Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Gebruik van Alu Element met minigenen om circulaire RNA's te analyseren

doi: 10.3791/59760 Published: March 10, 2020

Summary

We klonen en analyseren reporter genen die circulaire RNA's genereren. Deze reporter genen zijn groter dan constructies om lineaire splicing te analyseren en Alu-elementen bevatten. Om de cirkelvormige RNAs te onderzoeken, worden de constructies omgezet in cellen en wordt resulterend RNA geanalyseerd met behulp van RT-PCR na verwijdering van lineair RNA.

Abstract

Naast lineaire mRNAs genereren veel eukaryotische genen circulaire RNA's. De meeste circulaire RNAs worden gegenereerd door lid te worden van een 5 'splice site met een upstream 3 ' splice site binnen een pre-mRNA, een proces genaamd back-splicing. Deze circularisatie wordt waarschijnlijk geholpen door secundaire structuren in het pre-mRNA die de splice sites in de nabijheid brengen. In menselijke genen wordt gedacht dat Alu-elementen deze secundaire RNA-structuren bevorderen, omdat Alu-elementen overvloedig aanwezig zijn en basiscomplementariteiten met elkaar vertonen wanneer ze in tegengestelde richtingen aanwezig zijn in het pre-mRNA. Hier beschrijven we de generatie en analyse van grote, Alu-element met reportergenen die cirkelvormige RNA's vormen. Door optimalisatie van kloonprotocollen kunnen reporter genen met een afstandslengte tot 20 kb worden gegenereerd. Hun analyse in co-transfection experimenten maakt het mogelijk de identificatie van regelgevende factoren. Zo kan deze methode identificeren RNA sequenties en cellulaire componenten die betrokken zijn bij cirkelvormige RNA vorming.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Circulaire RNA's
Circulaire RNAs (circRNAs) zijn covalently gesloten enkele gestrande RNAs die worden uitgedrukt in de meeste organismen. Ze worden gegenereerd door zich aan te sluiten bij een downstream 5' splice site naar een upstream 3 ' splice site, een proces genaamd back-splicing (Figuur 1A)1. Sequenties in het pre-mRNA die basis complementair vertonen zo kort als 30-40 nt brengen back-splice sites in de juiste uitlijning voor circRNA vorming2. Bij de mens vormen Alu-elementen 1, die ongeveer 11% van het genoom3vertegenwoordigen , uitgebreide dubbelstrengs RNA-structuren in pre-mRNA vanwege hun zelfcomplementariteit4,5 en bevorderen zo de vorming van circRNAs1.

Momenteel zijn drie belangrijke functies van circRNAs beschreven. Sommige circRNAs binden microRNAs (miRNAs) en door sekwestratie fungeren als miRNA sponzen6. CircRNAs zijn betrokken bij transcriptie- en posttranscriptieregeling, door concurrentie met lineaire splicing7 of modulatie van transcriptiefactoractiviteit8. Ten slotte bevatten circRNAs korte open leeskaders en bewijzen van principestudies tonen aan dat ze kunnen worden vertaald9,10. De functie van de meeste circRNAs blijft echter raadselachtig. De meeste circulaire RNA's zijn gedetecteerd met behulp van volgende generatie sequencing methoden11. Gedetailleerde analyses van individuele genen met behulp van gerichte RT-PCR benaderingen blijkt dat een groot aantal circulaire RNAs nog moet worden ontdekt12.

Gebruik van reporter genen om pre-mRNA verwerking te analyseren
De analyse van mRNA afgeleid van DNA reporter construeert transfected in cellen is een gevestigde methode om alternatieve pre-mRNA splicing te bestuderen, die kan worden toegepast op cirkelvormige RNAs. In het algemeen worden de alternatieve exon, de omringende intronen en constitutieve exonen versterkt en gekloond tot een eukaryotische expressievector. Vaak worden de introns ingekort. De constructies worden omgezet in eukaryotische cellen en meestal geanalyseerd door RT-PCR13,14. Deze aanpak is op grote schaal gebruikt om regelgevende splice-sites en trans-acting factoren in co-transfection experimenten13,15,16,17,18in kaart te brengen . Bovendien kon de productie van eiwituitdrukkende minigenen worden gescreend op stoffen die alternatieve splicing19,20veranderen .

De methode is toegepast op circulaire RNA's. Momenteel zijn ten minste 12 minigene backbones beschreven in de literatuur en samengevat in tabel 1. Met uitzondering van het op tRNA gebaseerde expressiesysteem21,22zijn ze allemaal afhankelijk van polymerase II-promotors. Hier beschrijven we een methode om menselijke reporter minigenen te genereren om cis en trans-acting factoren die betrokken zijn bij de generatie van circulaire RNAs te bepalen. Een overzicht van de methode met behulp van sequenties van een gepubliceerd reporter gen23 is te zien in figuur 1.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Ontwerp van de constructies

  1. Gebruik de UCSC genoombrowser24 om repetitieve elementen te identificeren die nodig zijn voor cirkelvormige RNA-vorming en deze op te nemen in de constructies. Belangrijk is dat primers voor versterking buiten de repetitieve elementen moeten zijn.
  2. Plak de cirkelvormige RNA-sequentie(Supplemental Figuur 1 is een testsequentie) in https://genome.ucsc.edu/cgi-bin/hgBlat?command=start en selecteer het juiste organisme. Verzend de volgorde en ga naar browserweergave, zoom 1,5x uit of naar gelang van het geval (figuur 2A).
    OPMERKING: De zoekvolgorde wordt weergegeven in de bovenste regel(figuur 2A, 1). Afhankelijk van de volgorde van de exonen in het circulaire RNA zal BLAT niet alle exonen met elkaar verbinden. In dit voorbeeld is exon 12 (figuur 2A, 4) niet verbonden met 11 ( figuur2A, 2, 3), omdat exon 12 stroomopwaarts van exon 11 in de cirkelvormige RNA-sequentie(aanvullende figuur 1) is. De repetitieve elementen bevinden zich in het 'herhalingsmasker'-spoor, aangegeven door dozen, waarbij de zwarte naar de grijze kleur de evolutionaire conservering aangeeft(figuur 2A, 5).
  3. Muis over de repetitieve elementen om hun subtype te identificeren in een zwevend venster. De elementen van Alu zijn in de lijn SINE (korte gestrooid kernelement). Gebruik de knop 'standaardtracks' onder het venster om de browser opnieuw in te stellen als er een andere afbeelding is verkregen dan figuur 2.
    OPMERKING: Mousing over de exonen in het gendisplay genereert een venster met exonnummers die computer gegenereerd zijn. Deze aantallen komen niet overeen met de exonnummering die in de literatuur wordt gevestigd en veranderen ook tussen isoforms.

2. Selecteer de volgorde die moet worden gekloond in een expressievector

  1. Download de DNA-sequentie in het venster door naar View → DNA op de bovenste lijn van de UCSC genoom browser. Selecteer in de optie Sequencing-opmaakde optie Extended Case/Color.
  2. Selecteer de standaardaanvraag als Lager en selecteer de schakelaanvraag voor NCBI refseq. Selecteer onderstrepen en vet en cursief voor Herhaalmasker. Klik op Verzenden. Er zullen exons als hoofdletters en introns als kleine letters. Controleer de exon/intron grenzen.
  3. In dit voorbeeld is er een 'ccctttacCTTTTT'-reeks, wat aangeeft dat de browser de omgekeerde aanvulling weergeeft. Als dit het geval is, ga dan terug en selecteer de omgekeerde complementbox totdat u de juiste exon intron-randen (agEXONgt) ziet, in dit voorbeeld AAAAAGgtaaaggg.
  4. Kopieer het bestand met de juiste oriëntatie (interne exons worden omringd door intronic ag... gt) in een tekstverwerkingsdocument en markeer de exonen (Aanvullende figuur 2).
    OPMERKING: In dit voorbeeld is het genomische fragment dat exons 9-12 omvat ongeveer 24 kb en dus te groot om te worden versterkt uit genomisch DNA. Daarom wordt elke exon omgeven door ongeveer 1 kb intronic regio individueel versterkt en deze vier fragmenten worden geassembleerd in een kloonvector.
  5. Selecteer fragmenten die moeten worden versterkt (exon ± 500 nt intron). Zorg ervoor dat de intron niet begint of eindigt in een repetitieve regio, omdat primers in deze regio's specifieke sequenties niet versterken. De geselecteerde regio's worden weergegeven in figuur 2Ben de sequenties daarvan worden weergegeven in supplementaal figuur 3.
    OPMERKING: Hoe groter de constructies, hoe moeilijker het klonen zal zijn. De fragmenten kunnen stapgewijs worden geassembleerd (d.w.z. exon 9 wordt gecombineerd met de vector en in de volgende stap exon 10 wordt in deze constructie via klonen geïntroduceerd totdat alle exons op hun plaats zijn), of als alternatief worden alle fragmenten gelijktijdig geassembleerd. Een stapsgewijze aanpak werkt altijd, maar vergt meer tijd. Een gelijktijdige montage werkt niet altijd en hangt af van hoe goed de afzonderlijke fragmenten kunnen worden versterkt uit genomisch DNA en van de totale grootte van de constructie. We beginnen daarom meestal met beide benaderingen tegelijk.

3. Ontwerpprimers voor klonen

  1. Gebruik een webtool(https://nebuilder.neb.com/#!/)om de primers te ontwerpen voor klonen. Voer bijvoorbeeld fragmenten 9, 10, 11 en 12 en de vectorreeks(Aanvullende figuur 3)in dit gereedschap in.
  2. Voor de vectorreeks voegt u de invoegplaats toe als de laatste nucleotide en voegt u vervolgens de fragmenten toe. Aangezien de vectornummering niet begint met een bepaalde invoegplaats, bevindt zich de plaats van invoeging in de vector en wordt het downstream-gedeelte voor de upstream-reeks geplaatst. In dit voorbeeld starten de inserts direct na de HindIII [AAGCTT] site en eindigt direct na de PmeI [GTTTAAAC] site van pcDNA3.1. De volgorde van cccgctgatcag ... ccgtaaaaaggccgc wordt geplakt voor positie 1 in de pcDNA3.1-reeks (gttgctggcgttttttcc ...).
  3. Pas primers aan als hun smeltpunten meer dan 4 °C uit elkaar liggen, omdat ze niet werken bij versterking. De assemblage van de ontworpen fragmenten en primersequenties wordt weergegeven in aanvullende figuur 4. Primers voor klonen kunnen ook handmatig worden ontworpen25.

4. PCR- en amplicondetectie

  1. Standaard PCR-reactie: Maak een reactiemix voor het totale volume van 50 μL per reactie. Hieronder is het recept voor een reactie met behulp van polymerase 1:
    10 μL 5x Reactiebuffer
    1 μL van 10 mM dNTP's
    2,5 μL van 10 μM Forward Primer
    2,5 μL van 10 μM Reverse Primer
    0,5 μL polymerase 1
    32,5 μL Nuclease gratis H2O
    1. Voeg eventueel 10 μL 5x GC Enhancer toe als het product een hoog GC-gehalte heeft; maak een aparte mix met GC Enhancer om pcr-reactie te testen.
  2. Aliquot 49 μL van de mix in PCR buizen per reactie monster.
  3. Voeg 1 μL DNA toe aan de PCR, de hoeveelheid varieert van 10 pg tot 1 ng.
  4. Draai de monsters om residu te verwijderen van de zijkanten en plaats ze in een PCR machine. Gebruik dezelfde machine en dezelfde plekken in de machine bij het optimaliseren van de PCR-omstandigheden.

5. Optimalisatie voor langere DNA-fragmenten voor gebruik van verschillende polymeren

  1. Temperatuur
    1. Optimaliseer de polymerase 2 over lange afstand.
      1. Gebruik een lagere denaturatietemperatuur (Polymerase 1: 98 °C, Polymerase 2: 94 °C).
      2. Gebruik een langere denaturatietijd (Polymerase 1: 10 s, Polymerase 2: 30 s).
      3. Gebruik een langere annealing tijd (Polymerase 1: 30 s, Polymerase 2: 60 s).
      4. Gebruik een langere verlengtijd (Polymerase 1: 30 s/kb, Polymerase 2: 50 s/kb).
      5. Gebruik een lagere verlengtemperatuur (Polymerase 1: 72 °C, Polymerase 2: 65 °C).
      6. Gebruik een annealing temperatuur 5 °C onder de Tm van de primers.
    2. Optimaliseer de primerconcentraties (5x minder tot 5x meer dan de oorspronkelijke primerconcentratie). Optimaliseer DNA-concentraties van 10 pg tot 50 pg, 100 pg, 1 ng, 5 ng, 10 ng.
    3. Als voorbeeld van een PCR-programma om een productgrootte van 15 kb te versterken met polymerase 2, een eerste denaturatie uit te voeren bij 94 °C voor 30 s, DNA-denaturatie bij 94 °C voor 30 s, gevolgd door annealing bij 58 °C voor 30 s en DNA-uitbreiding bij 65 °C gedurende 12 min 30 s. Voer een laatste verlenging uit bij 65 °C gedurende 10 min met een laatste 4 °C hold.
      OPMERKING: De annealing temperatuur (Ta) specifiek voor de primers bepaald door web-based temperatuur berekeningen die specifiek zijn voor elke polymerase. De uitbreidingstijden kunnen variëren en moeten worden geoptimaliseerd als fragmenten groter zijn dan 10 kb.
  2. Verlengingstijden en DNA-concentraties
    1. Gebruik langere verlengtijden voor DNA-fragmenten van meer dan 6 kb: 1 min per 1 kb. Langere fragmenten moeten minder DNA gebruiken.
    2. Voer verdunningen van DNA uit om de optimale DNA-concentratie voor versterking te vinden, meestal 1 pg tot 1 ng voor plasmiden of 1 ng tot 1 μg voor genomisch DNA.
      OPMERKING: Voor de meeste klonen gebruik polymerase 1, ontworpen door het sso7d DNA binding domein te smelten aan een eigen thermostabiele DNA polymerase26. De polymerase heeft een laag foutenpercentage en door het Sso7d-domein een hoge procesiviteit, die nodig is om grote (10-15 kb) genomische fragmenten te versterken. Vanwege deze grote fragmentgrootte wordt enzymatische assemblage van DNA-moleculen27 gebruikt voor het inbrengen in vectoren, omdat deze methode geen beperkingsenzymen vereist. De versterking van fragmenten langer dan 15 kb wordt steeds moeilijker met polymerase 1. Voor grote fragment versterking gebruik polymerase 2 gemaakt van pyrococcus-zoalsproeflezen polymerase gesmolten om Sso7d of de lange afstand PCR kit die geeft, echter, hogere foutenpercentages.

6. Zuivering van PCR-producten voor klonen

  1. Voer de helft van de PCR-producten uit op 1% agarosegels met een intercalating nucleïnezuurvlek (bijvoorbeeld 1x GelGreen). Visualiseer de bevlekte gels op een donkere lezer transilluminator. Dit gekleurde DNA loopt niet trouw aan grootte.
    OPMERKING: GelGreen intercalates in DNA, vergelijkbaar met ethidium bromide, maar het is opgewonden door licht rond 500 nm (cyaan), een golflengte die geen schade toebrengt aan DNA, die het klonen sterk verbetert.
  2. Tegelijkertijd, lopen de helft van de PCR-producten op een 1% gel die is gekleurd na de run met ethidium bromide (Figuur 3A,B).
  3. Accijnsbanden van de juiste grootte van de gekleurde gel (stap 6.1) en isoleren DNA met behulp van een gel en PCR cleanup kit. In afwijking van het standaardprotocol, elute het DNA in slechts 20 μL van dubbel gedestilleerd water, zoals gewoonlijk de DNA-concentraties laag zijn.
  4. Controleer vóór het klonen het geïsoleerde DNA op een agarosegel op concentratie en integriteit (figuur 3B). Streef naar een 2:1 molaire invoegtoepassing tot vectorverhouding. Bij het gebruik van meerdere wisselplaten is de verhouding 2:2:2:1.

7. DNA-assemblage en kloondetectie

LET OP: Klonen gebeurt met behulp van een enzymatische DNA-assemblagekit, met kleine aanpassingen. De assemblage wordt uitgevoerd voor 60 min bij 50 °C en over het algemeen wordt het lagere bereik van DNA gebruikt voor assemblage (20-100 fmol/20 μL reactie). De hele reactiemix wordt toegevoegd aan chemische competente cellen en de hele cellen verguld op een 6 cm agar plaat.

  1. Combineer de vector en voeg in een verhouding van 1:2 kies (elk 20-500 fmol) in 10 μL water.
  2. Voeg 10 μL DNA Assembly Master Mix toe.
  3. Incubeer monsters gedurende 60 minuten bij 50 °C.
  4. Transformeer vervolgens competente cellen met de totale montagereactie. Gebruik hier E. coli stam 1 cellen voor kortere constructies of E. coli stam 2 cellen voor langere of onstabiele constructies. Cellen moeten in een volume van 50 μL zitten.
  5. Ontdooi cellen op ijs en voeg 2 μL van het gekoelde geassembleerde product toe aan de bevoegde cellen. Meng door de buis 4-5 keer zachtjes te vegen. Draai niet vortex.
  6. Laat het mengsel 30 min op ijs zitten.
  7. Hitteschok bij 42 °C gedurende 30 s. Niet mengen.
  8. Breng de buis terug naar ijs voor 2 min.
  9. Voeg 950 μL soc media op kamertemperatuur toe aan de buis.
  10. Incubeer de reactiebuis bij 37 °C gedurende 60 min. Schud krachtig (300 tpm).
  11. Warme selectieplaten met het juiste antibioticum tijdens de incubatie bij 37 °C.
  12. Pellet de cellen door middel van centrifugatie (10.000 x g, 30 s) en plaat uit 1/4 en 3/4 van cellen op twee selectieplaten en uitbroeden bij 37 °C 's nachts.

8. Validatie van klonen

  1. Gebruik kolonie PCR, met PCR-primers verspreid over de assemblagesites(figuur 1C)voor detectie.
  2. Neem een steriele tandenstoker en raak een enkele bacteriële kolonie aan.
  3. Raak de bodem van een PCR-buis aan met de tandenstoker die de kolonie heeft en trek vervolgens de tandenstoker op een antibioticum agarplaat, uitbroed de gestreepte plaat bij 37 °C of kamertemperatuur voor gevoelige constructies 's nachts.
  4. Overlay de PCR buis aangeraakt met de kolonie met een PCR mix met de detectie primers. Deze zijn ontworpen met primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/). Het programma heeft de mogelijkheid om primer ontwerp kracht over een gedefinieerde volgorde met behulp van de "[ccc]" borden om primers te selecteren over de assemblage knooppunt. DNA van positieve stammen wordt geïsoleerd en geverifieerd door sequencing.

9. Analyse van circulair RNA dat reporter genen uitdrukt

  1. Voor analyse, transfect reporter genen in eukaryotische cellen. Gebruik HIER HEK293 cellen (ATTC #CRL-1573) omdat ze een hoge transfection-efficiëntie geven. Gebruik PEI-oplossingen (polyethyleenimine) om kosten te besparen.
  2. Los voor de PEI-oplossing lineair polyethyleenhydrochloride (PEI) op bij 1 mg/mL in water bij lage pH, pH 2. Breng de pH naar 7 met NaOH. Steriel filter met 0,22 μm filters en op te slaan bij 4 °C.
  3. Splits cellen op in zes putten (ongeveer 150.000 cellen per put) en laat ze 's nachts groeien in 10% FBS in DMEM-media.
  4. Aliquot 1 μg van het reporter gen in een steriele buis en voeg 200 μL steriele gefilterde 150 mM NaCl toe. Meng met het DNA door vortexing.
  5. Voeg PEI-oplossing toe aan deze mix en vortex, kort centrifugeeren om monsters te verzamelen onder aan de buis. Gebruik een verhouding van 1 μg DNA per 3 μL PEI.
  6. Incubeer bij kamertemperatuur gedurende 10 minuten en voeg dan direct toe aan HEK 293 cellen.
  7. Incubeer HEK293 cellen bij 37 °C, 5% CO2, 's nachts.
  8. Isoleer RNA voor RT-PCR via een RNA isolatiekit.

10. RNase R-behandeling om lineaire RNA's te verwijderen

  1. Gebruik 10 μg totaal RNA in een RNase-vrije buis.
  2. Voeg 10 μL 10x RNase R buffer (0,2 M Tris-HCl (pH 8.0), 1 M KCl, 1 mM MgCl2) toe aan RNA.
  3. Voeg RNase R toe aan RNA (1 μl = 20U).
  4. Voeg 1 μL glycolblauw toe aan het RNA en breng het volume op tot 100 μL met steriel water.
  5. Incubeer monsters bij 37 °C gedurende 30 min.
  6. Voeg 100 μL fenol/chloroform en vortex toe gedurende 1 min.
  7. Centrifugeer bij 21.000 x g voor 1 min tot afzonderlijke fasen.
  8. Neem de supernatant (waterige fase) en voeg 1 volume toe (ongeveer 80 μL chloroform).
  9. Vortex gedurende 1 min, en dan centrifugeeren voor 1 min om fasen te scheiden.
  10. Neem supernatant, voeg 1:10 vol KAc en 2,5 vol ethanol toe en neerslaan bij -20 °C voor 1-4 uur. Centrifuge bij 4 °C gedurende 30 min op volle snelheid (21.000 x g). Er zal een kleine blauwe pellet aan de onderkant.
  11. Verwijder de supernatant, en wassen met 80% ethanol. Laat de lucht 5 min drogen bij kamertemperatuur en los op in 10 μL water.

11. RT-PCR-analyse

  1. Gebruik 1 μg RNA per RT-reactie.
  2. Maak de reactiemix voor een eindtotaal volume van 20 μL per reactie. Gebruik voor één reactie 1 μL van 10 mM dNTP's, 1 μL van 0,1 M Dithiothreitol (DTT), 4 μL van 5x First-Strand Buffer en 0,5 μL Reverse Transcriptase.
  3. Aliquot 6.5 μL van reactie mix in nieuwe PCR buizen.
  4. Meng tot 5 primers in één mix. Sommige primers kunnen echter verkeerd koppelen aan andere primers in de PCR(figuur 5). Primer sequenties zijn in tabel 2. We gebruiken routinematig genspecifieke exon-junction primers, maar priming met willekeurige hexameren is ook mogelijk.
  5. Voeg 1 μL van 10 μM Reverse primer toe aan de gewenste RT-reactiebuis.
  6. Voeg 1 μg RNA toe aan pcr-reactiebuis.
  7. Voeg RNase-vrije H2O toe tot een totaal volume van 20 μL.
  8. Draai buizen naar beneden om residu te verwijderen aan de zijkant van buizen en plaats in thermocycler.
  9. Voer de RT-reactie in thermocycler 50 minuten in thermocycler uit op 50 °C.
  10. Sla RT cDNA op -20 °C of ga over tot de PCR-reactie.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reporter genen maken bepaling van regelgevende factoren die van invloed zijn op circulaire RNA vorming. Echter, deze reporter genen zijn groot en bevatten repetitieve elementen die vaak DNA-constructies instabiel. Vanwege hun grote omvang is het vaak noodzakelijk om delen van de introns te verwijderen, wat wordt bereikt door het versterken van genomische stukken met de exonen en kleinere flankerende intronic-delen. Deze DNA-stukken zijn enzymatisch geassembleerd, waardoor de bouw zonder beperking enzymen.

Het voorbeeld van een circulair RNA gegenereerd uit de microtubule geassocieerdeiwit tau (MAPT) toont een toepassing van de minigene benadering om circulaire RNAs te analyseren. Het tau 9→12 minigene dat in dit voorbeeld werd gebruikt, werd mede-getransfecteerd met verschillende splicing-factoren en het effect van deze splicing-factoren werd gedetecteerd door RT-PCR (figuur 6). Verschillende trans-acting factoren beïnvloeden zowel circulair RNA als lineaire pre-mRNA vorming. Het experiment toont ook aan dat alle sequentie-elementen die nodig zijn voor cirkelvormige RNA-vorming zijn gelokaliseerd in het gekloonde fragment.

Figure 1
Figuur 1: Overzicht van de techniek. (A) Er wordt een hypothetisch gen getoond. Introns zijn lijnen, exonen zijn dozen, Alu elementen zijn kleinere gestreepte dozen. Backsplicing van exon C tot A creëert een cirkelvormig RNA. De structuur van dit cirkelvormige RNA wordt weergegeven in paneel (E). (B) Om een reporter gen te creëren, exonen en omliggende introns (ten minste 500 nt aan elke kant) worden versterkt. De constructies moeten repetitieve elementen bevatten, die meestal Alu-elementen bij de mens zijn. Een exon stroomopwaarts van exon A werd opgenomen om een extra Alu-element te bieden. De genomische fragmenten overlappen elkaar met hun flankerende 25 nts. (C) Fragmenten worden gekloond tot een expressievector, aangedreven door een CMV-promotor. De succesvolle recombinatie wordt gedetecteerd door detectie primers en gevalideerd door sequencing. (D) Cellen worden transfected met deze constructie. (E) Circulair RNA is geïsoleerd en (F) versterkt met behulp van cirkelvormige RNA specifieke primers, bij voorkeur exon junction primers. Tijdens PCR-versterking kan lineair RNA ook worden versterkt(G). (G) Oriëntatie van de primers die worden gebruikt om cirkelvormige RNA's te detecteren. De voorwaartse primer is in betekenisrichtlijn (d.w.z., heeft de zelfde opeenvolging zoals RNA) en de omgekeerde inleiding is in antisense richtlijn (d.w.z., is de omgekeerde aanvulling van RNA). Merk op dat anders dan RT-PCR voor lineaire mRNAs, de omgekeerde primer is stroomopwaarts van de voorwaartse primer. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: Selectie van de sequentie voor minigene constructie. (A) Browser display na de volgorde weergegeven in aanvullende figuur 1 wordt uitgevoerd tegen de menselijke genomische database met behulp van BLAT. Literatuur exon nummers36 zijn aangegeven in het gen display, ze zijn anders dan de nummers gegeven door de browser.
1. De uitgelijnde sequenties worden weergegeven onder 'YourSeq'
2-4. Merk op dat door de circulariteit van het RNA BLAT niet alle exonen met lijnen verbindt zoals in lineair RNA. Exons 10 en 11 (overeenkomend met 2 en 3) zijn met elkaar verbonden, maar exon 12 (overeenkomend met 4) is niet verbonden met exon 11.
5. Alu-elementen worden weergegeven in het repetitieve elementspoor.
(B) Sequentieuitlijning tussen de geplande constructie en genomic DNA.
6. De geplande constructie werd uitgevoerd tegen de database met behulp van BLAT.
7. Let op de opname van verschillende Alu-elementen in de constructie. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: Voorbeeld van de amplicons voorafgaand aan het klonen. (A) Geoptimaliseerde PCR producten gescheiden op een 1% agarose gel met 1x GelGreen. De individuele banden vertegenwoordigen de PCR producten die zullen worden gebruikt in enzymatische DNA-assemblage. (B) De banden van (A) werden uit gesneden uit de gel en gezuiverd. De gezuiverde PCR producten werden gescheiden op een 1% agarose gel, die vervolgens werd gekleurd met ethidium bromide. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: Beperkingsanalyse van reportergenen. Tau 9-12 minigene dat als voorbeeld wordt gebruikt werd gesneden met beperkingsenzymen die worden vermeld om belangrijke recombinaties uit te sluiten. Lane 1: cut with NcoI expected sizes 735 bp, 3345 bp, 6266 bp, lane 2 cut with XbaI expected size 10346 bp, lane 3 cut with HindIII expected sizes 3951 bp, 6395 bp, lane 4 cut with SmaI expected sizes 1168 bp, 1688 bp, 2708 bp, 4782 bp. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: Effect van primer multiplexing en RNase R behandeling op circulaire RNA detectie. (A) cDNA uit monsters A en B afgeleid van menselijke hersenweefsels werd versterkt met cirkelvormige RNA primers circTau exon12_10 Reverse en circTau exon10_11 Forward. De omgekeerde transcriptie voor het cDNA werd uitgevoerd met de primers voor lineair en cirkelvormig tau RNA. De verwachte band die overeenkomt met tau circulair RNA wordt getoond door een driehoek. De andere sterke banden zijn artefacten die niet overeenkomen met het menselijk genoom. (B) Het experiment werd herhaald met identieke PCR-omstandigheden, maar de omgekeerde transcriptie werd alleen uitgevoerd met de circTau exon12_10 Reverse primer. Alleen de verwachte band werd versterkt en gevalideerd door middel van sequencing. (C) Het RNA werd behandeld met RNase R dat lineair RNA verwijdert. Het circulaire RNA is detecteerbaar na de behandeling (links), terwijl lineair RNA niet langer een detecteerbaar signaal geeft (rechts) Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 6
Figuur 6: Voorbeeld van een analyse van een circRNA reporter gen. 1 μg van het tau 9→1237 reporter gen werd getransfected met 1 μg splicing factoren aangegeven. RNA werd geïsoleerd 24 h post transfection en geanalyseerd door RT-PCR. (A) Versterking van het lineaire tau mRNA. Als gevolg van alternatieve splicing van exon worden er 10 twee banden waargenomen. Hun verhouding verandert als gevolg van de overexpressie van splicing factoren38,39. (B) Versterking van de circulaire 12→10 tau RNA23. Let op de afhankelijkheid van tau circRNA expressie op expressie van een aantal splicing factoren, met name de cdc2 zoals kinase clk2 en de SR eiwit 9G8. (C) Het circulaire RNA van HIPK3 werd gebruikt als een positieve controle die aangeeft op gelijke belasting. Klik hier om een grotere versie van dit cijfer te bekijken.

Tabel 1: Lijst van huidige minigenen die circulaire RNA's uitdrukken. Klik hier om dit bestand te downloaden.

Ronde HIPK3 Control Primers
HIPK3 Reverse
HIPK3 Vooruit
TGCTTGGCTCTACTTTGAGTTTC
TCGGCCAGTCATATCAAA
Lineaire primers
Tau Exon 12 Reverse
Tau Exon 9 Vooruit
CCCAATCTTCGACTGGACTC
TGTCAAGTCCAAGATCGGCT
Circulaire primers
circTau exon12_10 Reverse
circTau exon10_11 Voorwaarts
CAGCTTCTTATTAATTATCTGCACCTTTTT
GAGGCGGCAGTGCAA

Tabel 2: Lijst van primers.

Supplemental Figure 1
Aanvullende figuur 1: Tau cirkelvormige RNA testsequentie. Testsequentie die overeenkomt met een cirkelvormig RNA uit de MAPT locus. De verschillende exons worden vermeld door onderstreping, small caps en grote caps. Klik hier om een grotere versie van dit cijfer te bekijken.

Supplemental Figure 2
Aanvullende figuur 2: Genomische sequentie met het geplande minigene. Exons worden gemarkeerd in kleur en repetitieve elementen worden onderstreept, cursief en vet. Grijze arcering geeft flankerende gebieden met een lage complexiteit aan die kunnen worden gebruikt om primers te genereren. Klik hier om dit bestand te downloaden.

Supplemental Figure 3
Aanvullend figuur 3: Opeenvolgingen van het geplande reportergen. De vectorsequentie en de geplande genomische fragmenten worden getoond. Klik hier om dit bestand te downloaden.

Supplemental Figure 4
Aanvullende figuur 4: Primers ontwerp voor montage. De reeks van supplementude figuur 3 werd opgenomen in het bouwgereedschap. Klik hier om een grotere versie van dit cijfer te bekijken.

Supplemental Figure 5
Aanvullende figuur 5: Volgorde van het tau 9->12 reporter gen gebruikt als voorbeeld. Klik hier om dit bestand te downloaden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In het algemeen, cirkelvormige RNA's zijn laag overvloedig1, die de studie van hun functie en vorming compliceert. Net als bij lineaire RNAs13,maakt het gebruik van reporter minigenes de identificatie van cis en trans-acting factoren die de vorming van cirkelvormige RNAs reguleren. Deze aanpak genereert dus hypothesen die verder kunnen worden getest met behulp van de endogene genen.

De meest kritische stap is het ontwerp van het reporter gen. De enzymatische assemblage van DNA-fragmenten ("Gibson klonen"27) vergemakkelijkt dit ontwerp, omdat het de bouw van grote reporter genen onafhankelijk van beperking sites mogelijk maakt.

De back-splicing sites worden samengebracht door flankerende omgekeerde herhalingen, waarmee rekening moet worden gehouden bij de bouw van reportergen. De herhalingen worden geannoteerd in de genoombrowser 'repeat track' en het selecteren ervan toont hun oriëntatie. Houd er rekening mee dat eiwitten ook de back-splicing sites kunnen dwingen tot een secundaire structuur die nodig is voor circulaire RNA-expressie28 en dat voor een onbevooroordeelde analyse 1-2 kb flankerende intronic-gebieden moet worden onderzocht.

Om de stabiliteit van de constructies te garanderen, is een belangrijke overweging het type bacteriestammen en hun groeiomstandigheden. Voor kortere, eenvoudige constructies worden standaard klonen bacteriën gebruikt, die vrijwel identiek zijn aan DH5-alpha (huA2 Δ (argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). Voor langere fragmenten, met meer dan 6 Alu-elementen, "stabiele" competente cellen worden gebruikt die een recombinase (recA) en endonuclease (endA1) (F' proA+B+ lacIq ∙(lacZ)M15 zzf::Tn10 (TetR)∙(ara-leu) 7697 araD1 39 fhuA ∙lacX74 galK16 galE15 e14- Φ80dlacZ·M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 ∙(mrr-hsdRMS-mcrBC). Als er problemen optreden met recombinatie, aangegeven door lage transformatietellingen, bekeer de getransformeerde bacteriën op twee platen en laat ze groeien op respectievelijk 30 ºC en 37 ºC. Door de aanwezigheid van tal van repetitieve elementen in de minigenen, moeten ze volledig worden gesequenced met behulp van next generation sequencing, die commercieel beschikbaar is voor ongeveer $ 150 per plasmid bij 2019 tarieven. De volgorde van het voorbeeld wordt weergegeven in aanvullende figuur 5. Bovendien wordt de polymorfismeanalyse van het beperkingsfragment voor nieuwe grotere bereiding van de constructies routinematig uitgevoerd. Het gebruik van sites die 1-4 keer snijden, resulteert bijvoorbeeld in een karakteristiek bandpatroon dat recombinaties uitsluit (figuur 4). Enzymen moeten worden geselecteerd die een karakteristiek bandpatroon van fragmenten geven dat op een agarosegel kan worden gescheiden.

Circulaire RNA's worden geanalyseerd met RT-PCR met behulp van exon junction primers die overlappen met de backsplicing gebeurtenis(Figuur 1F). Door de circulaire aard van het RNA is de omgekeerde (d.w.z. antisense) primer stroomopwaarts van de primer (d.w.z. sense) primer (figuur 1G). Primers detecteren van de overvloedig uitgedrukte homeodomain-interactie eiwit kinase 3 (HIPK3) circulaire RNA1 worden gebruikt als een positieve controle. HIPK3 en minigene specifieke omgekeerde primers zijn omgekeerd getranscribeerd in dezelfde buis, die hun vergelijking mogelijk maakt. PCR-reacties worden uitgevoerd met primers die de lineaire mRNAs versterken om verwerkingspatronen van cirkelvormige en lineaire pre-mRNAs te vergelijken. We hebben vaak afwijkende banden waargenomen wanneer primers voor lineaire en cirkelvormige RNA's werden gemengd(figuur 5), en dus de omgekeerde transcriptie van deze monsters gescheiden houden.

RT-PCR analyse van circulaire RNA's is uitdagend en moet zorgvuldig worden gecontroleerd. Hoewel gevoelig en handig, kan het artefacten produceren die uniek zijn voor ronde RNAs29. De omgekeerde transcriptase kan meerdere keren bewegen rond de RNA-cirkel, die concatemers genereert. De meeste cirkelvormige RNA reporter genen genereren zowel circulair als lineair RNA, dat cross-hybridiseert, wat leidt tot meer PCR artefacten21,30,31. Het is dus absoluut noodzakelijk om de PCR-producten te sequencen en bevindingen te valideren met behulp van verschillende technieken met behulp van Noordelijke blots32 of RNase protectionen23.

Onverklaarbare banden kunnen ook afkomstig zijn van afwijkende versterking van lineair RNA. Lineair RNA kan worden verwijderd met behulp van de exonuclease RNase R, die circulaire RNAs33 (Figuur 5C) verrijkt. RNase R behandeling helpt bij de eerste optimalisatie van detectie primers en kan vaak worden weggelaten zodra primers zijn geoptimaliseerd.

Alternatieve back-splicing kan ook bijdragen aan onverklaarbare banden als meerdere cirkelvormige RNAs kan worden gevormd uit een genomische locus34. Deze alternatieve back-splicing is vaak het resultaat van concurrerende pre-mRNA structuren gevormd door meer dan twee omgekeerde herhaalelementen. Bovendien kunnen cryptische back-splice sites optreden32,35. Afhankelijk van het experimentele doel kunnen Alu-elementen worden herhaald of aan de constructies worden toegevoegd. De complementaire regio's die back-splicing sites flankeren kunnen zo kort zijn als 30-40 nt35 en vervanging van Alu-elementen met kortere complementaire regio's kan leiden tot een toename van de circulaire RNA vorming2, die kan worden getest om de circulaire RNA-vorming te verbeteren. Zodra de pre-mRNA sequenties die back-splicing veroorzaken zijn geïdentificeerd, is het dus mogelijk om cirkelvormige RNA uitdrukken constructies, die transfection efficiëntie in sommige gevallen kan verbeteren verkorten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Niets te onthullen.

Acknowledgments

Dit werk werd ondersteund door het ministerie van Defensie DoD subsidie AZ180075. Stefan Stamm bedankt Jacqueline Noonan Endowment. Anna Pawluchin werd ondersteund door de DAAD, Duitse academische uitwisseling programma, Justin R. Welden was een ontvanger van de Universiteit van Kentucky Max Steckler Award.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Gebruik van <em>Alu</em> Element met minigenen om circulaire RNA's te analyseren
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter