Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Dairesel RNA'ları Analiz Etmek Için Minigen İçeren Alu Elementin Kullanımı

doi: 10.3791/59760 Published: March 10, 2020

Summary

Dairesel RNA'lar üreten muhabir genleri klonlayıp analiz ediyoruz. Bu muhabir genler doğrusal birleştirme analiz etmek ve Alu elemanları içeren yapılar daha büyüktür. Dairesel RNA'ları araştırmak için yapılar hücrelere dönüştürülr ve doğrusal RNA çıkarıldıktan sonra RT-PCR kullanılarak ortaya çıkan RNA analiz edilir.

Abstract

Lineer mRNA'lara ek olarak, birçok ökaryotik gen dairesel RNA'lar üretir. Çoğu dairesel RNA, 5'li bir splice sitesine, bir ön mRNA içinde 3' splice sitesi ile katılarak oluşturulur, bu süreç geri birleştirme olarak adlandırılır. Bu daireselleştirme büyük olasılıkla pre-mRNA ikincil yapılar tarafından desteklenir yakın içine splice siteleri getirmek. İnsan genlerinde, Alu elementleri bu ikincil RNA yapılarını teşvik eder, çünkü Alu elementleri bol miktarda bulunur ve mRNA öncesi zıt yönlerde mevcut olduğunda birbirleriyle baz tamamlayıcılıkları sergilerler. Burada dairesel RNA'lar oluşturan muhabir genleri içeren büyük Alu elementinin üretimini ve analizini tanımlıyoruz. Klonlama protokollerinin optimizasyonu ile 20 kb kesici uç uzunluğuna sahip muhabir genler oluşturulabilir. Ortak transfeksiyon deneylerindeki analizleri düzenleyici faktörlerin tanımlanmasına olanak sağlar. Böylece, bu yöntem dairesel RNA oluşumunda yer alan RNA dizilerini ve hücresel bileşenleri tanımlayabilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dairesel RNA'lar
Dairesel RNA'lar (circRNA'lar) kovalent olarak kapalı tek iplikçikli RNA'lar çoğu organizmada ifade edilir. Onlar bir downstream 5 'splice site, bir upstream 3' splice siteye katılarak oluşturulur, bir süreç geri birleştirme denir (Şekil 1A)1. 30-40 nt gibi kısa baz tamamlayıcı sergileyen pre-mRNA dizileri circRNA oluşumu2için uygun hizalama içine geri-splice siteleri getirmek . İnsanlarda, Alu elemanları1,genomunyaklaşık% 11 temsil 3 , kendi kendini tamamlayıcılık nedeniyle pre-mRNA geniş çift telli RNA yapıları oluşturmak4,5 ve böylece circRNAoluşumunuteşvik 1 .

Şu anda circRNA'ların üç ana işlevi tanımlanmıştır. Bazı circRNA'lar mikroRNA'ları (miRNA'lar) bağlar ve miRNA süngerleri gibi tutma hareketi ile6. CircRNA'lar transkripsiyonel ve post transkripsiyonel düzenlemeye, doğrusal birleştirme7 veya transkripsiyon faktörüaktivitesininmodülasyonu ile rekabet yoluyla 8. Son olarak, circRNA kısa açık okuma çerçeveleri ve ilke çalışmalarıkanıtı içeren 9,10tercüme edilebilir göstermektedir. Ancak, en circRNA fonksiyonu esrarengiz kalır. Dairesel RNA'ların çoğu yeni nesil sıralama yöntemleri kullanılarak tespit edilmiştir11. Hedeflenen RT-PCR yaklaşımları kullanılarak bireysel genlerin ayrıntılı analizleri, çok sayıda dairesel RNA'nın12.

Pre-mRNA işleme analiz etmek için muhabir genlerin kullanımı
DNA muhabirinden elde edilen mRNA'nın hücrelere transfekte olan yapılarından elde edilen mRNA'nın analizi, dairesel RNA'lara uygulanabilen alternatif pre-mRNA birleştirme yi incelemek için kurulmuş bir yöntemdir. Genel olarak, alternatif ekson, çevresindeki intronlar ve kurucu ekonlar yükseltilir ve ökaryotik ifade vektörü içine klonlanır. Sık sık, intronlar kısalır. Yapılar ökaryotik hücrelere dönüştürüldü ve genellikle RT-PCR13,14tarafından analiz edilir. Bu yaklaşım, ortak transfeksiyon deneylerinde düzenleyici splice sitelerinin ve trans-etkili faktörlerin haritalarında yaygın olarak kullanılmıştır13,15,16,17,18. Buna ek olarak, protein ifade minigenlerin üretimi alternatif birleştirme değiştiren maddelerin taranması için izin19,20.

Yöntem dairesel RNA'lara uygulanmıştır. Literatürde en az 12 minigen omurgası tanımlanmış ve Tablo 1'deözetlenmiştir. TRNA tabanlı ifade sistemi21,22dışında hepsi polimeraz II organizatörleri bağlıdır. Burada, dairesel RNA'ların oluşumunda yer alan cis ve trans-acting faktörleri belirlemek için insan muhabir minigenleri oluşturmak için bir yöntem açıklıyoruz. Yayınlanan muhabir gen23 dizilerini kullanarak yönteme genel bir bakış Şekil 1'degösterilmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Yapıların tasarımı

  1. Dairesel RNA oluşumu için gerekli tekrarlayan elementleri belirlemek ve bunları yapılara dahil etmek için UCSC genomtarayıcısı 24'ü kullanın. Daha da önemlisi, amplifikasyon için astartekrarlayan elemanların dışında olması gerekir.
  2. Dairesel RNA dizisini(Tamamlayıcı Şekil 1 bir test dizisidir) https://genome.ucsc.edu/cgi-bin/hgBlat?command=start yapıştırın ve doğru organizmayı seçin. Sırayı gönderin ve tarayıcı görünümüne gidin, 1.5x'i uzaklaştırın veya uygun şekilde uzaklaştırın (Şekil 2A).
    NOT: Arama sırası üst satırda görünür (Şekil 2A, 1). Dairesel RNA'daki ekzonların sırasına bağlı olarak, BLAT tüm ekzonları bağlamaz. Bu örnekte, ekson 12(Şekil 2A, 4) 11'e bağlı değildir ( Şekil2A, 2, 3), çünkü ekson 12 dairesel RNA dizisinde ekson 11'in yukarı sındadır ( Ek Şekil1). Yinelenen elemanlar, siyahın gri ye doğru renkte evrimsel korumayı gösterdiği kutularla gösterilen 'tekrar masker' parçasında dır(Şekil 2A, 5).
  3. Kayan bir pencerede alt yazılarını tanımlamak için yinelenen öğelerin üzerinde fare. Alu elementler SİnSİn (kısa serpiştirilmiş nükleer eleman) hattındadır. Şekil 2'den farklı bir resim elde edilirse tarayıcıyı sıfırlamak için pencerenin altındaki 'varsayılan parçalar' düğmesini kullanın.
    NOT: Gen ekranındaki eksonlar üzerinde mousing bilgisayar oluşturulan ekson numaraları ile bir pencere oluşturur. Bu sayılar literatürde yer alan ekson numaralandırmaya karşılık gelmez ve aynı zamanda İzoformlar arasında da değişir.

2. Bir ifade vektöründe klonlanacak sırayı seçin

  1. UCSC genom tarayıcısının üst satırındaki View → DNA'ya giderek pencerede gösterilen DNA dizisini indirin. Sıralama Biçimlendirme Seçeneği'ndeGenişletilmiş Büyük/Renk Seçenekleri'niseçin.
  2. Varsayılan servis durumunu Alt olarak seçin ve NCBI refseqiçin geçiş örneğini seçin. Yinelenen Maskeriçin altı çizili, kalın ve italik'i seçin. Gönder'itıklatın. Büyük harfler, intronlar küçük harfler olarak ekonlar olacaktır. Ekson/intron sınırlarını kontrol edin.
  3. Bu örnekte, tarayıcının ters tamamlayıcıyı gösterdiğini belirten bir 'ccctttacCTTTTTT' dizisi vardır. Bu durumda, geri gidin ve bu örnekte AAAAAGgtaaaggg, doğru exon intron sınırları (agEXONgt) görene kadar ters kompleman kutusunu seçin.
  4. Dosyayı doğru yönlendirmeyle kopyalayın (iç eksonlar intronic ag ile çevrilidir... gt) bir kelime işleme belgesi içine ve exons vurgulamak (Ek Şekil 2).
    NOT: Bu örnekte, 9-12 eksonlarını kapsayan genomik parça yaklaşık 24 kb civarındadır ve böylece genomik DNA'dan güçlendirilemeyecek kadar büyüktür. Bu nedenle, yaklaşık 1 kb intronic bölge ile çevrili her ekson ayrı ayrı yükseltilir ve bu dört parça bir klonlama vektörü monte edilir.
  5. Yükseltilecek parçaları seçin (ekson ± 500 nt intron). Bu bölgelerdeki astarlar belirli dizileri yükseltmeyeceğinden, intron'un yinelenen bir bölgede başlamadığından veya bitmediğinden emin olun. Seçilen bölgeler Şekil 2B'de,dizileri ise Ek Şekil 3'tegösterilmiştir.
    NOT: Genel olarak, büyük yapılar, daha zor klonlama olacaktır. Parçalar ya adım akıllıca monte edilebilir (yani, ekson 9 vektör ile birleştirilir ve bir sonraki adımda ekson 10 tüm ekonlar yerine kadar klonlama yoluyla bu yapıya tanıtıldı), ya da alternatif olarak, tüm parçalar aynı anda monte edilir. Adım adım bir yaklaşım her zaman çalışır ama daha fazla zaman gerektirir. Eşzamanlı montaj her zaman işe yaramaz ve tek tek parçaların genomik DNA'dan ne kadar iyi yükseltileneve yapının genel boyutuna bağlıdır. Bu nedenle genellikle her iki yaklaşımla da aynı anda başlarız.

3. Klonlama için tasarım astarları

  1. Klonlama için astar tasarlamak için bir web aracı(https://nebuilder.neb.com/#!/)kullanın. Örneğin, bu araca 9, 10, 11 ve 12 ve vektör dizisini(Ek Şekil 3)girin.
  2. Vektör dizisi için, ekleme bölgesini son nükleotit olarak ekleyin ve daha sonra parçaları ekleyin. Vektör numaralandırması belirli bir ekleme sitesiyle başlamadığından, vektöre ekleme yeri bulunur ve akış aşağı kısmı yukarı akış sırasının önüne konur. Bu örnekte ekler doğrudan HindIII [AAGCTT] sitesinden sonra başlar ve pcDNA3.1'in PmeI [GTTTAAAC] sitesinden hemen sonra sona erer. Cccgctgatcag gelen dizi ... ccgtaaaaaggccgc pcDNA3.1 sırasına göre pozisyon 1'in önüne yapıştırılır (gttggctggcgtttttcc ...).
  3. Erime noktaları 4 °C'den fazlaysa astarları ayarlayın, çünkü amplifikasyonda çalışmayacaklar. Tasarlanan parçaların ve astar dizilerinin montajı Ek Şekil 4'tegösterilmiştir. Klonlama için astarlar da el ile tasarlanabilir25.

4. PCR ve amplicon algılama

  1. Standart PCR Reaksiyonu: Reaksiyon başına toplam 50 μL hacim için bir reaksiyon karışımı yapın. Aşağıda polimeraz 1 kullanarak bir reaksiyon için reçete:
    10 μL 5x Reaksiyon Tampon
    1 μL 10 mM dNTPs
    2,5 μL 10 μM İleri Astar
    2,5 μL 10 μM Ters Astar
    0,5 μL Polimeraz 1
    32.5 μL Nükleaz sızmaz H2O
    1. İsteğe bağlı olarak, ürün yüksek GC içeriğine sahipse 10 μL 5x GC Arttırıcı ekleyin; PCR reaksiyonu test etmek için GC Arttırıcı içeren ayrı bir karışım yapın.
  2. Aliquot 49 μL reaksiyon numunesi başına PCR tüpleriçine karışımı.
  3. PCR'ye 1 μL DNA ekleyin, miktar 10 pg ile 1 ng arasında değişir.
  4. Yanlarındaki kalıntıları çıkarmak ve bir PCR makinesine yerleştirmek için numuneleri aşağı doğru döndürün. PCR koşullarını optimize ederken aynı makineyi ve makinedeki aynı noktaları kullanın.

5. Farklı polimerazların kullanımı için daha uzun DNA parçaları için optimizasyon

  1. Sıcaklık
    1. Uzun menzilli Polimeraz 2'yi optimize edin.
      1. Daha düşük bir denatürasyon sıcaklığı kullanın (Polimeraz 1: 98 °C, Polimeraz 2: 94 °C).
      2. Daha uzun bir denatürasyon süresi kullanın (Polimeraz 1: 10 s, Polimeraz 2: 30 s).
      3. Daha uzun bir tavlama süresi kullanın (Polimeraz 1: 30 s, Polimeraz 2: 60 s).
      4. Daha uzun uzatma süresi kullanın (Polimeraz 1: 30 s/kb, Polimeraz 2: 50 s/kb).
      5. Daha düşük uzatma sıcaklığı kullanın (Polimeraz 1: 72 °C, Polimeraz 2: 65 °C).
      6. Astarların Tm altında 5 °C'lik bir tavlama sıcaklığı kullanın.
    2. Astar konsantrasyonlarını optimize edin (orijinal astar konsantrasyonundan 5 kat daha az. DNA konsantrasyonlarını 10 pg'den 50 pg'ye, 100 pg'ye, 1 ng'den 5 ng'ye, 10 ng'ye optimize edin.
    3. Polimeraz 2 kullanarak 15 kb ürün boyutunu yükseltmek için bir PCR programına örnek olarak, 94 °C'de 30 s için ilk denatürasyon, 30 s için 94 °C'de DNA denatürasyonu ve ardından 58 °C'de 30 s ve DNA uzantısı 65 °C'de 12 dk 30 s. 65 °C'de 10 dk'da son 4 °C'lik bir tutuşla son uzatmayı gerçekleştirin.
      NOT: Her polimeraz için özel web tabanlı sıcaklık hesaplamaları ile belirlenen astarlar için özel tavlama sıcaklığı (Ta). Parçalar 10 kb'den büyükse uzatma süreleri değişebilir ve en iyi duruma getirilmesi gerekebilir.
  2. Uzatma süreleri ve DNA konsantrasyonları
    1. 6 kb'nin üzerindeki DNA parçaları için daha uzun uzatma süreleri kullanın: 1 kb'de 1 dk. Daha uzun parçalar daha az DNA kullanmalıdır.
    2. Amplifikasyon için optimum DNA konsantrasyonunu bulmak için DNA seyreltmegerçekleştirin, genellikle plazmidler için 1 ng'den 1'e veya genomik DNA için 1 ng'den 1'e kadar.
      NOT: Çoğu klonlama için polimeraz 1, Özel bir termokararlı DNA polimeraz26Sso7d DNA bağlayıcı etki birleştirir tarafından tasarlanmış. Polimeraz düşük hata oranına sahiptir ve Sso7d etki alanı nedeniyle büyük (10-15 kb) genomik parçaları yükseltmek için gerekli yüksek bir prosesivite vardır. Bu büyük parça boyutu nedeniyle, DNA moleküllerinin enzimatik montaj27 vektörler içine yerleştirmek için kullanılır, Bu yöntem restriksiyon enzimleri gerektirmez gibi. 15 kb'den uzun parçaların amplifikasyonu polimeraz 1 ile giderek daha zor hale geldi. Büyük parça amplifikasyon için kullanılan polimeraz 2 pyrococcusyapılmış -sso7d veya uzun menzilli PCR kiti erimiş redaksiyon polimeraz gibi, ancak, daha yüksek hata oranları verir.

6. Klonlama için PCR ürünlerinin saflaştırılması

  1. PCR ürünlerinin yarısını % 1 agarose jeller üzerinde intercalating nükleik asit lekesi (örneğin, 1x GelGreen) içeren çalıştırın. Koyu bir okuyucu transilluminator üzerinde lekeli jeller görselleştirin. Bu lekeli DNA boyutuna göre çalışmaz.
    NOT: GelGreen DNA içine intercalates, ethidyum bromür benzer, ama ışık tarafından heyecanlı etrafında 500 nm (siyan), DNA zarar vermez bir dalga boyu, hangi son derece klonlama geliştirir.
  2. Buna paralel olarak, PCR ürünlerinin yarısını ethidyum bromür le lekelenmiş %1'lik bir jel üzerinde çalıştırın (Şekil 3A,B).
  3. Lekeli jel (adım 6.1) doğru boyutta tüketim bantları ve bir jel ve PCR temizleme kiti kullanarak DNA izole. Standart protokolünden sapmada, DNA konsantrasyonları genellikle düşük olduğu için, sadece 20 μL çift distile su da DNA'yı eleyin.
  4. Klonlamadan önce, bir agarose jel üzerinde izole EDILMIŞ DNA'yı konsantrasyon ve bütünlük için kontroledin( Şekil 3B). Vektör oranına 2:1 molar kesici uç hedefleyin. Birkaç kesici uç kullanırken, oran 2:2:2:1'dir.

7. DNA montajı ve klon tespiti

NOT: Klonlama, küçük değişikliklerle enzimatik BIR DNA montaj kiti kullanılarak yapılır. Montaj 50 °C'de 60 dk boyunca yapılır ve genellikle montaj için daha düşük DNA aralığı kullanılır (20-100 fmol/20 μL reaksiyon). Tüm reaksiyon karışımı kimyasal yetkili hücrelere eklenir ve tüm hücreler 6 cm'lik bir agar plaka üzerine kaplanır.

  1. Vektörü birleştirin ve 10 μL suda 1:2 molar oranı (her biri 20-500 fmol) ekleyin.
  2. 10 μL DNA Montaj Master Mix ekleyin.
  3. 50 °C'de 60 dakika kuluçka yada numuneler.
  4. Ardından, toplam montaj reaksiyonu ile yetkili hücreleri dönüştürün. Burada, daha kısa yapılar için E. coli strain 1 hücreleri veya daha uzun veya kararsız yapılar için E. coli strain 2 hücreleri kullanın. Hücreler 50 μL hacimde olmalıdır.
  5. Buz üzerindeki hücreleri eritin ve soğutulmuş monte ürünün 2 μL'sini yetkili hücrelere ekleyin. Tüpü 4-5 kez hafifçe hareket ettirerek karıştırın. Girdap etmeyin.
  6. Karışımı 30 dakika buz üzerinde oturup sağlar.
  7. 42 °C'de 30 s. için ısı şoku. Karıştırmayın.
  8. Tüpü 2 dakika boyunca buza geri aktarın.
  9. Tüpe 950 μL oda sıcaklığında SOC Media ekleyin.
  10. Reaksiyon tüpünü 37 °C'de 60 dk. Şiddetle çalkalayın (300 rpm).
  11. 37 °C'de kuluçka sırasında uygun antibiyotik ile sıcak seçim plakaları.
  12. Hücreleri santrifüj (10.000 x g, 30 s) ile peletleyin ve iki seçim plakası üzerinde hücrelerin 1/4 ve 3/4'ü dışarı ve 37 °C'de bir gecede kuluçkaya yatırın.

8. Klonların doğrulanması

  1. Algılama için montaj sitelerine(Şekil 1C)yayılan PCR astarları kullanarak koloni PCR'yi kullanın.
  2. Steril bir kürdan al ve tek bir bakteri kolonisi dokunur.
  3. Bir PCR tüpünün altına koloniye sahip kürdanla dokunun ve ardından kürdanı bir antibiyotik agar plakası üzerinde çizgiyle geçirin, çizgili plakayı 37 °C'de veya hassas yapılar için oda sıcaklığında bir gecede kuluçkaya yatırın.
  4. PCR tüp algılama astariçeren bir PCR karışımı ile koloni ile dokundu bindirme. Bu astar 3(http://bioinfo.ut.ee/primer3-0.4.0/)kullanılarak tasarlanmıştır. Program, montaj bağlantısı boyunca astar seçmek için "[ccc]" işaretlerini kullanarak astar tasarımını tanımlı bir sıra boyunca zorlama seçeneğine sahiptir. Pozitif suşlardan dna izole edilir ve sıralama ile doğrulanır.

9. Muhabir genlerini ifade eden dairesel RNA analizi

  1. Analiz için transfect muhabir genleri ökaryotik hücrelere dönüşür. Burada, yüksek transfeksiyon verimliliği vermek gibi HEK293 hücreleri (ATTC #CRL-1573) kullanın. Maliyetlerden tasarruf etmek için PEI (polietilenin) solüsyonları kullanın.
  2. PEI çözeltisi için, lineer polietileninhidroklorür (PEI) 1 mg/mL suda düşük pH, pH 2 çözünür. NaOH ile pH'ı 7'ye getirin. 0,22 μm filtreli steril filtre ve 4 °C'de saklayabilirsiniz.
  3. Hücreleri altı kuyuya bölün (kuyu başına yaklaşık 150.000 hücre) ve DMEM medyasında bir gecede %10 FBS'de büyümelerine izin verin.
  4. Aliquot 1 μg steril bir tüp içinde muhabir gen ve steril filtre lenmiş 200 μL ekleyin 150 mM NaCl. Girdap ederek DNA ile karıştırın.
  5. Bu karışım ve girdap PEI çözeltisi ekleyin, kısaca tüp altında örnekleri toplamak için santrifüj. PEI'nin 3 μL'si başına 1 μg DNA oranı kullanın.
  6. 10 dakika oda sıcaklığında kuluçka ve sonra doğrudan HEK 293 hücrelerine ekleyin.
  7. 37 °C'de HEK293 hücrelerini inkübün, %5 CO2,bir gecede.
  8. RNA izolasyon kiti ile RT-PCR için RNA'yı yalıtın.

10. Lineer RNA'ları çıkarmak için RNase R tedavisi

  1. RNa içermeyen bir tüpte 10 μg toplam RNA kullanın.
  2. RNA'ya 10 μL 10 x RNase R tampon (0,2 M Tris-HCl (pH 8,0), 1 M KCl, 1 mM MgCl2) ekleyin.
  3. RNA'ya RNa R ekleyin (1 μl = 20U).
  4. RNA'ya 1 μL glikol mavisi ekleyin ve hacmi steril suyla 100°L'ye kadar getirin.
  5. 37 °C'de 30 dk kuluçka dan örnekler.
  6. 1 dakika boyunca 100 μL fenol/kloroform ve girdap ekleyin.
  7. Ayrı aşamalara 1 dk için 21.000 x g santrifüj.
  8. Supernatant (sulu faz) alın ve 1 hacim (kloroform yaklaşık 80 μL) ekleyin.
  9. Girdap için 1 dk, ve sonra ayrı aşamaları için 1 dakika için santrifüj.
  10. Supernatant alın, 1:10 vol KAc ve 2.5 vol etanol ekleyin ve 1-4 h. Santrifüj için -20 °C'de çökelti 4 °C'de tam hızda 30 dakika (21.000 x g). Alt tabakada küçük mavi bir pelet olacak.
  11. Supernatant çıkarın ve% 80 etanol ile yıkayın. Oda sıcaklığında 5 dakika kurutun ve 10 μL suda çözünün.

11. RT-PCR analizi

  1. RT reaksiyonu başına 1 μg RNA kullanın.
  2. Reaksiyon başına 20 μL'lik son toplam hacim için reaksiyon karışımı yapın. Bir reaksiyon için 1 0 mM dNTPs'nin 1 00L'sini, 1 0,1 M Dithiothreitol'u (DTT), 4 μL 5x First-Strand Tampon'u ve 0,5 μL'lik Ters Transkriptaz kullanın.
  3. Aliquot 6.5 μL reaksiyon yeni PCR tüpleri içine karıştırın.
  4. Bir karışımda en fazla 5 astarı karıştırın. Ancak, bazı astarlar PCR'deki diğer astarlarla yanlış eşleşebilir (Şekil 5). Astar dizileri Tablo 2'dedir. Biz rutin olarak gen-spesifik ekson-kavşak astarlar kullanmak ama rasgele hexamers ile astar da mümkündür.
  5. İstenilen RT reaksiyon tüpüne 1 μL 10 μM Ters astar ekleyin.
  6. PCR reaksiyon tüpüne 1 g RNA ekleyin.
  7. Toplam 20 μL hacmine kadar RNase içermeyen H2O ekleyin.
  8. Tüplerin yan tarafındaki kalıntıyı gidermek ve termocycler yerleştirmek için tüpleri aşağı doğru döndürün.
  9. 50 °C'de 50 °C'de RT reaksiyonu 50 dakika çalıştırın.
  10. RT cDNA'yı -20 °C'de saklayın veya PCR reaksiyonuna devam edin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Muhabir genleri dairesel RNA oluşumunu etkileyen düzenleyici faktörlerin belirlenmesine olanak sağlar. Ancak, bu muhabir genler büyük tür ve genellikle DNA yapılarını kararsız hale getiren tekrarlayan elementler içerir. Büyük boyutları nedeniyle, genellikle eksonve daha küçük yan intronic parçalar içeren genomik parçaların yükseltilmesi ile elde edilen intronların bazı kısımlarını silmek gerekir. Bu DNA parçaları enzimatik olarak biraraya getirilerek konstrüksiyon enzimleri olmadan yapılmasına izin verilir.

Mikrotübül ilişkili protein tau (MAPT) oluşturulan dairesel RNA örneği dairesel RNA analiz etmek için minigen yaklaşımının bir uygulama gösterir. Bu örnekte kullanılan tau 9→12 minigene farklı birleştirme faktörleri ile birlikte transfeced ve bu birleştirme faktörlerinin etkisi RT-PCR tarafından tespit edilmiştir(Şekil 6). Farklı trans-etkifaktörler hem dairesel RNA'yı hem de lineer pre-mRNA oluşumunu etkiler. Deney ayrıca dairesel RNA oluşumu için gerekli tüm sıra elemanlarının klonlanmış parçada lokalize olduğunu gösterir.

Figure 1
Şekil 1: Tekniğin genel bakışı. (A) Varsayımsal bir gen gösterilir. Intronlar çizgiler, ekonlar kutular, Alu elemanları daha küçük çizgili kutulardır. Ekson C'den A'ya geri dönüş dairesel bir RNA oluşturur. Bu dairesel RNA'nın yapısı panelde gösterilmiştir (E). (B) Bir muhabir geni oluşturmak için ekseonlar ve çevre intronlar (her iki tarafta en az 500 nt) yükseltilir. Yapılar genellikle insanlarda Alu elementleri olan tekrarlayan elementler içermelidir. Ek bir Alu öğesi sağlamak için ekson A'nın bir öteni ekson ekine eklenmiştir. Genomik parçalar 25 nt'lik yanlarıyla çakışacak. (C) Parçalar bir CMV organizatörü tarafından yönlendirilen bir ifade vektörü içine klonlanır. Başarılı rekombinasyon algılama astarları tarafından algılanır ve sıralama ile doğrulanır. (D) Hücreler bu yapı ile transfeced vardır. (E) Dairesel RNA izole edilmiş ve (F) dairesel RNA özgü astarlar, tercih edilen ekson kavşak astarları kullanılarak yükseltilir. PCR amplifikasyon sırasında, lineer RNA da amplifikatörlü olabilir (G). (G) Dairesel RNA'ları tespit etmek için kullanılan astarların yönü. İleri astar anlamda oryantasyon (yani, RNA ile aynı sıraya sahiptir) ve ters astar antisense oryantasyondadır (yani RNA'nın ters tamamlayıcısıdır). Doğrusal mRNA'lar için RT-PCR'den farklı olarak, ters astarın ileri astarın yukarı sında olduğunu unutmayın. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: Minigen konstrüksiyonu için dizinin seçimi. (A) Ek Şekil 1'de gösterilen diziden sonra tarayıcı ekranı BLAT kullanılarak insan genomik veritabanına karşı çalıştırılır. Literatür ekson numaraları36 gen ekranında gösterilir, bunlar tarayıcı tarafından verilen sayılardan farklıdır.
1. Hizalanmış diziler 'YourSeq' altında gösterilir
2-4. RNA'nın daireselliği nedeniyle BLAT'ın tüm ekzonları doğrusal RNA'da olduğu gibi çizgilerle bağlamadığını unutmayın. Exons 10 ve 11 (2 ve 3'e karşılık gelen) bağlanır, ancak ekson 12 (4'e karşılık gelen) ekson 11'e bağlı değildir.
5. Alu elemanları yinelenen eleman parça gösterilir.
(B) Planlanan yapı ile genomik DNA arasındaki dizi hizalaması.
6. Planlanan yapı BLAT kullanılarak veritabanına karşı çalıştırıldı.
7. Yapıya birkaç Alu elementinin dahil edilmesine dikkat edin. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3: Klonlama dan önceki amficons örneği. (A) Optimize PCR ürünleri 1x GelGreen içeren% 1 agarose jel ayrılmış. Tek tek bantlar enzimatik DNA montajında kullanılacak PCR ürünlerini temsil ediyor. (B) (A)bantları jelden kesilerek saflaştırıldı. Saflaştırılmış PCR ürünleri daha sonra ethidium bromür ile boyanmış bir% 1 agarose jel, ayrılmıştır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 4
Şekil 4: Muhabir genlerinin kısıtlanması analizi. Örnek olarak kullanılan tau 9-12 minigeni majör rekombinasyonları ekarte etmek için konan restriksiyon enzimleri ile kesildi. Lane 1: NcoI beklenen boyutları 735 bp ile kesilmiş, 3345 bp, 6266 bp, XbaI beklenen boyutu 10346 bp ile şerit 2 kesim, HindIII beklenen boyutları 3951 bp, 6395 bp, şerit 4 SmaI beklenen boyutları 1168 bp, 1688 bp, 2708 bp, 4782 bp ile kesilmiş bu rakamın daha büyük bir sürümünü görmek için lütfen buraya tıklayın.

Figure 5
Şekil 5: Astar çoklama ve RNase R tedavisinin dairesel RNA tespitine etkisi. (A) insan beyin dokularından elde edilen A ve B örneklerinden cDNA dairesel RNA astarlar circTau exon12_10 Ters ve circTau exon10_11 İleri ile güçlendirilmiştir. CDNA için ters transkripsiyon lineer ve dairesel tau RNA için astarile yapıldı. Tau dairesel RNA karşılık beklenen bant bir üçgen ile gösterilir. Diğer güçlü gruplar insan genomuyla uyuşmayan objelerdir. (B) Deney aynı PCR koşulları ile tekrarlandı, ancak ters transkripsiyon sadece circTau exon12_10 Ters astar ile yapıldı. Yalnızca beklenen bant çoğaltıldı ve sıralama ile doğrulandı. (C) RNA doğrusal RNA'yı kaldıran RNa R ile tedavi edildi. Dairesel RNA tedaviden sonra tespit edilebilir (solda), doğrusal RNA artık tespit edilebilir bir sinyal vermezise (sağda) Bu figürün daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 6
Şekil 6: Bir circRNA muhabiri geninin analizine örnek. Tau 9→1237 muhabir geninin 1 μg'si 1 μg'lik birleştirme faktörü ile transfeced edildi. RNA 24 saat sonrası transfeksiyon izole edildi ve RT-PCR tarafından analiz edildi. (A) Lineer tau mRNA amplifikasyonu. Eksexon 10'un alternatif birleştirilmesi nedeniyle iki bant gözlenir. Bunların oranı, birleştirme faktörlerinin aşırı ekspresyonuna bağlı olarak değişir38,39. (B) Dairesel 12→10 tau RNA23amplifikasyonu . Tau circRNA ifadesinin bazı birleştirme faktörlerinin, özellikle kinaz clk2 ve SR protein 9G8 gibi cdc2'nin ekspresyonuna olan bağımlılığına dikkat edin. (C) HIPK3'ün dairesel RNA'sı eşit yüklemeyi gösteren pozitif kontrol olarak kullanılmıştır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Tablo 1: Dairesel RNA'ları ifade eden mevcut minigenlerin listesi. Bu dosyayı indirmek için lütfen buraya tıklayınız.

Dairesel HIPK3 Kontrol Astarları
HIPK3 Ters
HIPK3 İleri
TGCTTGGCTCTTTGAGTTTC
TCGGCCAGTCATGTATCAAA
Lineer Astarlar
Tau Exon 12 Ters
Tau Exon 9 İleri
CCCAATCTTCGACTGGACTC
TGTCAAGTCCAAGATCGGCT
Dairesel Astarlar
circTau exon12_10 Ters
circTau exon10_11 İleri
CAGCTTCTTATTAATCTGCACCTTTTTTTT
GAGGCGGCAGTGTGCAA

Tablo 2: Astar listesi.

Supplemental Figure 1
Ek Şekil 1: Tau dairesel RNA test sırası. MAPT çekirgesinden dairesel bir RNA'ya karşılık gelen test sırası. Farklı ekonlar altı çizili, küçük kapaklar ve büyük kapaklar ile gösterilir. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Supplemental Figure 2
Ek Şekil 2: Planlanan minigeni içeren genomik dizi. Ekonlar renkli ve yinelenen öğeler vurgulanır, italik ve kalın. Gri gölgelendirme, astar oluşturmak için kullanılabilecek düşük karmaşıklıkta yan bölgeleri gösterir. Bu dosyayı indirmek için lütfen buraya tıklayınız.

Supplemental Figure 3
Ek Şekil 3: Planlanan muhabir geninin dizileri. Vektör dizisi ve planlanan genomik parçalar gösterilmiştir. Bu dosyayı indirmek için lütfen buraya tıklayınız.

Supplemental Figure 4
Ek Şekil 4: Montaj için astar tasarımı. Ek Şekil 3'teki sıra oluşturucu aracına girildi. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Supplemental Figure 5
Ek Şekil 5: Örnek olarak kullanılan tau 9->12 muhabir geninin sırası. Bu dosyayı indirmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Genel olarak, dairesel RNA'lar düşükboldur 1, bu da onların fonksiyon ve oluşumunun incelenmesini zorlaştırır. Lineer RNA13benzer , muhabir minigenlerin kullanımı dairesel RNA oluşumunu düzenleyen cis ve trans-etkili faktörlerin belirlenmesini sağlar. Böylece, bu yaklaşım daha da endojen genler kullanılarak test edilebilir hipotezler oluşturur.

En kritik adım muhabir genin tasarımıdır. DNA parçalarının enzimatik montajı ("Gibson klonlama"27)bu tasarımı kolaylaştırır, çünkü kısıtlama sitelerinden bağımsız büyük muhabir genlerinin inşasına olanak sağlar.

Arka birleştirme alanları, muhabir gen yapımında dikkate alınması gereken ters tekrarlar ile bir araya getirilir. Tekrarlar genom tarayıcısında 'tekrar parça' olarak açıklamalı ve onları seçerek yönlerini gösterir. Proteinlerin de dairesel RNA ekspresyonu28 için gerekli ikincil bir yapıya geri birleştirme sitelerini zorladığını ve 1-2 kb intronik bölgenin tarafsız bir analizi için araştırılması gerektiğini unutmayın.

Yapılar istikrarını sağlamak için, önemli bir göz bakteriyel suşları türü ve büyüme koşulları. Daha kısa, basit yapılar standart klonlama bakterileri için kullanılır, neredeyse DH5-alfa (huA2 Δ (argF-lacZ)U169 phoA glnV4 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). 6'dan fazla Alu eleman içeren daha uzun parçalar için, Rekombinaz (recA) ve ensonükleaz (endA1) (F' proA+B+ lacIq (lacZ)M15 zzf::Tn10 (TetR) (Ara-leu) 7697 araD1 eksikliği "kararlı" yetkili hücreler kullanılır39 fhuA & lacX74 galK16 galE15 e14- Φ80dlacZ,M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 (mrr-hsdRMS-mcrBC). Düşük dönüşüm sayılarıyla gösterilen rekombinasyon ile ilgili sorunlar ortaya çıkarsa, dönüştürülmüş bakterileri iki plaka üzerine plakalayın ve sırasıyla 30 ºC ve 37 ºC'de büyümelerini sağlar. Minigenlerde çok sayıda tekrarlayan elementin bulunması nedeniyle, 2019 oranlarında plazmid başına yaklaşık 150 dolara satışa sunulan yeni nesil sıralama kullanılarak tam olarak sıralanması gerekmektedir. Örneğin sırası Ek Şekil 5'tegösterilmiştir. Buna ek olarak, konstrüksiyonların yeni büyük hazırlanması için kısıtlama parça uzunluğu polimorfizm analizi rutin olarak gerçekleştirilir. Örneğin, 1-4 kat kesilen sitelerin kullanılması, rekombinasyonları dışlayan karakteristik bir bant deseni yle sonuçlanır (Şekil 4). Enzimler bir agarose jel üzerinde ayrılabilir parçaların karakteristik bir bant deseni vermek seçilmelidir.

Dairesel RNA'lar rt-PCR ile ters leştirme olayıyla örtüşen ekson bağlantı astarları kullanılarak analiz edilir (Şekil 1F). RNA'nın dairesel yapısı nedeniyle, ters (yani antisense) astar, ileri (yani anlamda) astarın yukarısındadır (Şekil 1G). Bol ifade homeodomain-etkileşen protein kinaz 3 (HIPK3) dairesel RNA1 pozitif kontrol olarak kullanılır. HIPK3 ve minigene spesifik ters astarlar aynı tüpe ters olarak transkripsiyonu yla karşılaştırılır, bu da karşılaştırmalarını sağlar. PCR reaksiyonları, dairesel ve lineer pre-mRNA'ların işleme desenlerini karşılaştırmak için lineer mRNA'ları yükselten astarlarla gerçekleştirilir. Lineer ve dairesel RNA'ların astarlarının karıştırılmasında(Şekil 5)anormal bantları sık sık gözlemledik ve böylece bu örneklerin ters transkripsiyonlarını ayrı tutabildik.

Dairesel RNA'ların RT-PCR analizi zordur ve dikkatle kontrol edilmesi gerekmektedir. Hassas ve kullanışlı olsa da, daireselRNA'lar 29'aözgü eserler üretebilir. Ters transkriptaz rna daire etrafında birkaç kez hareket edebilir, hangi concatemers oluşturur. En dairesel RNA muhabiri genler dairesel ve doğrusal RNA oluşturmak, hangi çapraz melezleşebiliyor, daha PCR eserler yolaçan 21,30,31. Bu nedenle PCR ürünlerini sıralamak ve Kuzey lekeleri32 veya RNase korumaları23kullanarak farklı teknikler kullanarak bulguları doğrulamak zorunludur.

Açıklanamayan bantlar da lineer RNA anormal amplifikasyon kaynaklanabilir. Lineer RNA, daireselRNA'ları zengine veren ekonükleaz RNase R kullanılarak çıkarılabilir 33 (Şekil 5C). RNase R tedavisi algılama astarlarının ilk optimizasyonuna yardımcı olur ve astarlar optimize edildikten sonra genellikle atlanabilir.

Birden fazla dairesel RNA'lar genomik lokus34'tenoluşabileceğinden, alternatif geri birleştirme de açıklanamayan bantlara katkıda bulunabilir. Bu alternatif geri birleştirme genellikle ikiden fazla ters tekrar öğesi tarafından oluşturulan rakip pre-mRNA yapıları sonucudur. Buna ek olarak, şifreli back-splice siteleri oluşabilir32,35. Deneysel hedefe bağlı olarak, Alu elementleri tekrarlanabilir veya yapılara eklenebilir. Arka birleştirme alanlarını çevreleyen tamamlayıcı bölgeler 30-40 nt35 kadar kısa olabilir ve Alu elemanlarının daha kısa tamamlayıcı bölgelerle değiştirilmesi dairesel RNAoluşumunuartırabilir 2 , dairesel RNA oluşumunu iyileştirmek için test edilebilir. Geri birleştirme lere neden olan pre-mRNA dizileri tanımlandıktan sonra, bazı durumlarda transfeksiyon verimliliğini artırabilecek dairesel RNA ifade yapılarını kısaltmak mümkündür.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Açıklayacak bir şey yok.

Acknowledgments

Bu çalışma Savunma Bakanlığı DoD hibe AZ180075 tarafından desteklenmiştir. Stefan Stamm teşekkürler Jacqueline Noonan Vakfı. Anna Pawluchin DAAD, Alman akademik değişim programı tarafından desteklenen, Justin R. Welden University of Kentucky Max Steckler Ödülü'nü aldı.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Dairesel RNA'ları Analiz Etmek Için Minigen İçeren <em>Alu</em> Elementin Kullanımı
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter