генов в A. гракл. Подходы включают использование морфолиновая, Tol2 трансгенез, и Джин редактирования системы, часто используемые в данио рерио и другие рыбы модели, чтобы манипулировать функции гена в A. гракл. Эти протоколы включают подробные описания процедур приурочен разведения, коллекции оплодотворенные яйца, инъекции и отбора генетически модифицированных животных. Для исследования генетических и нейронных механизмов, лежащих в основе эволюции различных признаков в A. граклпозволит эти методологические подходы.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

С тех пор Происхождение видовДарвина1ученые получили глубокое понимание как черты эволюционно формируются в ответ на определенные природоохранные и экологические давление, благодаря пещера организмов2. Мексиканский tetra, A. гракл, состоит из глазами предков «поверхности» популяций, которые населяют рек Мексики и Южной Техас и по крайней мере 29 географически изолированные популяции производных пещера морф, населяющих Abra Сьерра-дель- и другие районы северо-восточной Мексике3. Было выявлено несколько черт, связанных пещера в A. гракл, включая потребление кислорода изменены, депигментация, потерю глаза и изменили кормления и нагула поведение4,5,6, 7,8,9. A. гракл представляет мощную модель для изучения механизмов конвергентной эволюции благодаря четко определенной эволюционной истории, подробная характеристика состояния окружающей среды и присутствие независимо эволюционировали пещера населением в10,11. Многие из пещеры производные признаки, которые присутствуют в cavefish, включая потерю глаз, потеря сна, увеличилось, питание, потеря школьного обучения, снижение агрессии и уменьшить стресс ответы, развивались несколько раз через независимого происхождения, зачастую с использованием различные генетические пути между пещеры8,12,13,14,15. Это повторяется, эволюция является мощным аспектом A. гракл системы и может обеспечить проницательность в более общий вопрос о как генетических систем может возмущенных для создания аналогичных фенотипов.

В то время как в многих видов рыб (в том числе A. гракл) был ограниченным применения генетических технологий механистический расследования функции гена, последние достижения в zebrafish обеспечивают основу для разработки генетических технологий в рыбе 16,17,18,19,20. Многочисленные инструменты широко используются в zebrafish манипулировать экспрессии генов, и осуществление этих процедур давно были стандартизированы. К примеру инъекции oligos Морфолино (MOs) на стадии одноклеточных выборочно блокирует РНК и предотвращает перевод для краткое временного окна во время разработки21,22. Кроме того, ген редактирования подходы, такие, как кластерный регулярно interspaced короткие палиндром повторяется (ТРИФОСФАТЫ) / ТРИФОСФАТЫ, связанные белком 9 (Cas9) и транскрипции активатор как эффекторных нуклеиназы (TALEN), позволяют для генерации определенных исключений или, в некоторых случаях, вставки через рекомбинации в геномах19,,2023,24. Трансгенез используется для манипулирования стабильной ген выражение или функцию определенным образом тип ячейки. Система Tol2 эффективно используется для создания трансгенных животных, coinjecting Транспозаза мРНК с Tol2 плазмида ДНК, содержащие трансген25,26. Система Tol2 использует Tol2 Транспозаза оризии для создания стабильной микрофлорой вставки трансгенных construct17. Создание Tol2 мутация включает в себя coinjecting плазмиды, содержащий трансген, обрамленная Tol2 интеграции сайтов и мРНК Tol2 Транспозаза17. Эта система используется для создания массива трансгенных линий в данио рерио и его использование недавно расширена еще формирующейся модели систем, включая цихлид, Пецилиевые рыбы, колюшка и, более недавно, мексиканской cavefish27, 28,29,30.

В то время как cavefish это увлекательный биологическая система для разъяснения механизмов черта эволюции, его потенциал как Эволюционная модель не были использованы полностью. Это частично объясняется невозможностью манипулировать генетических и сотовой функция непосредственно31. Кандидат генов, регулирование сложных черты были определены с использованием количественных признаков локусов (QTL) исследования, но проверка этих генов кандидат был трудным32,33,34. Недавно переходных нокдаун, используя морфолиновая, Джин, редактирование с помощью систем ТРИФОСФАТЫ и TALEN и использование Tol2-опосредованной трансгенез были использованы для изучения генетической основы, лежащие в основе ряда признаков35,36,37 ,38. Осуществление и стандартизации этих методов позволит для манипуляции, которые допрашивают молекулярных и нейронных основы биологических черт, в том числе манипуляции функции гена, маркировки определенных клеточных популяций, и выражение функциональных репортеров. Успешное осуществление этих генетических инструменты для манипулирования генов или сотовой функция была продемонстрирована в формирующейся модели систем, в то время как в A. граклпо-прежнему отсутствуют подробные протоколы.

A. гракл обеспечивают критический взгляд в механизмы эволюции в ответ на меняющиеся условия и возможность для определения новых генов, регулирующих различные черты. Ряд факторов предполагают, что A. гракл является чрезвычайно шансов справиться с возникающими модель для применения установленных геномной инструментов, имеющихся в настоящее время в установленные генетические моделей, включая возможность легко поддерживать рыбы в лабораториях, большой размер выводка, прозрачности, последовательности генома и определенных поведенческих анализов39. Здесь мы описываем методологии для использования морфолиновая, трансгенез и Джин редактирования в поверхность и пещера популяциях A. гракл. Более широкое применение этих инструментов в A. гракл позволит механистический расследование молекулярных процессов, лежащих в основе эволюции развития, физиологические и поведенческие различия между cavefish и поверхности рыбы.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Морфолино oligo дизайн

Примечание: Последовательности для A. гракл доступны через Национальный центр биотехнологической информации (NCBI) ген и SRA NCBI (https://www.ncbi.nlm.nih.gov), а также из Ensembl генома браузер (https://www.ensembl.org). При проектировании Морфолино для использования в обеих формах поверхности - и местонахождения троглофильных, важно определить любые генетические различия между морф на данном этапе, так как цели для морфолиновая можно избежать этих генетических регионов. Все полиморфные вариацию Морфолино целевого сайта может привести к неэффективной привязки. Дизайн похож на другие системы рыбы, например данио рерио и ранее было показано, чтобы эффективно работать в A. гракл21,36,40.

