A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

8.1K views

DOI:

10.3791/59270

March 21st, 2019

In This Article

Summary

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

Abstract

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models.

Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

Introduction

The intestinal microbiome is an essential component for maintenance of homeostasis, and involves both innate and adaptive immune responses1,2. The commensal microbiota community is characterized by different main commensal constituents: symbionts that confer beneficial effects by important immunomodulatory functions, and pathobionts that can have detrimental effects in genetically predisposed hosts and promote and trigger intestinal inflammation3,4. Many studies on symbionts and pathobionts and their influence on the host immune system have been published mainly studying adaptive immune responses.

Since these studies involve many animals for the investigations and the protection and replacement of animals used for experimentation is of increasing public interest, we seek to find a replacement model to allow for a screening of different bacterial immunogenic properties. Insects, especially Galleria mellonella, are a widely used replacement model in infection research. G. mellonella combines different advantages such as low costs and high throughput; it allows oral administration of bacteria, which is the natural exposure route, and it allows for systemic infection5,6. G. mellonella further enables incubation at 37 °C, which is the physiological body temperature of mammals and the optimum for bacterial virulence factor expression5. The main advantage of G. mellonella is the conserved innate immune system that enables the discrimination of self from non-self and encodes a variety of pattern recognition receptors like apolipophorin or the opsonin hemolin6,7. Upon microbe recognition, G. mellonella can trigger different downstream humoral immune responses. It can induce oxidative stress responses and secrete reactive oxygen species (ROS) which involves the activity of NOS (nitric oxidase synthase) and NOX (NADPH oxidase)6,8. In addition, G. mellonella activates a potent antimicrobial peptide (AMP) response, which results in the secretion of a mixture of different AMPs such as gloverin, moricin, cecropin or the defensin-like gallerimycin6,8,9,10. Generally, AMPs have quite broad host specificity against Gram-positive and Gram-negative bacteria and fungi and have to provide an potent response since insects are lacking any adaptive response10. Gloverin is an AMP active against bacteria and fungi and inhibits outer membrane formation6,11. Moricins exhibit their antimicrobial function against Gram-positive and Gram-negative bacteria by penetrating the membrane and forming a pore9,11. Cecropins provide activity against bacteria and fungi and permeabilize the membrane similarly like moricins9,10. Gallerimycin is a defensin-like peptide with anti-fungal properties9. Interestingly, it was found that the combination of cecropin and gallerimycin had a synergistic activity against E. coli10.

Due to their easy-to-use character G. mellonella larvae are an often used infection model to assess bacterial pathogenicity. In particular, studies in which data obtained from G. mellonella correlate with data obtained from mice support the strength of this alternative host model. It was found that the most pathogenic serotypes of Listeria monocytogenes in a mouse infection model lead also to higher mortality rates in G. mellonella after systemic infection. Further, less virulent serotypes turned out to be also less virulent in the G. mellonella model12. Similar observations have been made with the human pathogenic fungi Candida albicans. Virulence of different C. albicans strains has been assessed by systemic infection and subsequent monitoring of larval survival. Mouse avirulent strains were also avirulent or exhibited reduced virulence in G. mellonella, whereas the mouse virulent strains lead also to high larval mortality13. The G. mellonella model could further be used to identify type 3 secretion system pathogenicity factors of Pseudomonas aeruginosa14.

Since most investigations involving G. mellonella were focused on virulence factors using the systemic infection approach we were especially interested in providing a method suitable for the analysis of intestinal commensals in an oral force-feeding model in which we can apply a distinct dosage of bacteria per larvae and not only observe the larval mortality rate but analyze different hallmarks of innate immune responses to maintain intestinal homeostasis.

Our method helps to increase the use of G. mellonella as a replacement model since we combine the application of bacteria and the analysis of RNA expression. It is not only useful to strengthen the meaning of bacterial pathogenesis studies when including the analysis of immune responses after oral administration and not only the observation of mortality rates after systemic infection. Our methods allows for the analysis of immunogenic properties of bacterial non-pathogenic commensals since it is provides more complex conditions than cell culture by offering an intestinal barrier in a living organism.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. G. mellonella rearing and preparation of the larvae for the experiments

NOTE: The cycle from egg to last instar larva takes approximately 5-6 weeks.

  1. Transfer the eggs laid by adult moths to 2 L boxes containing wax moth substrate (22% corn grits, 22% wheat meal, 17.5% beeswax, 11% skimmed milk powder, 11% honey, 11% glycerol, 5.5% dried yeast). Perform the whole breeding at 30 °C in the dark.
  2. Transfer 25 g of substrate containing the larvae into fresh substrate after approximately 1-2 weeks when small and tiny larvae were visible. Synchronize the larvae after 2 weeks according to their size and keep groups of 30-40 larvae in 2 L containers on wax moth substrate for additional 2 weeks.
  3. Select the larvae for experiments by weight. Use only pale and fast moving larvae with a mass of 180-200 mg.

2. Cultivation and preparation of Bacteroides vulgatus and Escherichia coli for oral administration

  1. Grow the obligate anaerobic bacterium Bacteroides vulgatus mpk at 37 °C anaerobically using jars and sachets for creating an anaerobic environment (see Table of Materials)15,16. Cultivate B. vulgatus for 2 days and grow an overnight subculture in brain heart infusion (BHI) broth.
  2. Grow the facultative anaerobic bacterium Escherichia coli mpk under aerobic conditions in Luria-Bertani (LB) broth at 37 °C. Cultivate E. coli overnight in LB broth and grow subculture for 2 h at 37 °C on the day of the experiment.
  3. Harvest the cultures by centrifugation at 1,700 x g for 5 min. Resuspend the bacterial pellets in DPBS (Dulbecco's Phosphate-Buffered Saline). Determine the optical density (OD) of the bacterial cultures at OD 600 nm and calculate the bacterial concentrations. The bacterial concentrations were adjusted to 109/mL.

3. Force-feeding of G. mellonella larvae with bacterial suspensions

  1. Force-feed each larva with 10 µL of the adjusted bacterial suspension containing 107 bacteria per dose. Use an insulin syringe with a blunt-ended needle for oral application of the bacterial suspension.
    1. Fix the syringe into a microsyringe pump (Figure 1) to ensure the accuracy of the applied suspension volume to each larva (see Table of Materials). Insert the syringe carefully between their mandibles. Do not force the syringe between the mandibles. Wait for the larvae to open it mouthparts and insert then the syringe.
  2. Incubate the force-fed larvae in the dark at 37 °C between 1-24 h. Use DPBS-administered larvae as mock background controls to exclude potential stress responses induced due to the handling of the larvae during force-feeding.

4. Processing of orally administered larvae and RNA isolation

  1. Work under a hood and wear safety glasses. Clean the hood and spray reagent to prevent RNase contamination.
    1. Snap-freeze the living larvae after incubation in liquid nitrogen and homogenize them. Use a mortar and pistil for homogenization. Add liquid nitrogen to the mortar and grid each larval individual until powdered homogenates are produced.
    2. Pour the homogenate to a disposable weighing boat and wait for the liquid nitrogen to evaporate.
  2. Mix the liquid nitrogen-free frozen powdered homogenates with 1 mL of Trizol in a 2 mL tube and incubate the mixture at room temperature for 1 h.
  3. Centrifuge the mixture at 8,000 x g for 15 min at room temperature and transfer the supernatant into a fresh tube and discard the pellet. Mix the supernatant with 200 µL of 1-Bromo-3-Chloropropane (BCP). Vortex and incubate the mixture for 5 min at room temperature and for 10 min on ice.
  4. Centrifuge the BCP-added reactions at 18,000 x g for 15 min at 4 °C. Transfer the upper transparent layer into a new 2 mL tube and discard the rest. Precipitate the RNA of the transferred upper layer with 500 µL isopropanol by mixing and inverting the tube for 5 min.
  5. Centrifuge the tube at 18,000 x g for 15 min at 4 °C. Wash the precipitated RNA pellet with 500 µL of 75% ethanol.
  6. Dry the RNA pellet for 5-10 min at RT. Take care to not over dry it as it will be hard to dissolve later.
  7. Dilute ribonuclease inhibitor (1:100) in nuclease-free water and use 100 µL of the solution to resuspend the dried RNA pellet. Vortex the tube carefully until the pellet is completely dissolved.
  8. Measure RNA quality and quantity. Ensure that the 260/280 ratio is approximately 2.0 and 260/230 ratio in the range of 2.0-2.2 (see Table of Materials).
  9. Use 5 µg of the isolated RNA for DNase digestion. Mix 5 µL of 10x buffer, 1 µL of ribonuclease inhibitor enzyme, 2 µL of DNase enzyme, 5 µg of RNA, and fill up with nuclease-free water up to 50 µL. Incubate for 30 min at RT.
    1. Add 6 µL of inactivation reagent and incubate for 2 min at RT and vortex reaction occasionally. Centrifuge reaction at 10,000 x g for 1 min. Transfer supernatant into fresh 1.5 mL tube.
      NOTE: The RNA contains the larval RNA as well as the bacterial RNA of the respective strain used for oral administration.

5. Quantification of the bacterial 16S copy numbers after force-feeding

NOTE: The copy numbers of the expressed bacterial 16S was determined using cDNA synthesized from the RNA extracted in section 4. Final quantification is calculated with the help of a standard curve of plasmid in which the 16S PCR fragment of either B. vulgatus or E. coli was cloned.

  1. Preparation of plasmid standards
    1. Amplify 16S fragments from E. coli mpk or B. vulgatus mpk genomic DNA by PCR. Mix 10 µL of 5x buffer, 1 µL of 10 mM dNTP solution, 2.5 µL of 10 µM forward primer and 2.5 µL of 10 µM reverse primer dilution, 1 µL of DMSO, 1 µL of genomic DNA template, 31.5 µL of nuclease-free water and 0.5 µL of proof-reading enzyme.
    2. Run the PCR (initial denaturation: 98 °C for 30 s, denaturation: 98 °C for 10 s, annealing: 60 °C for 30s, extension: 72 °C for 30 s, final extension: 72 °C for 5 min, repeat denaturation, annealing and extension for 30 cycles).
      1. Use 16S E. coli primers (p_forward: GTTAATACCTTTGCTCATTGA, p_reverse: ACCAGGGTATCTAATCCTGTT17, 320 bp) or 16S B. vulgatus primers (p_forward: AACCTGCCGTCTACTCTT, p_reverse: CAACTGACTTAAACATCCAT18, 400 bp) for amplification.
    3. Use the E. coli and B. vulgatus 16S PCR fragments for blunt-end cloning into a cloning vector. Set up ligation and mix 10 µL of 2x buffer, 1 µL of non-purified PCR product, 1 µL of blunt-end cloning plasmid, 7 µL of nuclease-free water and 1 µL of T4 DNA Ligase. Incubate ligation for 10 min at RT.
    4. Prepare E. coli DH5α competent cells.
      1. Inoculate 100 mL of LB medium in an Erlenmeyer flask with 1 mL of an overnight culture. Grow the culture until OD 600 nm is between 0.4-0.6. Split the resulting culture into two 50 mL tubes and incubate the cultures on ice for 10 min.
      2. Centrifuge the cultures at 1,700 x g for 10 min at 4 °C. Discard the supernatant and resuspend each pellet carefully with 5 mL of RFI solution (30 mM CH3COOK, 100 mM KCl, 10 mM CaCl, 50 mM MnCl2, adjust pH 5.8 with glacial acid, sterile filtered). Fill each tube with additional 45 mL of RFI solution.
      3. Centrifuge the cultures at 1,700 x g for 10 min at 4 °C. Discard the supernatant and resuspend each pellet carefully with 6 mL of RFII (10 mM MOPS, 15 mM CaCl2, 10 mM KCl, 15% glycerol, autoclaved) solution. Pool both fractions and incubate the 12 mL suspension on ice for 15 min. Prepare cell suspension aliquots (200 µL). Store the aliquots at -80 °C.
    5. Transfer the ligation reaction to one aliquot of competent E. coli DH5α cells and leave the reaction on ice for 15 min. Heat shock the cells for 45 s at 42 °C and add 1 mL of LB medium.
      1. Incubate transformation for 45 min at 37 °C. Add 100 µL of the transformation to a LB agar plate containing ampicillin and incubate overnight at 37 °C.
    6. Perform colony PCR of 8 resulting transformants from the LB agar plate of step 5.1.5. Pick each colony with a toothpick, dip it onto a fresh LB plate containing ampicillin (master plate) and then dip the same toothpick into a well containing 5.5 µL of nuclease-free water in a PCR stripe.
      1. Add 7.5 µL of 2x PCR mix, 0.5 µL of 10 µM forward primer and 0.5 µL of 10 µM reverse primer dilution. Use the same primer pairs mentioned in section 5.1.1.
      2. Run PCR (initial denaturation: 95 °C for 5 min, denaturation: 95 °C for 1 min, annealing: 60 °C for 30s, extension: 72 °C for 1 min, final extension: 72 °C for 7 min, repeat denaturation, annealing and extension for 35 cycles).
    7. Verify the size of the 16S fragments on a 1% agarose gel. Use 0.5x Tris-Borate-EDTA (TBE) buffer to dissolve 1 g of agarose and boil it in a microwave. Add 1:50,000 dye to gel and pour it. Add the colony PCR reactions and a 100 bp DNA ladder to the gel, and run the gel for 45 min at 110 V.
    8. Inoculate a 5 mL LB overnight culture containing ampicillin with one clone from the master plate (section 5.1.6) for each E. coli and B. vulgatus 16S plasmid that contains the right insert size.
      1. Centrifuge the bacterial overnight cultures in a 2 mL tube at 1,700 x g. Discard the supernatant and resuspend the pellet in 600 µL sterile water.
      2. Add 100 µL of lysis buffer and mix by inverting the tube 6 times. Add 350 µL of cold (4°C) neutralization solution and mix thoroughly by inverting the tube.
      3. Centrifuge at maximum speed in a centrifuge for 3 min. Transfer the supernatant (~900 µL) to a spin column and centrifuge at maximum speed in a centrifuge for 15 s.
      4. Discard the flowthrough and add 200 µL of endotoxin removal wash and centrifuge at maximum speed in a centrifuge for 15 s.
      5. Add 400 µL of wash solution to the column and centrifuge at maximum speed in a centrifuge for 30 s. Transfer the column to a clean 1.5 mL tube, add 30 µL of elution buffer to the column incubate it for 1 min at room temperature.
      6. Centrifuge at maximum speed in a centrifuge for 30 s (see Table of Materials).
    9. Determine the plasmid DNA concentration by mixing 1 µL of plasmid DNA with 199 µL of working solution (1 µL of fluorescent dye per 199 µL of buffer for each reaction). Prepare two standards by mixing 10 µL of standard 1 or 10 µL of standard 2 with 190 µL. Vortex the sample and standard tubes and incubate reaction for 2 min. Measure the concentration (see Table of Materials).
    10. Prepare standard concentrations in 10-fold serial dilutions in a range of 10-100,000 copies: Calculation the mass of the single plasmid (m = (n) x (1.096x10-21 g/bp), n = plasmid size, m = mass). Calculate the mass of plasmid DNA needed to contain the desired copy numbers of interest (copy number of interest x mass of single plasmid = mass of plasmid DNA needed).
  2. Preparation of samples for quantification
    1. Synthesize cDNA. Mix 2 µL of 7x buffer, 1 µL of DNase-digested RNA from section 4 and 11 µL of nuclease-free water. Incubate for 2 min at 42 °C.
      1. Place reaction immediately on ice. Mix 4 µL of 5x RT Buffer, 1 µL of RT (Reverse Transcriptase) primer mix, 1 µL of RT enzyme and the reaction of step 5.2.1. Incubate for 15 min at 42 °C. Incubate for 3 min at 95°C to inactivate RT enzyme.
    2. Quantify cDNA concentrations fluorometrically like described in step 5.1.9.
  3. Measurement of bacterial load
    1. Adjust cDNA concentrations to 5 ng per 12 µL reaction for quantitative PCR. Mix 2x RT-PCR mix, 0.25 µL of 100 µM forward primer, 0.25 µL of 100 µM reverse primer (5.1.1) and 12 µL of adjusted cDNA. Run qPCR (initial denaturation: 95 °C for 5 min, denaturation: 95 °C for 10 s, annealing: 60 °C for 30 s, repeat denaturation and annealing for 35 cycles, melting: 95 °C, cool down to 4 °C).
    2. Plot log10 concentrations of plasmid standard curve (10-100,000 copies), i.e. 1-5 (x-axis), against the corresponding ct-values (y-axis). Perform linear regression to obtain the regression equation. Solve the equation for x (concentration). Use the formula to calculate the log10 of the copy numbers by inserting ct-value into the formula. Calculate the antilogarithm to obtain copy numbers.

6. Determination of innate immune marker gene using quantitative RT-PCR

  1. Check primers for gene-specificity by PCR and subsequent agarose gel electrophoresis to verify the correct fragment size. Perform PCR like described in section 5.1.5.
    Ubiquitin 130 bp: forward TCAATGCAAGTAGTCCGGTTC, reverse CCAGTCTGCTGCTGATAAACC19 (housekeeping)
    Nox-4 159 bp: forward TGGCACGGCATCAGTTATCA, reverse ACAGCGACTGTCATGTGGAA8
    Nos 76 bp: forward ATGAAGGTGCTGAAGTCACAA, reverse GCCATTTTACAATCGCCACAA8
    Gst 156 bp: forward GACAGAAGTCCTCCGGTCAG, reverse TCCGTCTTCAAGCAAAGGCA8
    ApoIII 265 bp: forward AGACTTGCACGCCATCAAGA, reverse TGCATGCTGTTTGTCACTGC8
    hemolin 267 bp: forward CTCCCTCACGGAGGACAAAC, reverse GCCACGCACATGTATTCACC8
    gallerimycin 161 bp: forward GAAGTCTACAGAATCACACGA, reverse ATCGAAGACATTGACATCCA8
    cecropin 158 bp: forward CTGTTCGTGTTCGCTTGTGT, reverse GTAGCTGCTTCGCCTACCAC8
    gloverin 101 bp: forward GTGTTGAGCCCGTATGGGAA, reverse CCGTGCATCTGCTTGCTAAC8
    moricin 124 bp: forward GCTGTACTCGCTGCACTGAT, reverse TGGCGATCATTGCCCTCTTT8)
  2. Assess primer efficiency to be E=2.
    1. Pool 2 µL of 5-10 different positive samples (i.e., samples that are expressing the gene for which the primer pair needs to be investigated).
    2. Prepare a 1:5 dilution series of the sample pool: standard 1 (S1): undiluted pool; S2: 2 µL of S1 + 8 µL nuclease-free water; S3: 2 µL of S2 + 8 µL nuclease-free water; S4: 2 µL of S3 + 8 µL nuclease-free water.
    3. Apply 1 µL of S1-S4 and a non-template control (nuclease-free water) to a 96-well qPCR plate. Add 5 µL of RT master mix, 0.1 µL of each 100 µM forward and reverse primer, 3.7 µL of nuclease-free water and 0.1 µL of RT mix per well.
    4. Run quantitative RT-PCR (reverse transcription: 50 °C for 10 min, initial denaturation: 95 °C for 5 min, denaturation: 95 °C for 10 s, annealing: 60 °C for 30 s, repeat denaturation and annealing for 40 cycles, melting: 95 °C, cool down to 4 °C).
    5. Plot log10 of relative units for S1-S4 (1, 0.2, 0.04, 0.008) (x-axis) against the corresponding ct-values (y-axis). Perform linear regression and determine the slope of the standard curve. Calculate the efficiency E: E= 10-(1/slope).20
      NOTE: A slope of -3.32 indicates ideal reaction conditions and primer efficiency of E=2.00. This means: the amount of PCR product doubles during each cycle.
  3. Use 100 ng of digested RNA (100 ng/µL) as a template for RT-PCR. Mix RT-PCR reagents and run RT-PCR like mentioned in section 6.2. Measure all bacteria- and DPBS-administered samples with both housekeeping primer pair and target primer pairs. Always run the S1-S4 dilutions with the housekeeping primer pair and S1-S4 with the target primer pair on the same plate for efficiency determination.
  4. Calculate ratio (R) of RNA gene expression according to the following formula using the experimentally determined primer efficiency of both the housekeeping and the target primer pair. Normalize bacteria stimulated samples to mock controls20.
    qPCR relative quantification formula; equation for gene expression analysis; ΔCт calculation method.
    R: ratio
    Etarget: efficiency of S1-4 measured with target primer pair
    Ehousekeeping: efficiency of S1-4 measured with housekeeping primer pair
    Δcttarget(control-sample): Δct of (ct of DPBS-fed sample)-(ct of bacteria-fed sample) measured with target primer pair
    Δcthousekeeping(control-sample): Δct of (ct of DPBS-fed sample)-(ct of bacteria-fed sample) measured with housekeeping primer pair

Access restricted. Please log in or start a trial to view this content.

Results

The G. mellonella hemolymph infection model in widely used to analyze the virulence factors of a huge variety of pathogens. Most measurements include the analysis of larvae mortality, which is a quite easy method. Nevertheless, this method does not allow conclusions about immune responses in general and link the results of G. mellonella immune responses with vertebrate immune mechanisms. The G. mellonella oral administration model on the other hand is only rarel...

Access restricted. Please log in or start a trial to view this content.

Discussion

The G. mellonella model is a frequently used model to assess bacterial virulence factors in a systemic infection approach21. Since many pathogens and bacteria enter the host via the oral colonization or infection route, new insights need to be found to evaluate G. mellonella as a model for oral colonization and infection.

The possibility to rear G. mellonella between 15-37 °C is a great advantage since most mammalian models maintain body ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was funded by the DFG (SPP1656), the DFG research training group 1708, the Bundesministerium für Bildung und Forschung (BMBF), and the German Center for Infection Research (DZIF).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1.5 mL tubesEppendorf0030120086
100 bp DNA ladder Thermo Fisher Scientific15628019
1-Bromo-3-Chloropropane (BCP)Sigma-AldrichB9673
2 mL tubesEppendorf0030120094
2x MangomixBiolineBIO-25033Colony PCR
50 mL tubesGreiner Bio-One210 261
AgaroseBiozym840004
BeeswaxMixed-Store.de -
Brain heart infusion brothThermo Fisher ScientificCM1135
CloneJET PCR Cloning KitThermo Fisher ScientificK1232Cloning vector for 16S fragments
Corn gritsOstermühle Naturkost GmbH306Organic cultivation
Difco LB Agar, Miller (Luria-Bertani)Becton DickinsonBD
Difoco LB Broth, Miller (Luria-Bertani)Becton Dickinson244610
DNA-free DNA Removal Kit Thermo Fisher Scientific244510 Dnase digestion
Dried yeastRapunzel -Organic cultivation
Dulbecco's Phosphate-Buffered Saline (DPBS)Thermo Fisher Scientific14040
EthanolVWR20821.330
GlycerolSigma-AldrichW252506
HoneyOstermühle Naturkost GmbH487
Isopropanol VWR20842.330
Lightcycler 480 Instrument IIRoche Molecular Systems5015278001
LightCycler 480 Multiwell Plate 96, whiteRoche Molecular Systems4729692001
Manual Microsyringe Pump with Digital DisplayWorld Precision InstrumentsDMP
Micro-Fine+ U-100 insulin syringe 0.3 x 8 mmBecton Dickinson324826Oral administration
Mortar, unglazedVWR410-9327 
NanodropThermo Fisher Scientific13-400-518
Nuclease-free water Thermo Fisher Scientific10977035
Oxoid AnaeroGen sachets Thermo Fisher ScientificAN0025AQuality and quantity of RNA
PCR stripesBiozym710970
Pestle, unglazed grinding surfaceVWR410-9324 
Phusion proof-reading enzyme Thermo Fisher ScientificF553S
PrimersBiomers -
PureYield Plasmid Miniprep SystemPromegaA1222
QuantiFast SYBR Green PCR kit Qiagen204056qPCR for bacterial copy number measurment
QuantiFast SYBR Green RT-PCR Kit Qiagen204156qRT-PCR for gene expression measurements
QuantiTect Reverse Transcription Kit Qiagen205311cDNA synthesis
Qubit Assay TubesThermo Fisher ScientificQ32856
Qubit dsHS DNA kit Thermo Fisher ScientificQ32851Quantification of plasmid and cDNA samples
Qubit fluorometerThermo Fisher ScientificQ33226Quantification of plasmid and cDNA samples
RNase-ExitusPlusAppliChemA7153
Rnasin Ribonuclease InhibitorPromegaN2511
Skimmed milk powderSucofin -
SYBR safe DNA Gel StainThermo Fisher ScientificS33102
TRI reagent Sigma-AldrichT9424
Weighing boatVWR10803-148
Wheat mealOstermühle Naturkost GmbH6462Organic cultivation

References

  1. Nell, S., Suerbaum, S., Josenhans, C. The impact of the microbiota on the pathogenesis of IBD: lessons from mouse infection models. Nature Reviews Microbiology. 8 (8), 564-577 (2010).
  2. Muniz, L. R., Knosp, C., Yeretssian, G. Intestinal antimicrobial peptides during homeostasis, infection, and disease. Frontiers in Immunology. 3, 310(2012).
  3. Ivanov, I. I., Honda, K. Intestinal commensal microbes as immune modulators. Cell Host Microbe. 12 (4), 496-508 (2012).
  4. Ayres, J. S. Inflammasome-microbiota interplay in host physiologies. Cell Host Microbe. 14 (5), 491-497 (2013).
  5. Champion, O. L., Titball, R. W., Bates, S. Standardization of G. mellonella Larvae to Provide Reliable and Reproducible Results in the Study of Fungal Pathogens. Journal of Fungi (Basel). 4 (3), (2018).
  6. Wojda, I. Immunity of the greater wax moth Galleria mellonella. Insect Science. , (2016).
  7. Buchmann, K. Evolution of Innate Immunity: Clues from Invertebrates via Fish to Mammals. Frontiers in Immunology. 5, 459(2014).
  8. Lange, A., et al. Galleria mellonella: A Novel Invertebrate Model to Distinguish Intestinal Symbionts From Pathobionts. Frontiers in Immunology. 9 (2114), (2018).
  9. Tsai, C. J., Loh, J. M., Proft, T. Galleria mellonella infection models for the study of bacterial diseases and for antimicrobial drug testing. Virulence. , 1-16 (2016).
  10. Bolouri Moghaddam, M. R., et al. The potential of the Galleria mellonella innate immune system is maximized by the co-presentation of diverse antimicrobial peptides. Biological Chemistry. 397 (9), 939-945 (2016).
  11. Casanova-Torres, A. M., Goodrich-Blair, H. Immune Signaling and Antimicrobial Peptide Expression in Lepidoptera. Insects. 4 (3), 320-338 (2013).
  12. Mukherjee, K., et al. Galleria mellonella as a model system for studying Listeria pathogenesis. Applied and Environmental Microbiology. 76 (1), 310-317 (2010).
  13. Brennan, M., Thomas, D. Y., Whiteway, M., Kavanagh, K. Correlation between virulence of Candida albicans mutants in mice and Galleria mellonella larvae. FEMS Immunological and Medical Microbiology. 34 (2), 153-157 (2002).
  14. Miyata, S., Casey, M., Frank, D. W., Ausubel, F. M., Drenkard, E. Use of the Galleria mellonella caterpillar as a model host to study the role of the type III secretion system in Pseudomonas aeruginosa pathogenesis. Infection and Immunity. 71 (5), 2404-2413 (2003).
  15. Waidmann, M., et al. Bacteroides vulgatus protects against Escherichia coli-induced colitis in gnotobiotic interleukin-2-deficient mice. Gastroenterology. 125 (1), 162-177 (2003).
  16. Lange, A., et al. Extensive Mobilome-Driven Genome Diversification in Mouse Gut-Associated Bacteroides vulgatus mpk. Genome Biology and Evolution. 8 (4), 1197-1207 (2016).
  17. Hermann-Bank, M. L., Skovgaard, K., Stockmarr, A., Larsen, N., Molbak, L. The Gut Microbiotassay: a high-throughput qPCR approach combinable with next generation sequencing to study gut microbial diversity. BMC Genomics. 14, 788(2013).
  18. Sato, K., et al. OmpA variants affecting the adherence of ulcerative colitis-derived Bacteroides vulgatus. Journal of Medical and Dental Science. 57 (1), 55-64 (2010).
  19. Freitak, D., et al. The maternal transfer of bacteria can mediate trans-generational immune priming in insects. Virulence. 5 (4), 547-554 (2014).
  20. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research. 29 (9), 45(2001).
  21. Ramarao, N., Nielsen-Leroux, C., Lereclus, D. The insect Galleria mellonella as a powerful infection model to investigate bacterial pathogenesis. Journal of Visualized Experiments. (70), e4392(2012).
  22. Ramarao, N., Nielsen-Leroux, C., Lereclus, D. The insect Galleria mellonella as a powerful infection model to investigate bacterial pathogenesis. Journal of Visualized Experiments. (70), e4392(2012).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Commensal BacteriaInnate Immune ResponseRNA ExtractionGene Expression AnalysisBacterial ClearanceImmune Marker ActivationAntimicrobial PeptidesReactive Oxygen Species