  1. Дизайн блокирования перевода морфолиновая
    Примечание: Блокирование перевода морфолиновая блокировать перевод путем привязки к эндогенной стартовый сайт и препятствуют трансляционная техника от привязки последовательность мРНК через их пространственной препятствие.
    1. Идентифицировать кодирвоания целевого гена, начиная с начала сайт ATG.
    2. Запишите первые 25 пар оснований последовательности целевых объектов путем копирования и вставки последовательность в текстовый редактор или лаборатории ноутбука.
    3. С помощью онлайн программного обеспечения (например, http://reverse-complement.com) или ручной перевод, генерировать обратный дополнение последовательности целевого объекта. Сохраните полученный обратный дополнением в текстовом редакторе или лаборатории ноутбука.
    4. Заказывайте Морфолино с последовательностью обратный дополнение от компании, которая создает Морфолино олигонуклеотидов. Смотрите Таблицу материалы для компаний.
  2. Дизайн сплайс преграждать морфолиновая
    Примечание: Блокирование Splice морфолиновая блокировать сплайсинга и, таким образом, предотвратить формирования зрелой молекулы мРНК. Это обеспечивает альтернативный метод для нокдаун, когда начала сайты не являются четко определенными, или более оптимальный подход желано проверки нокдаун через полимеразной цепной реакции (ПЦР). Это преимущество сплайс преграждать морфолиновая (над ГПТ преграждать MOs) это что экзона исключение или включение Интрон можно легко оценить с обратной транскриптазы (RT)-PCR и размер различия, визуализируется на геле. RT-PCR и гель электрофореза для определения эффективности Морфолино должно быть сделано с помощью стандартных лабораторных процедур.
    1. Определите последовательность пре мРНК гена целевого объекта. Используйте имеющуюся информацию из генома A. гракл через NCBI или Ensembl для определения границ Интрон экзона33.
    2. Целевые Экзон Интрон (соединитель доноров) или Интрон экзона границы (соединитель акцептор) сайты для Интрон включение или экзона исключения.
      Примечание: Сплайсосома обычно цели последовательности «ГУ» (U1 цель) в Интрон на месте сращивания 5' и последовательности AG» »на сайте intronic соединитель (U2 целевой) 3'. При нормальных условиях Сплайсосома U1 и U2 субблоков привязать эти целевые сайты на пре мРНК последовательности для надлежащего сплайсинга происходят. Однако если любой из этих последовательностей целевой блокируется Морфолино, Сплайсосома будет двигаться следующий доступный узел в области U1 и U2, вызывая Интрон исключение или экзона в последовательность мРНК. Это будет включать планирование/оптимизации, в зависимости от целевого гена21. Как правило блокирование внутренний сайт U1 перенаправляет соединитель следующий доступный узел U1, вызывая экзона эксцизии. Кроме того блокировка перекрестка первой или последней сращивания вызывает включение Интрон потому что нет никакой другой сайт, чтобы перенаправить соединитель для. Используйте программное обеспечение последовательности для прогнозирования эффекта различных исключений против включений. Прогнозы можно указать потенциальных frameshifts или преждевременной остановки кодонов, указав более эффективной целевой сайт для срыва мРНК.
    3. После определения целевого сайта, записи его последовательности в текстовый редактор или лаборатории книги. Убедитесь, что целевой сайт 25 пар оснований (ВР) длиной.
    4. С помощью онлайн программного обеспечения (например, http://reverse-complement.com) или ручной перевод, генерировать обратный дополнение последовательности целевого объекта. Запись последовательности в текстовый редактор или лаборатории книги.
    5. Заказывайте Морфолино с последовательностью обратный дополнение от компании, которая создает Морфолино олигонуклеотидов. Смотрите Таблицу материалы для образца компаний.

2. морфолиновая для инъекций

Примечание: Несколько концентрации или томов MO инъекции нужно будет выполняться для установления оптимальной концентрации для вставки. Типичный инъекции количества являются 400 – 800 pg MO. Эффект Морфолино нокдаун может сохраняться до 6 дней postinjection.

  1. Получение акций Морфолино. Складе Морфолино прибывает лиофилизированные. Гидрат с стерильных H2O до использования в нужной концентрации запасов (например, 4 мм). Хранить при-20 °C до использования.

3. ТРИФОСФАТЫ gRNA дизайн, в vitro транскрипция и подготовка

  1. ТРИФОСФАТЫ gRNA дизайн
    Примечание: оформления созданные с использованием ранее опубликованных исследований Varshney et al.40 и41Wierson и др.
    1. С помощью браузера генома, определите кодирвоания гена интереса. С использованием геномной последовательности, определить последовательности целевых объектов в пределах экзона gRNA путем поиска для 20 bp нуклеотидов целевой последовательности, начиная с GG и Пэм последовательность (НЭС). Регионе гена после того, как будут направлены на запуск (ГПТ).
      Примечание: Если в желаемого экзона гена, один или оба из G'не удалось найти целевой последовательности с GG в конце 5' s можно заменить для первой и второй нуклеотидов в 5' конце последовательности. Однако два G's должны быть включены в oligo, поскольку они необходимы для транскрипции T7.
    2. Дизайн и заказать ген специфического олигонуклеотида (oligo A: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). Добавьте ген специфического 20 bp gRNA последовательности целевых объектов (жирным шрифтом) без PAM последовательности между T7 промоутер последовательности (красный) и дублирования последовательность, используемая для отжига для второй олигонуклеотида (синий). Отжиг и усилить (см. шаг 3.2.1) этот oligo A и второй oligo (oligo B: 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') для создания gRNA шаблон, используемый для транскрипции.
      Примечание: Oligo B является одинаковым для каждой реакции и нужно только заказать 1 x.
  2. подготовка gRNA и транскрипции
    1. Отжиг и усилить oligos. Включить следующие Праймеры для того чтобы усилить gRNA для того чтобы увеличить урожайность: 5'-TAATACGACTCACTATA-3' (T7 грунт) и 5'-GATCCGCACCGACTCGGTG-3' (3' gRNA грунтовка). Выполните с помощью Thermococcus kodakaraensis (код) полимеразы PCR.
      Примечание: Для обоих грунтовки в oligo A и oligo Б, 10 циклов рекомендуется для хорошего урожая. Подробный протокол можно найти в Wierson et al.41.
    2. Транскрибируйте gRNA использование коммерчески доступных в vitro транскрипция наборы (см. Таблицу материалы). Это делается путем изменения производителя'протокол s Опубликовано Klaassen et al.42.
    3. Осадок, вымыть и Ресуспензируйте gRNA, как описано в Klaassen et al.42.
      Примечание: GRNA должен быть высокомобильна в РНКазы свободной воды для предотвращения деградации.
    4. Запись концентрация gRNA, который может быть определен с помощью спектрофотометра. Оценить качество РНК, запустив 2 мкл на геле агарозы. Аликвота РНК избежать замораживания/оттаивания и хранить его на-80 °C до непосредственно перед инъекции.
  3. Cas9 подготовка и транскрипции
    1. Cas9 мРНК могут быть транскрибированы использование коммерчески доступных в vitro транскрипция наборы (см. Таблицу материалы) как описано ранее43. Используйте версию nls-Cas9-nls43.
    2. Регистрировать концентрацию gRNA и оценить его качества, запустив 2 мкл на геле агарозы. Аликвота РНК во избежание разложения, который возникает через несколько циклов замораживания оттаивания и хранить аликвоты-80 °C.

4. Подготовка Tol2 конструкций, Tol2 Транспозаза и трансгенез

  1. Подготовка Tol2 трансген конструкции для инъекций.
    Примечание: Мы успешно использовали публикации доступны данио рерио и оризии конструкций в A. гракл. Эти конструкции являются полностью функциональными в A. гракл, вероятно из-за высокого уровня последовательности гомологии (обратитесь к AddGene репозиторий и данио рерио информационной сети [ZFIN] базы данных для имеющихся конструкций). Данио рерио промоутер фрагменты выразили трансгенов в ожидаемых тканях при использовании в A. гракл.
    1. Приобрести Tol2 конструкции или генерировать плазмида с ткани конкретной промоутера, желаемого трансген и Tol2 оружия (см. Кван et al.44). По получении последовательность конструкции для проверки плазмиды.
    2. Выполнить midiprep для конструкции в зависимости от производителя's руководящие принципы. Элюировать окончательный плазмида в свободный РНКазы H2O, определить концентрацию с спектрофотометр, ослабить концентрацию до 100300 нг / Л,μи Алиготе и магазин конструкции при-20 °C.
  2. Дайджест Tol2 Транспозаза плазмиды и синтез мРНК.
    1. Получите копию плазмида Транспозаза Tol2 (ПК zT2TP) как шаблон для генерации мРНК Tol245.
    2. Согласно данным производителя'Midiprep ПК zT2TP построить s руководящие принципы. Элюировать в низкий объем РНКазы свободной воды или буфера (~ 50 мкл). Хранить аликвоты при-20 °C.
    3. Дайджест Tol2 плазмиду с помощью энзима ограничения.
      1. Выполните дайджест ограничение на 10 мкг круговой ПК zT2TP плазмиду с помощью таблицы 1.
      2. Разделение реакции в 250 мкл реакции и инкубировать и реакции на ночь в 37 °C в тепловая велосипедист.
      3. На следующий день инактивирует фермент путем нагревать его к 65 °C в течение 20 мин.
      4. Очищайте линеаризованного плазмида сразу же после дайджест, используя коммерчески доступные наборы очищения ПЦР (см. Таблицу материалы) с требованиями производителей' . Элюировать плазмида в 15 мкл РНКазы свободный H2O и определить концентрацию продукта с помощью спектрофотометра.
      5. Запуск 1 мкл переваривается плазмиды и 1 мкл режиссерский плазмида на 1,5% агарозном гель для подтверждения линеаризованного плазмиды.
    4. Выполните в vitro транскрипция Tol2 мРНК.
      1. Используйте как шаблон для транскрипции 1 мкг линеаризованного ПК zT2TP плазмиды. Следуйте производитель's руководящие принципы в vitro транскрипция (см. Таблицу материалы), как описано в таблице 2.
      2. Инкубируйте при 37 °C в тепловой циклователь на производителя's руководящих принципов.
      3. 1 мкл DNase, инкубации при 37 °C в тепловой циклователь на производителя's руководящие принципы.
      4. Выполняйте Лития хлорид осадков в транскрипции Кит протокол. Ресуспензируйте Пелле РНК в ~ 2030 мкл РНКазы свободный H2O.
      5. Определение концентрации продукта, используя спектрофотометр и записывать качество РНК.
      6. Разбавить продукт300 нг/мкл и Алиготе ~ 100 в 5 образцов 10 мкл, чтобы избежать повторного замораживания оттаивания. Храните их в-80 °C до использования.
        Примечание: Это можно проверить 12 мкл очищенный Tol2 мРНК для мазка и полосами с электрофорезом геля.

5. микроинъекций

  1. Подготовка общих инструментов для инъекций
    Примечание: Процедуры, описанные в этом разделе были описаны подробно Kowalko et al.46, и здесь представлен обзор с незначительными изменениями.
    1. Сгенерировать инъекции пластины, поливая теплой 3% агарозы, растворенных в воде системы рыбы в 100 мл Петри. Осторожно поместите яйцо инъекции плесень в свеже налил агарозы для скважин на икру. Место на стороне плесень в агар под углом 45° и, затем, медленно опустите его в агарозном; медленно снижение плесень под углом избегает воздуха, получить в ловушке под плесень. Осторожно удалите плесень, после затвердевшим агарозы. Пластины могут быть сохранены, герметичный, 4 °C на срок до 1 недели.
    2. Вытащить из боросиликатного стекла капилляров для инъекций в электрод/иглы съемник согласно данным производителя'иглы s руководящих принципов. Этот протокол будет варьироваться в пипетку съемник; Однако образец потянув иглу программы можно найти в таблице 3.
      Примечание: Оптимизация игла имеет важное значение для инъекции, как иглы, которые слишком долго будет согнуть, а не чисто проникают яйцо.
    3. Сделайте большой диаметр стеклянной пипетки для передачи яйцо, разбив стандартные стеклянные пипетки, так что открытие является достаточно большой для яиц. С помощью горелки Бунзена, польский сломанной конца стекла, подвергая конце сломанной пипетки пламени до тех пор, пока оно не станет гладким.
  2. Установки размножения
    Примечание: Существует множество различных протоколов, используемых для разведения A. гракл. Подробный протокол Borowsky39см. Запустите программу установки разводить 1 неделю до инъекции.
    1. На 1 день место два-три женщины мужчины и три-четыре в одном 10 галлон танк, на уровне 24 ± 1 °C.
    2. В дни 17, увеличьте, питание ~ 3 раза в день. Убедитесь, что диета включает в себя живую пищу, такие как черный червей и артемии.
    3. На 6 день добавьте один резервуар подогреватель, равным 27 °C. Lab танк температура может варьироваться; Таким образом это будет увеличение 2нормальный танк температура 3 °C относительно.
    4. Вечером 7, день, который вечером (zeitgeber [ZT] 911) инъекций ночью, тщательно очистите танки с губкой, смоченной водой и удалить любой избыток пищи или мусора, с помощью чистой тонкой сеткой или сифон.
    5. В ночь на 7 день начало проверку поверхности икры на ZT15 и продолжайте проверять каждые 1530 мин до ZT18. Для cavefish начать проверку для яиц в ZT17 и продолжайте проверять каждые 1530 мин до ZT20.
      Примечание: Время основаны на 14:10 h свет: темные цикла с использованием zeitgeber время. Разведение раз являются оценочными и отдельных лабораториях необходимо определить точное время. Важно, чтобы собирать яйца, вскоре после того, как они выпустили/оплодотворенной чтобы привнести их в стадии одноклеточных.
  3. Сбор яиц стадии одноклеточных
    1. Ночью, в котором ожидается разведения, изучите танки каждые 15монитор для яиц в нижней части бака и 30 мин. Яйца появляются полупрозрачные, измерения около 1 мм в диаметре.
    2. Использование чистой тонкой сетки рыбу собирать яйца и передавать их в кастрюлю с водой системы свежей рыбы. Изучите яйца под микроскопом, чтобы подтвердить, что яйца находятся в стадии одной ячейки.
    3. С помощью пипетки стеклянные, передачи одноклеточных яйца для инъекций пластины. Пипетки стеклянные необходимы на данном этапе, как яйца будут придерживаться пластика.
    4. С помощью пипетки, тщательно выпуск яйца в скважины агарозы инъекции пластины из раздела 5.1. Заполните строки подогретую (при комнатной температуре) инъекций пластины с максимальное количество яиц (3040 в строке и до пяти строк). Полные строки помогают держать яйца от перемещения во время инъекции. Храните яйца гидратированных на пластину инъекции с небольшим количеством воды системы рыбы до выполнения инъекции.
  4. Пико инъекции установки и руководящие принципы оптимизации общего инъекций
    1. Засыпки инъекционным иглам, используя либо гель загрузки дозаторов советы, которые вписываются внутрь капиллярной или с помощью стандартных микропипеткой советы и добавить 24 мкл болюс в конце. После того, как заполнены иглы, используйте щипцы обрезать излишки длиной от инъекционной иглы.
    2. Выполните с помощью иглы, смонтированные в микроманипулятор, подключенных к microinjector пиколитр микроинъекций.
    3. Установить время инъекций 0,03 s и давления из на ~0.0 psi. Давление впрыска будет изменяться соответственно с незначительными различиями между иглами, так оптимизировать для достижения ~1.0 nL введения болюса.
      Примечание: Давление впрыска часто находится в диапазоне от ~ 1030 psi.
    4. Стандартизировать болюсного введения путем впрыскивать в минеральное масло и измерения болюс размер микрометром слайд для достижения 1 ~1.5 объем впрыска nL. Отрегулируйте давление впрыска (psi) для увеличения или уменьшения громкости болюса.
    5. Черпать воду от самой верхней части яйца с помощью лаборатории тканей.
      Примечание: Яйцо Хорион Астианакт немного сложнее для проникновения чем данио рерио яйца. Мы находим, что черпания воды из верхней части яйца помогает облегчить проникновение иглы в яйцо. Пластина оптимизации может позволить для ~ 200 яиц на одной пластине.
    6. Используйте микроманипулятор проникнуть каждое яйцо с иглой, и внедрить непосредственно в желтке. После того, как расположены в желтке, придать яйцо, нажав педаль вставки кнопка или инъекции.
      Примечание: Полное пластина может быть введен в течение ~ 15 мин. Стадии одноклеточных длится ~ 40 мин.
  5. Инъекции морфолиновая
    Примечание: Количество необходимых для сногсшибательно не вызывая токсичности Морфолино будет необходимо оптимизировать каждого гена целевого объекта; Однако концентрация 400 ПГ является хорошим местом для начала.
    1. Подготовьте Морфолино, так что 400 pg Морфолино будут вводиться на яйцо. Морфолино оттепели на льду. Инъекционного раствора состоит из Морфолино (на желаемой концентрации), RNase свободный H2O или Danieau's решение и фенола красного (10% от конечного объема). В качестве примера см. таблицу 4.
    2. Придать 1 nL за эмбриона.
  6. ТРИФОСФАТЫ инъекции
    1. Подготовьте РНК, так что 25 pg gRNA и 300 pg Cas9 мРНК всего будет выведена за эмбриона. Для образца ТРИФОСФАТЫ/Cas9 инъекции смеси см. таблицу 5.
    2. Придать 2 nL gRNA/Cas9 мРНК за эмбриона непосредственно в эмбрион.
  7. Инъекции Tol2 Транспозаза и Tol2-бокам плазмиду для трансгенез
    1. Размораживание Транспозаза мРНК и Tol2 плазмиды на льду. Комбайн Cas9 мРНК (на 25 нг/мкл), желаемый Tol2 конструкцию (25 нг /μЛ) и красный (10% от конечного объема) фенола в воде, RNase бесплатно. Для образца Tol2 трансгенез инъекции смеси см. таблицу 6.
    2. Держите инъекционного раствора и иглы на льду, чтобы избежать деградации мРНК. Залить на 1 nL в томе за эмбриона.

6. воспитание и скрининг вводят рыбы

  1. Вводят рыбы животноводства
    1. После того, как яйца вводят, немедленно перевести их в стеклянной чаши (10 x 5 см) заполнены с ~ 200 мл воды системы рыбы. Яйца легко промыть путем погружения плиты инъекций в чаш, наполненных рыбы воды и полоскать яйца с пипеткой.
    2. Место ~ 5080 эмбрионы вводят в миску и сзади них 2224 °C.
    3. Чистить чаши с рыбой вводят 2 раза в день для удаления мертвых зародышей и изменить ~ 20% воды на ежедневной основе.
    4. Дополнительные воспитания осуществляется в соответствии с ранее опубликованные протоколы39.
  2. Скрининг лиц, вводят Морфолино
    1. Визуализируйте животных под стереомикроскопом экран для фенотипов. Морфолиновая эффект может сохраняться до ~ 5 дней постинъекционные21.
    2. Мера поведенческих фенотипов на 4 дня postinjection.
  3. Скрининг для ТРИФОСФАТЫ indels
    1. Дизайн праймеров для того чтобы усилить дна genomic вокруг целевого сайта. Дизайн праймеров, таким образом, чтобы целевой продукт PCR приблизительно 100125 bp.
      Примечание: например, для oca2 локус, регион вокруг gRNA целевой сайт был усиленный с помощью вперед грунтовка 5'-CTCCTCTGTCAGGCTGTGC-3' и обратный грунтовка 5'-GAAGGGGATGTTGTCTATGAGC-3' для ПЦР продукта длиной 105 bp.
    2. Жертву эмбрионов или плавник клип взрослых рыб согласно институциональных животных протокол.
    3. Собирать эмбрионов или расчлененных плавники в ПЦР-пробирки и извлечь ДНК и выполняют протоколы PCR ГКДЗ. пример для гена специфические праймеры можно найти в35мА и др.
    4. Чтобы оценить для мутагенеза, запуск 5 мкл ПЦР продукта на 3% агарозном геле на 70 V для 3 h. одичал тип (nonmutagenized) ДНК приведет к продукт PCR как собственный группа. Мутант ДНК приведет в замазанных текстов группы на геле.
    5. Чтобы определить последовательность мутантные аллели, TA клонировать продукт PCR, по словам производителя's инструкции, выбрать колоний и алкалический культур. Отправьте полученный ДНК для виртуализации.
    6. Устанавливать и поддерживать линии рыб, препровождающее мутантные аллели, крест взрослых рыб вводят одичал типа рыб, и экран 510 эмбрионов, чтобы определить, если любой из потомства нести Мутантный аллель гена, следующие шаги 6.3.1-6.3.6.
      Примечание: Различные F1 человек из же F0 основатель рыбы может нести различные мутации. Убедитесь, что получить мутации, предсказал производить аллелей, которые выходят за рамки виртуализируются мутантных линий.
    7. Идентификации рыб, перевозящих Мутантный аллель методом ПЦР, используя assay замазанных текстов группы (шаги 6.3.1-6.3.6) или путем разработки Аллел Специфически PCR праймеры, которые будут усиливать мутант и одичал тип полос (рис. 2 c).
    8. После создания линии рыб, homozygose мутантных аллелей для проверки рецессивных фенотипов.
  4. Скрининг для трансгенных позитивных людей
    Примечание: С помощью конструкций, содержащих флуоресцентные чайник рекомендуется упорядочить скрининга для трансгенных положительных людей. Однако, Стандартное PCR скрининг методы могут использоваться для экран для передачи.
    1. Визуализируйте флуоресцентные ткани специфических белков в F0 рыба postinjection 2 дня, в кратчайшие сроки с эпифлуоресцентного, пройдя через область.
      Примечание: Выражение в F0 личинки мозаики, и позитивные люди могут иметь широкий спектр выражение фенотипов.
    2. Сохранить позитивные лица как F0 основатель рыбы.
    3. Когда ф0достигают зрелости, backcross основателей рыбы nontransgenic лицам, производный от тот же запас населения/лаборатории. Экран F1 потомство, используя тот же протокол, как описано в пункте 6.2.
      Примечание: Выражение в личинок1 F единообразные и обеспечивает согласованность между F1 братьев и сестер.
    4. Поскольку интеграция Tol2-это не сайт опосредованной и интеграция могут варьироваться среди учредителей, выберите F1 братьев и сестер производный один основатель0 F и скрещиванию положительный выражая F1 братьев и сестер для создания2ф. Это потомство будет основой для стабильного линии.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Несколько популяций местонахождения троглофильных A. гракл показывают сокращение сна и повышенная бодрствования/активность по отношению к их поверхности жилище сородичами14. Hypocretin/orexin (HCRT) является весьма сохранены нейропептида, который действует для увеличения бодрствования, и аберраций в пути HCRT причиной нарколепсии в организме человека и других млекопитающих47,48. Ранее мы показали, что пещера A. гракл увеличились выражение HCRT пептид, предполагая, что увеличение выражение этот пептид могут лежать в основе потеря сна в cavefish38. Нокдаун MO hcrt выражение обеспечивает мощный подход непосредственно изучения эффект увеличения hcrt выражение посреднической потеря сна в cavefish.

Для изучения взаимосвязи между hcrt выражения и сна, мы разработали Морфолино блокирования перевода. Bp цели первые 25 MO экзона, включая ГПТ запустите узел (рис. 1A,B). Как элемент управления мы использовали коммерчески доступных кинулись MO управления (рис. 1B). С использованием алгоритма взрыва на NCBI, мы подтвердили, что существует не пробить эффектов для либо MO на протяжении всего генома (данные не показаны). A. гракл поверхности рыбы и Pachón cavefish были разведены и их яйца были собраны и затем вводится с 400 ГУ МО в 1 nL объем на один клеточной стадии (рис. 1 c,D). Рыбы были подняты до 4 dpf и затем измеряется для деятельности и поведения сна.

Пещера A. гракл вводят с элементом управления МО выставлены значительно более двигательной активности и сокращение сна в течение 24 ч. по сравнению с поверхности рыбы, также вводится с кинулись MO (Рисунок 1E,F), предложив никакого эффекта контроль Морфолино инъекции, как результаты согласуются с ранее опубликованных моделей активности и сна в каждом морфотипа (t = 5.021, df = 88, p < 0.0001). Инъекции HCRT-MO имел небольшое влияние на сон в поверхности рыбы по сравнению с управления впрыском рыбы (t = 0,17, df = 88, p > 0,99). В отличие от hcrt нокдаун через инъекции MO имел значительное влияние на сон в пещере жилище рыбы. Личинки cavefish Pachón показали меньше четырехкратного сокращения в двигательной активности и спать почти в два раза больше, чем контролировать Pachón личинок (Рисунок 1E,F; t = 2.694, df = 88, p < 0,05). Сравнение двигательной активности и сна в MO-нокдаун поверхности - и местонахождения троглофильных рыбы выявлены сопоставимые суммы локомоции и сна (рисунок 1E, F). Эти данные обеспечивают прямую связь между hcrt выражения и потеря сна и предоставляют метод допросить биологических механизмов для потери сна в эволюционно производных местонахождения троглофильных морф.

Потеря пигментации является отличительной чертой пещера организмов, и несколько местонахождения троглофильных Астианакт населения продемонстрировать Потеря пигментации. Альбинизм в Molino и Pachón cavefish был сопоставлен с помощью сопоставления QTL геномной регион, содержащие ген, глазной альбинизм 2 (oca2), предполагая, что мутации в oca2 лежат в основе Альбинизм в cavefish6.

Чтобы проверить oca2 как причинный Локус для Альбинизм в Pachón пещеру морф, мы использовали ТРИФОСФАТЫ/Cas9 гена редактирования мутировать этого региона в поверхности рыбных популяций. Поскольку в Molino рыба6удаляется экзона 21, мы разработали gRNA целевой этот регион гена (рис. 2A). Геномные последовательности, включая gRNA последовательности целевых объектов и Пэм (жирным шрифтом), является 5'-GGTCATGTGGGTCTCAGCTTTGG-3». Это последовательности целевых объектов (без последовательности PAM) был использован для создания gRNA для целевых мутагенеза. Поверхности заводчики были сделаны для спаривания, и результате эмбрионы были собраны на одной клеточной стадии. Один клеточной стадии эмбрионы были введены с Cas9 мРНК и ориентации gRNA oca2, и вводили животных были подняты до совершеннолетия43. Вводят взрослым были сделаны к спариванию одичал тип поверхности рыбы, и эмбрионы от эти кресты были генотипируемого, чтобы определить зародышевой линии передачи, используя праймеры от шага 6.3.1. Мы последовательно аллеля мутанта oca2 и определили зародыш линии передано 2 bp удаления в oca2 (Рисунок 2Б,C). Для удобства генотипирования мы разработали аллель специфические праймеры для идентификации одичал тип и мутантные аллели (Рисунок 2D) и генотипируемого рыбы, используя PCR, следуют гель-электрофорез (Рисунок 2E). Мы incrossed поверхности рыбы гетерозиготных для этого oca2 Мутантный аллель. Результате потомства были пигментированные или Альбино (Рисунок 2F-я). Пигментированный лица были одичал тип или гетерозиготных в локусе oca2, в то время как альбинос лица были гомозиготных мутант (Рисунок 2E). Эти данные обеспечивают прямую связь между oca2 Локус гена и Альбинизм в A. гракл cavefish.

Мириады поведения, таких как сна, питания и стресса отличаются A. гракл cavefish по отношению к поверхности сородичами, но основополагающие детерминанты нейронов между морфов остаются неясными. Целом мозг кальция изображений обеспечивает мощный непредвзятый подход для изучения корреляции между измененным нейронной активности и изменение поведения. Мы созданы поверхности рыбы и cavefish с выражением вблизи вездесущие нейрональных генетически закодированный кальция индикатора, GCaMP6s, с использованием реагентов, широко используется в zebrafish исследований. ELAV-как нейрон специфических RNA-связывая протеин 3 (elavl3) выражается эндогенно в недавно дифференцированной нейронов всей центральной нервной системы49 и был использован в zebrafish водить экспрессию белков на протяжении большинства нервной системы50. Мы получили Tol2 конструкции, содержащие ~2.8 КБ данио рерио elavl3 промоутер транскрипции вверх по течению генетически закодированный кальция индикатора GCaMP6s (фьюжн Зеленый флуоресцирующий белок [GFP], Кальмодулин и M13, пептид последовательность из миозин свет цепь киназы), окруженный на 5' и 3' концах с сайтов Tol2 (Tol2 -elavl3:GCaMP6s-Tol2)51.

A. гракл поверхности рыбы и Molino cavefish были разведены, и были coinjected результате эмбрионы на стадии одноклеточных с 25 нг/мкл Tol2 -elavl3:GCaMP6s-Tol2 конструкцию и 25 нг/мкл Tol2 Транспозаза мРНК (рис. 3A). В 24-48 dpf личинки были экранированы для переходных нейрональных выражение GCaMP6s. Эмбрионы вводят (F0) с выражением GCaMP6s были подняты до совершеннолетия и backcrossed с взрослыми одичал тип, производный от той же линии поверхности рыбы или cavefish. Результате F1 взрослых были экранированы для стабильной выражения экспрессии GCaMP6s, и эти личинки были сохранены для создания стабильной линии (рисунок 3B,C). Потому что каждый взрослый F1 с выражением стабильной вероятно интегрированы Tol2 -elavl3: GCaMP6s-Tol2 на различных участках генома, каждый F1 назначается различных аллелей. Используя этот подход, мы породили стабильной F1s поверхности рыбы и Molino cavefish населения (рис. 3B,C), таким образом благоприятные живой кальция, изображений для выявления различий в нейронной активности, посредничество поведенческие изменения в пещере окружающей среды (рис. 3 C,D). Кроме того такой подход закладывает основу для выражения многих дополнительных трансгенов характеризуют и манипулировать функции гена в A. гракл.

Figure 1
Рисунок 1: Морфолино нокдаун Hcrt снижает активность и повышает сна в cavefish. (A) перевод преграждать Морфолино цели первые 25 bp по Hcrt кодирования последовательности, включая начало сайт ATG. (B) Hcrt Морфолино oligo (MO) и управляющие последовательности. (C) выравнивание ~ 200 одноклеточных яйца на агарозы яйцо формы для инъекций. (D) микроинъекции 1.0 nL смесь инъекций с фенола красного индикатора для визуализации. Линейки шкалы = 0.5 мм. (E) Морфолино нокдаун Hcrt снижает активность (общее расстояние) Pachón cavefish (t = 5.021, df = 88, p < 0,0001), но не поверхности рыбы (t = 1,318, df = 88, p > 0,72). (F) нокдаун увеличивает сна в Pachón cavefish (t = 2.694, df = 88, p < 0,05), но не влияет на поверхности рыбы (t = 0,17, df = 88, p > 0,99). В баре шкалы = 1 мм. Планки погрешностей в панели E и F обозначают Среднеквадратичная ошибка среднего значения. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: ТРИФОСФАТЫ ген редактирование oca2 вводит Альбинизм в поверхность жилище A. гракл. (A) схема oca2 кодирования регионов и руководство РНК (gRNA) ориентации экзона 21 для редактирования ТРИФОСФАТЫ опосредованной ген. (B) последовательности Хроматограмма одичал тип Oca2 + и (C) мутант Oca2 - аллелей. Красный прямоугольник панели B означает 2 bp последовательность, которая отсутствует в мутанта Oca2 - аллель изображен в группе C. (D) целевых ТРИФОСФАТЫ вводит 2 удаления bp, нарушая Oca2 функции. Грунты, предназначенные для генотипической скрининг 2 удаления bp в F0 потомства. (E) ПЦР и гель электрофорез Oca2 одичал тип поверхности рыбы (группы размер = 134 bp) и вводят F0 ТРИФОСФАТЫ потомство (группы размер = 133 bp). Лица гомозиготных или гетерозиготных одичал тип варианта Oca2 (Oca2 +) пигментированы, а F0s гомозиготных для удаления 2 bp (Oca2 -) гавань альбинизм. (F) всего тела изображения одичал типа поверхности рыбы и (G) поверхности рыбы с ТРИФОСФАТЫ опосредованной альбинизм. В баре шкалы =. 5 мм (H и I) Magnified мнение руководителей лиц, изображенные в F и G, соответственно. Линейки шкалы = 2 mm. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: Tol2 трансгенез Пан нейронов GCAMP6s позволяет жить визуализации активности мозга в A. гракл. (A) Tol2-опосредованной трансгенез в A. гракл. Coinjection Tol2 мРНК и Tol2 -elav3l: GCAMP6s-Tol2 плазмиды интегрирует трансген GCAMP6s в F0 учредителей. Беккросс исходный запас одичал тип рыбы дает F1 лиц с выражением стабильной Пан нейронов GCAMP6s. (B и C) результате потомство проверяются для стабильной выражения с помощью конфокальной микроскопии и dissection. Стабильная TgAsty(elav3l: GCaMP6s) для поверхности-(изображены в группы B) и местонахождения троглофильных Морфотипы (изображены в группе C) были созданы лица F1. В баре шкалы = 200 мкм.  Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Реагент Объем или количество
10.0 мкг ПК zT2TP плазмидной ДНК X μl
НЭБ CutSmart буфера 10,0 мкл
Фермент персо HF 2,0 мкл
Нуклеаза свободный H2O X μl
BSA 1.0 мкл
Итого 100 мкл

Таблица 1: Ограничение дайджест Tol2 плазмиды.

Реагент Объем или количество
1,0 мкг линеаризованных ПК zT2TP плазмидной ДНК X μl
10 x буфер реакции 2,0 мкл
2 x NTP/CAP 10,0 мкл
SP6 фермента микс 2,0 мкл
РНКазы свободный H2O X μl
Итого ≤20 мкл

Таблица 2: В пробирке синтез мРНК Tol2.

Имя параметра Значение параметра
Жара 510
Тяга 55
Скорость 100
Время 40
Давление 500
Пандус 534

Таблица 3: Образец пипетки потянув протокол. 

Реагент Объем или количество
Морфолино (морозильник сток @ 4 мм) 1.0 мкл
Свободной от нуклеиназы H2O или Danieau в раствор 17.0 мкл
Фенол красный 2,0 мкл
Итого 20 мкл

Таблица 4: Морфолино инъекции смесь.

Реагент Суммы
gRNA (окончательные рабочие концентрации @ 100ng/мкл) 1 мкл
Cas9 мРНК (окончательные рабочие концентрации @ 1200ng/мкл) 1 мкл
РНКазы свободный H2O 2 мкл
Итого 4 мкл

Таблица 5: Пример ТРИФОСФАТЫ/Cas9 инъекции смесь.

Реагент Суммы
Tol2 плазмиды (окончательные рабочие концентрации @ 25ng/мкл) X μl
Tol2 мРНК (окончательные рабочие концентрации @ 25ng/мкл) X μl
Фенол красный 1.0 мкл
РНКазы свободный H2O X μl
Итого 15 мкл

Таблица 6: Пример Tol2 трансгенез инъекций смесь

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Здесь мы предоставили методологию для манипулирования функции гена, используя морфолиновая, ТРИФОСФАТЫ/Cas9 гена редактирования и трансгенез методологии. Богатство генетических технологий и оптимизации этих систем в данио рерио, скорее всего, позволит для передачи этих средств в A. гракл с легкостью52. Последние выводы использовали эти подходы в A. гракл, но они по-прежнему недостаточно в расследовании различных морфологических, развития и поведенческие черты в этой системы по30,,3642 , 53.

Морфолиновая широко использовались в zebrafish исследований в нокдаун экспрессии генов. Этот подход снисходительный и приводит к надежной нокдаун выражения. Однако пробить эффекты были широко документированных22,53; Таким образом животных, в которых морфолиновая были введены для должны тщательно контролироваться для любых неожиданных фенотипов22,55. Когда это возможно, полученные от Морфолино нокдаун результаты должны проверяться с помощью других методов, например ТРИФОСФАТЫ/Cas9-опосредованной нокаут подходы. В то время как морфолиновая позволяют надежные нокдаун экспрессии генов, Морфолино опосредованной нокдаун является несохраняемым. Таким образом анализируя взрослых фенотипов невозможна при использовании этого метода.

ТРИФОСФАТЫ/Cas9-опосредованной мутагенеза предлагает прямой манипуляции специфических генов. Кроме того в отличие от Морфолино опосредованной нокдаун, ТРИФОСФАТЫ/Cas9 мутагенез позволяет для анализа мутант фенотипы в зрелом возрасте. Для предотвращения воздействия пробить ТРИФОСФАТЫ/Cas9, мутантные линии должны outcrossed несколько поколений, и когда это возможно, более чем один аллель должны получить и испытаны. ТРИФОСФАТЫ/Cas9 система также обеспечивает потенциал для использования ген редактирования подходы к детонации-аллелей или производить конкретных генетических изменений. ТРИФОСФАТЫ/Cas9 система использовалась в zebrafish производить точные интеграций экзогенной ДНК и сформировать точные точечные мутации19,20,56,,5758, 59. с секвенирования генома cavefish, это теперь возможно для определения единичных нуклеотидных полиморфизмов (ОНП) или другие тонкие генетические изменения между поверхности рыбы и cavefish населения33. Приложение ТРИФОСФАТЫ/Cas9 гена редактирования предоставляет возможность обменяться аллели между поверхности рыбы и cavefish, или различных популяций cavefish, для изучения роли этих генетических изменений в различных процессов развития.

Трансгенез подходов, описанных в настоящем Протоколе обеспечивают простой и мощный метод для усиления функции исследования и инструменты для изменения биологических процессов генетически. Tol2 система широко используется в zebrafish исследованиях, и мы показали, что это также мощный в A. гракл. Кроме того мы продемонстрировали конструкцию трансгенных сгенерирована данио рерио, который использует zebrafish промоутер и резюмирует эндогенного выражение в A. гракл. Мы обнаружили, что четыре других промоутеров изолированы от данио рерио выражение ткани конкретного диска как ожидалось в A. гракл (данные не показаны). Поскольку у рыбок данио промоутеров резюмировать их шаблоны сохранены выражений в A. гракл, это свидетельствует о том, что многие генетические инструменты могут быть переданы непосредственно от данио рерио A. гракл без необходимости модификации с а. гракл промоторов. Кроме того с развитием технологий виртуализации в A. гракл33, трансгенных подходов, описанных здесь позволит мощный будущего для расследования усилители и промоутеров, которые могут играть определенную роль в разнице между поверхность и пещера формы. И наконец мощные инструменты для генетической манипуляции биологических процессов, которые сделали данио рерио ценные одинаково важны в A. гракл60,61,62,63. Различия в различные поведенческие черты, такие как сон, питание, стресс, и агрессия, между формами поверхности - и местонахождения троглофильных A. гракл были широко документированных12,14,15 ,38,64, но базовые нейронные корреляты не вполне понятны. Инструменты, такие как Tg(elavl3:GCaMP6s) , позволят рассечение как различия в активности нейронов мозга общесистемной коррелируют с различиями в поведении и предлагают уникальную возможность заглянуть в как мозг должен быть изменен эволюционно.

Вместе взятые, а гракл обещает стать ведущей моделью для изучения эволюции различных морфологических и поведенческих признаков. Различные различия в сложных биологических процессах в A. гракл обеспечить платформу для изучения генетических механизмов черта эволюции. Применение инструментов для манипулирования функции гена может помочь развивать этот организм в модель, которая может применяться для исследования биологических заболеваний, связанных с дегенерацией глаз, нарушения психомоторного развития и бессонница.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Авторы благодарят Sunishka Тхакур за ее помощь в генотипирования и визуализации oca2 мутант рыб, изображенный на рисунке 2. Эта работа была поддержана Национальный фонд науки (NSF) награду 1656574 A.C.K., премии 1754321 NSF J.K. и A.C.K. и национальных институтов здравоохранения (НИЗ) премии R21NS105071 A.C.K. и E.R.D.

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
Манипуляции функции гена в мексиканской Cavefish
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter