Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

استخدام عنصر Alu الذي يحتوي على جينات صغيرة لتحليل الحمض النووي الريبي الدائري

doi: 10.3791/59760 Published: March 10, 2020

Summary

نحن نسخ وتحليل الجينات مراسل توليد الحمض النووي الريبي دائرية. هذه الجينات المراسل ة أكبر من الإنشاءات لتحليل الربط الخطي وتحتوي على عناصر Alu. للتحقيق في الحمض النووي الريبي الدائري ، يتم نقل المنشئات إلى الخلايا ويتم تحليل الحمض النووي الريبي الناتج باستخدام RT-PCR بعد إزالة الحمض النووي الريبي الخطي.

Abstract

بالإضافة إلى mRNAs الخطية، العديد من الجينات eukaryotic توليد الحمض النووي الريبي دائرية. يتم إنشاء معظم الحمض النووي الريبي الدائري عن طريق الانضمام إلى موقع لصق 5 'مع موقع لصق 3 'المنبع داخل ما قبل مرنا، وهي عملية تسمى الربط الخلفي. ومن المرجح أن يكون هذا التعميم بمساعدة الهياكل الثانوية في فترة ما قبل مرنا التي تجلب مواقع التوصيل إلى مكان قريب. في الجينات البشرية، ويعتقد أن عناصر ألو لتعزيز هذه الهياكل الحمض النووي الريبي الثانوية، وعناصر ألو وفيرة ويحمل التكامل قاعدة مع بعضها البعض عندما تكون موجودة في اتجاهات معاكسة في ما قبل مرنا. هنا، ونحن نصف توليد وتحليل كبير، Alu عنصر يحتوي على الجينات المراسل التي تشكل الحمض النووي الريبي الدائري. من خلال التحسين من بروتوكولات الاستنساخ ، يمكن إنشاء جينات المراسل مع ما يصل إلى 20 كيلوبايت طول الإدراج. ويتيح تحليلها في تجارب التعامَل المشترك تحديد العوامل التنظيمية. وهكذا، يمكن لهذه الطريقة تحديد تسلسل الحمض النووي الريبي والمكونات الخلوية المشاركة في تشكيل الحمض النووي الريبي دائرية.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

الحمض النووي الريبي الدائري
الحمض النووي الريبي الدائري (circRNAs) هي مغلقة بشكل التكافؤ واحد RNAs الذين تقطعت بهم السبل التي يتم التعبير عنها في معظم الكائنات الحية. يتم إنشاؤها من خلال الانضمام إلى موقع لصق المصب 5 'إلى موقع لصق المنبع 3 '، وهي عملية تسمى الربط الخلفي(الشكل 1A)1. متواليات في مرحلة ما قبل مرنا التي تعرض قاعدة تكميلية قصيرة مثل 30-40 NT جلب المواقع مرة أخرى لصق في محاذاة مناسبة لتشكيل circRNA2. في البشر، عناصر ألو 1، تمثل حوالي 11٪ من الجينوم3، تشكل هياكل الحمض النووي الريبي المزدوجة واسعة في مرحلة ما قبل مرنا بسبب تكاملها الذاتي4،5 ، وبالتالي تعزيز تشكيل circRNAs1.

وفي الوقت الراهن، تم وصف ثلاث وظائف رئيسية للوظائف المتعلقة بالنُسُر. بعض circRNAs ربط microRNAs (ميرناس) ومن خلال عزل قانون مثل الإسفنج ميرنا6. وقد تورطت CircRNAs في النسخ وبعد تنظيم النسخ، من خلال المنافسة مع الربط الخطي7 أو تعديل نشاط عامل النسخ8. وأخيرا، circRNAs تحتوي على إطارات القراءة المفتوحة قصيرة وإثبات من حيث المبدأ تظهر الدراسات التي يمكن ترجمتها10. ومع ذلك ، فإن وظيفة معظم circRNAs لا تزال غامضة. تم الكشف عن معظم RNAs دائرية باستخدام الجيل التالي من أساليب التسلسل11. وتكشف التحليلات التفصيلية للجينات الفردية التي تستخدم نُهج RT-PCR المستهدفة أن عدداً كبيراً من الحمض النووي الريبي الدائري لا يزال يتعين اكتشافه12.

استخدام جينات المراسل لتحليل معالجة ما قبل مرنا
تحليل مرنا المستمدة من الحمض النووي المراسل يبني تنتقل العدوى إلى الخلايا هو وسيلة راسخة لدراسة بديل ما قبل مرنا الربط، والتي يمكن تطبيقها على الحمض النووي الريبي دائرية. بشكل عام ، يتم تضخيم الإكسون البديل ، والإنترونالمحيط به ، والطاردين التأسيسيين واستنساخهم في متجه تعبير eukaryotic. في كثير من الأحيان، يتم تقصير الـ introns. يتم نقل الهياكل إلى خلايا eukaryotic وعادة ما يتم تحليلها من قبل RT-PCR13،14. وقد استخدم هذا النهج على نطاق واسع لرسم خريطة مواقع الربط التنظيمية والعوامل العابرة للبالنيابة في تجارب الإرسال المشترك13،15،16،17،18. وبالإضافة إلى ذلك، سمح توليد من البروتين التعبير عن الجينات الصغيرة لفحص المواد التي تغير الربط البديل19،20.

وقد تم تطبيق الأسلوب على الحمض النووي الريبي الدائري. وفي الوقت الراهن، تم وصف ما لا يقل عن 12 عموداً فقرياً صغيراً في الأدبيات وملخصة في الجدول 1. باستثناء نظام التعبير القائم على tRNA21،22، فإنهم يعتمدون جميعًا على مروجي البوليميراز الثاني. هنا ، ونحن نصف طريقة لتوليد minigenes مراسل الإنسان لتحديد رابطة الدول المستقلة والعوامل العابرة للتمثيل المشاركة في توليد الحمض النووي الريبي الدائري. يتم عرض نظرة عامة على الطريقة التي تستخدم متواليات من جين مراسل منشور23 في الشكل 1.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. تصميم الهياكل

  1. استخدم متصفح الجينوم UCSC24 لتحديد العناصر المتكررة اللازمة لتشكيل الحمض النووي الريبي الدائري ودمجها في الإنشاءات. الأهم من ذلك ، يجب أن تكون الالتمهيديات للتضخيم خارج العناصر المتكررة.
  2. لصق تسلسل الحمض النووي الريبي دائرية(الشكل التكميلي 1 هو تسلسل الاختبار) في https://genome.ucsc.edu/cgi-bin/hgBlat?command=start وحدد الكائن الحي الصحيح. إرسال التسلسل والذهاب إلى عرض المتصفح، تصغير 1.5x أو حسب الاقتضاء(الشكل 2A).
    ملاحظة: يظهر تسلسل البحث في السطر العلوي(الشكل 2A, 1). اعتمادا على ترتيب السُبّاة في الحمض النووي الريبي الدائري، لن يربط BLAT جميع السُبّاجين. في هذا المثال، لا يرتبط exon 12(الشكل 2A, 4)إلى 11(الشكل 2A, 2, 3),لأن exon 12 هو المنبع من exon 11 في تسلسل RNA دائرية(الشكل التكميلي 1). العناصر المتكررة هي في المسار 'تكرار قناع'، المشار إليها بواسطة مربعات، حيث الأسود إلى اللون الرمادي يشير إلى الحفظ التطوري(الشكل 2A، 5).
  3. الماوس فوق العناصر المتكررة لتحديد النوع الفرعي الخاص بهم في إطار عائم. عناصر Alu في خط SINE (عنصر نووي قصير يتخلله). استخدم زر "المسارات الافتراضية" أسفل النافذة لإعادة تعيين المستعرض إذا تم الحصول على صورة مختلفة عن الشكل 2.
    ملاحظة: التحوير على الإكسفير في عرض الجينات يولد نافذة مع أرقام الإكسون التي يتم إنشاؤها بواسطة الكمبيوتر. هذه الأرقام لا تتوافق مع ترقيم السّبّاب المنصوص عليه في الأدب وأيضاً تتغير بين أشكال الأيزو.

2. حدد التسلسل الذي سيتم استنساخه في متجه تعبير

  1. تحميل تسلسل الحمض النووي هو مبين في النافذة من خلال الذهاب إلى عرض → الحمض النووي على السطر العلوي من متصفح الجينوم UCSC. في خيار تنسيق التسلسل، حدد خيارات الحالة/الألوان الموسعة.
  2. حدد الحالة الافتراضية كحالة أقل وحدد حالة تبديل لـ NCBI refseq. حدد تسطير، وغامق، ومائل لتكرار الماسك. انقر فوق إرسال. سيكون هناك الرؤوس الانبافية كحروف كبيرة وحروف صغيرة. تحقق من حدود الـ exon/intron.
  3. في هذا المثال هناك تسلسل "ccctttacCTTTTTT" ، مما يشير إلى أن المستعرض يظهر المكمل العكسي. إذا كان هذا هو الحال، العودة وحدد مربع تكملة عكس حتى رؤية الحدود الانترون ية exon الصحيح (agEXONgt)، في هذا المثال AAAAGgtaaggg.
  4. نسخ الملف مع الاتجاه الصحيح (السّبّاق الداخليمحاطون بـ...... gt) في وثيقة معالجة الكلمات وتسليط الضوء على اليرحم(الشكل التكميلي 2).
    ملاحظة: في هذا المثال، يكون جزء الجينوم الذي يشمل الإكسون9-12 حوالي 24 كيلوبايت وبالتالي أكبر من أن يتم تضخيمه من الحمض النووي الجينومي. ولذلك، يتم تضخيم كل exon محاطة حوالي 1 كيلوبايت منطقة intronic بشكل فردي ويتم تجميع هذه الأجزاء الأربعة في متجه الاستنساخ.
  5. حدد الأجزاء التي سيتم تضخيمها (exon ± 500 nt intron). تأكد من أن intron لا يبدأ أو ينتهي في منطقة متكررة ، حيث أن الالتمهيديفين في هذه المناطق لن يضخموا تسلسلات محددة. يتم عرض المناطق المحددة في الشكل 2B، وتظهر تسلسلاتها في الشكل التكميلي 3.
    ملاحظة: بشكل عام، كلما كانت الإنشاءات أكبر، كلما كان الاستنساخ أكثر صعوبة. ويمكن تجميع الشظايا إما خطوة حكيمة (أي أن الإكسون 9 يُجمع مع المتجه وفي الخطوة التالية يُدخل الإكسون 10 في هذا البناء عن طريق الاستنساخ إلى أن يتم وضع جميع الطاردات في مكانها)، أو بدلاً من ذلك، يتم تجميع جميع الشظايا في وقت واحد. نهج تدريجي يعمل دائما ولكن يتطلب المزيد من الوقت. التجميع المتزامن لا يعمل دائمًا ويعتمد على مدى نجاح الأجزاء الفردية من الحمض النووي الجينومي وعلى الحجم الإجمالي للبناء. ولذلك فإننا نبدأ عادة بالنهجين كليهما في وقت واحد.

3- تصميم الكبيات للاستنساخ

  1. استخدام أداة ويب(https://nebuilder.neb.com/#!/)لتصميم الكبيات للاستنساخ. على سبيل المثال، أدخل الأجزاء 9 و10 و11 و12 وتسلسل المتجه(الشكل التكميلي 3)إلى هذه الأداة.
  2. لتسلسل المتجه، إضافة موقع الإدراج كالنيوكليوتيد الأخير ثم إضافة الأجزاء. وبما أن ترقيم المتجه لا يبدأ بموقع إدراج معين، فإن موقع الإدراج في المتجه يقع ويتم وضع الجزء المصب أمام تسلسل المنبع. في هذا المثال تبدأ الإدراجات مباشرة بعد موقع HindIII [AAGCTT] وتنتهي مباشرة بعد موقع PmeI [GTTTAAAC] من pcDNA3.1. التسلسل من cccgctgatcag ... يتم لصق ccgtaaaaggccgc أمام موقف 1 في تسلسل pcDNA3.1 (gttgctggggcgttttcc ...).
  3. ضبط التمهيديات إذا كانت نقاط انصهارها أكثر من 4 درجات مئوية ، لأنها لن تعمل في التضخيم. يتم عرض تجميع الأجزاء وتسلسل التمهيدي المصمم في الشكل التكميلي 4. كما يمكن تصميم الكتيبات للاستنساخ يدويا25.

4- PCR والكشف عن الأمبيريكون

  1. رد فعل PCR القياسي: قم بمزيج تفاعل لإجمالي حجم 50 ميكرولتر لكل رد فعل. وفيما يلي وصفة لرد فعل واحد باستخدام البوليميراز 1:
    10 ميكرولتر من المخزن المؤقت لرد الفعل 5x
    1 ميكرولتر من 10 مبير متر من الـ dNTPs
    2.5 ميكرولتر من 10 ميكرومتر إلى الأمام التمهيدي
    2.5 ميكرولتر من 10 ميكرومتر التمهيدي العكسي
    0.5 ميكرولتر من البوليميراز 1
    32.5 ميكرولتر من Nuclease مجانا H2O
    1. اختيارياً، إضافة 10 ميكرولتر من محسن GC 5x إذا كان المنتج يحتوي على محتوى GC عالية; جعل مزيج منفصل يحتوي على محسن GC لاختبار تفاعل PCR.
  2. Aliquot 49 μL من المزيج في أنابيب PCR لكل عينة رد فعل.
  3. إضافة 1 ميكرولتر من الحمض النووي إلى PCR، وتتراوح الكمية من 10 pg إلى 1 نانوغرام.
  4. تدور أسفل العينات لإزالة بقايا قبالة الجانبين ووضعها في جهاز PCR. استخدم نفس الجهاز وكذلك نفس البقع في الجهاز عند تحسين ظروف PCR.

5. الأمثل لشظايا الحمض النووي أطول لاستخدام البوليمرات المختلفة

  1. درجه الحراره
    1. تحسين البوليميراز طويل المدى 2.
      1. استخدام انخفاض درجة حرارة التسخ (بولميراز 1: 98 درجة مئوية، بوليمرز 2: 94 درجة مئوية).
      2. استخدام فترة أطول التسخ (بولميراز 1: 10 s، بوليمرز 2: 30 s).
      3. استخدام وقت أطول الصلب (بولميراز 1: 30 s، بولميراز 2: 60 s).
      4. استخدام فترة تمديد أطول (بولميراز 1: 30 s/kb، Polymerase 2: 50 s/kb).
      5. استخدام درجة حرارة تمديد أقل (البوليميراز 1: 72 درجة مئوية، بوليمراس 2: 65 درجة مئوية).
      6. استخدام درجة حرارة الصلب 5 درجة مئوية تحت TM من الكبيرز.
    2. تحسين تركيزات التمهيدي (5x أقل إلى 5x أكثر من تركيز التمهيدي الأصلي). تحسين تركيزات الحمض النووي من 10 pg إلى 50 pg، 100 pg، 1 نانوغرام، 5 نانوغرام، 10 نانوغرام.
    3. كمثال على برنامج PCR لتضخيم حجم المنتج 15 كيلوبايت باستخدام Polymerase 2 ، قم بإجراء عملية تهيئة أولية عند 94 درجة مئوية لمدة 30 ثانية ، وتحلل الحمض النووي عند 94 درجة مئوية لمدة 30 ثانية تليها الصلب عند 58 درجة مئوية لمدة 30 ثانية ، وتمديد الحمض النووي عند 65 درجة مئوية لمدة 12 دقيقة 30 ثانية. قم بإجراء التمديد النهائي عند 65 درجة مئوية لمدة 10 دقيقة مع عقد 4 درجات مئوية.
      ملاحظة: درجة حرارة الصلب (Ta) محددة للالتمهيديات التي تحددها حسابات درجة الحرارة المستندة إلى الويب والمحددة لكل بوليميراز. قد تختلف أوقات التمديد وتحتاج إلى تحسين إذا كانت الأجزاء أكبر من 10 كيلوبايت.
  2. أوقات التمديد وتركيزات الحمض النووي
    1. استخدم أوقات تمديد أطول لشظايا الحمض النووي أكثر من 6 كيلوبايت: 1 دقيقة لكل 1 كيلوبايت. يجب أن تستخدم الشظايا الأطول حمضًا نوويًا أقل.
    2. إجراء تخفيفات الحمض النووي للعثور على تركيز الحمض النووي الأمثل للتضخيم، وعادة 1 pg إلى 1 نانوغرام لبلازميدس أو 1 نانوغرام إلى 1 ميكروغرام للحمض النووي الجينومي.
      ملاحظة: بالنسبة لمعظم الاستنساخ استخدام البوليميراز 1، هندسيا عن طريق دمج المجال الحمض النووي Sso7d ملزمة إلى بوليميراز الحمض النووي الحرارية الملكية26. البوليميراز لديه معدل خطأ منخفض وبسبب المجال Sso7d معالجة عالية، اللازمة لتضخيم كبيرة (10-15 كيلوبايت) شظايا الجينوم. بسبب هذا الحجم الكبير للشظية ، يتم استخدام التجميع الأنزيمي لجزيئات الحمض النووي27 للإدخال في ناقلات ، لأن هذه الطريقة لا تتطلب إنزيمات تقييد. تضخيم شظايا أطول من 15 كيلوبايت يحصل على نحو متزايد من الصعب مع البوليميراز 1. لتضخيم جزء كبير استخدام البوليميراز 2 مصنوعة من المكورات الناريةمثل البوليميراز التدقيق المنصهر إلى Sso7d أو مجموعة PCR طويلة المدى التي تعطي، ومع ذلك، معدلات خطأ أعلى.

6- تنقية منتجات الـ PCR لأغراض الاستنساخ

  1. تشغيل نصف منتجات PCR على 1٪ المواد الهلامية agarose التي تحتوي على بقعة حمض النووي intercalating (على سبيل المثال، 1x GelGreen). تصور المواد الهلامية الملونة على قارئ الظلام transilluminator. هذا الحمض النووي الملطخ لا يعمل صحيح الحجم.
    ملاحظة: يتشابك GelGreen في الحمض النووي ، على غرار بروميد الإثيديوم ، ولكنه متحمس بالضوء حوالي 500 نانومتر (سماوي) ، وهو طول موجي لا يضر الحمض النووي ، مما يحسن الاستنساخ بشكل كبير.
  2. بالتوازي، تشغيل نصف منتجات PCR على هلام 1٪ التي هي ملطخة بعد تشغيل مع بروميد إيتهيديوم(الشكل 3A، B).
  3. نطاقات المكوس من الحجم الصحيح من هلام الملون (الخطوة 6.1) وعزل الحمض النووي باستخدام هلام وPCR تنظيف عدة. في الانحراف عن البروتوكول القياسي ، يذيب الحمض النووي في 20 ميكرولتر فقط من الماء المقطر المزدوج ، كما عادة ما تكون تركيزات الحمض النووي منخفضة.
  4. قبل الاستنساخ، تحقق من الحمض النووي المعزول على هلام أغاروز للتأكد من تركيزه وسلامته(الشكل 3B). تهدف إلى إدراج 2:1 الأضراس إلى نسبة ناقلات. عند استخدام عدة إدراجات، تكون النسبة 2:2:2:1.

7. تجميع الحمض النووي والكشف عن استنساخ

ملاحظة: يتم الاستنساخ باستخدام مجموعة تجميع الحمض النووي الأنزيمية، مع تعديلات طفيفة. يتم تنفيذ التجميع لمدة 60 دقيقة عند درجة حرارة 50 درجة مئوية وعادة ما يتم استخدام النطاق السفلي من الحمض النووي للتجميع (تفاعل 20-100 fmol/20 μL). يضاف مزيج التفاعل كله إلى الخلايا الكيميائية المختصة والخلايا كلها مطلي بها على لوحة أغار 6 سم.

  1. الجمع بين ناقلات وإدراج في نسبة 1:2 الأضراس (20-500 fmol لكل منهما) في 10 ميكرولتر من الماء.
  2. إضافة 10 ميكرولتر من الحمض النووي الجمعية الرئيسية ميكس.
  3. احتضان العينات لمدة 60 دقيقة في 50 درجة مئوية.
  4. بعد ذلك، تحويل الخلايا المختصة مع رد فعل مجموع الجمعية. هنا، استخدم E. coli سلالة 1 خلايا ليبني أقصر أو E. القولونية سلالة 2 الخلايا ليبني أطول أو غير مستقرة. يجب أن تكون الخلايا في حجم 50 ميكرولتر.
  5. إذابة الخلايا على الجليد وإضافة 2 ميكرولتر من المنتج المبرد ة المجمعة إلى الخلايا المختصة. مزيج عن طريق النقر بلطف أنبوب 4-5 مرات. لا دوامة.
  6. دع الخليط الجلوس على الجليد لمدة 30 دقيقة.
  7. صدمة الحرارة في 42 درجة مئوية لمدة 30 s. لا تخلط.
  8. نقل أنبوب مرة أخرى إلى الجليد لمدة 2 دقيقة.
  9. أضف 950 ميكرولتر من وسائط SOC درجة حرارة الغرفة إلى الأنبوب.
  10. احتضان أنبوب التفاعل عند 37 درجة مئوية لمدة 60 دقيقة. اهتز بقوة (300 دورة في الدقيقة).
  11. لوحات اختيار دافئة مع المضادات الحيوية المناسبة أثناء الحضانة عند 37 درجة مئوية.
  12. بيليه الخلايا من خلال الطرد المركزي (10،000 × ز، 30 ق) ولوحة من 1/4 و 3/4 من الخلايا على اثنين من لوحات الاختيار واحتضان في 37 درجة مئوية بين عشية وضحاها.

8- التحقق من صحة المستنسخين

  1. استخدام PCR مستعمرة، وتوظيف التمهيديات PCR تمتد مواقع التجميع(الشكل 1C)للكشف.
  2. تناول مسواك معقمة والمس مستعمرة بكتيرية واحدة.
  3. المس الجزء السفلي من أنبوب PCR مع مسواك التي تحتوي على المستعمرة ومن ثم خط مسواك على لوحة أغار المضادات الحيوية، واحتضان لوحة متتالية في 37 درجة مئوية أو درجة حرارة الغرفة للبنى الحساسة بين عشية وضحاها.
  4. تراكب أنبوب PCR لمست مع المستعمرة مع مزيج PCR التي تحتوي على التمهيديات الكشف. تم تصميم هذه باستخدام التمهيدي 3(http://bioinfo.ut.ee/primer3-0.4.0/). البرنامج لديه خيار لفرض تصميم التمهيدي عبر تسلسل محدد باستخدام علامات "[ccc]" لتحديد التمهيديات عبر تقاطع التجميع. يتم عزل الحمض النووي من السلالات الإيجابية والتحقق منه عن طريق التسلسل.

9. تحليل الحمض النووي الريبي الدائري الذي يعبر عن جينات المراسل

  1. للتحليل، والجينات مراسل transfect في الخلايا eukaryotic. هنا، استخدم خلايا HEK293 (ATTC #CRL-1573) لأنها تعطي كفاءة عالية في الترانزفيشن. لتوفير التكاليف، استخدم حلول جزيرة الأمير إدوارد (البولي إيثيلينينين).
  2. بالنسبة لحل جزيرة الأمير إدوارد، قم بإذابة هيدروكلوريد البولي إيثيليني (PEI) الخطي عند 1 ملغم/مل في الماء عند درجة الحموضة المنخفضة، درجة الحموضة 2. رفع درجة الحموضة إلى 7 مع NaOH. مرشح معقم مع مرشحات 0.22 ميكرومتر وتخزينها في 4 درجة مئوية.
  3. تقسيم الخلايا إلى ستة آبار (ما يقرب من 150،000 خلية لكل بئر) والسماح لهم تنمو بين عشية وضحاها في FBS 10٪ في وسائل الإعلام DMEM.
  4. Aliquot 1 ميكروغرام من الجين مراسل في أنبوب معقم وإضافة 200 ميكرولتر من المعقمة تصفية 150 mM NaCl. مزيج مع الحمض النووي عن طريق الدوامة.
  5. إضافة حل جزيرة الأمير إدوارد لهذا المزيج والدوامة، والطرد المركزي لفترة وجيزة لجمع العينات في الجزء السفلي من أنبوب. استخدام نسبة 1 ميكروغرام من الحمض النووي لكل 3 ميكرولتر من جزيرة الأمير إدوارد.
  6. احتضان في درجة حرارة الغرفة لمدة 10 دقيقة ثم تضاف مباشرة إلى خلايا HEK 293.
  7. احتضان HEK293 الخلايا في 37 درجة مئوية، 5٪ COبين عشية وضحاها.
  8. عزل الجيش الملكي النيبالي لRT-PCR عن طريق مجموعة العزل الجيش الملكي النيبالي.

10. RNase R العلاج لإزالة الحمض النووي الريبي الخطي

  1. استخدم 10 ميكروغرام من إجمالي الحمض النووي الريبي في أنبوب خال ٍ من RNase.
  2. إضافة 10 ميكرولتر من 10x RNase R المخزن المؤقت (0.2 M تريس-HCl (درجة الحموضة 8.0)، 1 M KCl، 1 m M MgCl2)إلى RNA.
  3. إضافة RNase R إلى RNA (1 ميكرولتر = 20U).
  4. أضف 1 ميكرولتر من الأزرق الجلايكول إلى الحمض النووي الريبي وارفع الحجم إلى 100 ميكرولتر بالماء المعقم.
  5. عينات احتضان في 37 درجة مئوية لمدة 30 دقيقة.
  6. أضف 100 ميكرولتر من الفينول/الكلوروفورم والدوامة لمدة دقيقة واحدة.
  7. جهاز طرد مركزي عند 21,000 × ز لمدة دقيقة واحدة لمراحل منفصلة.
  8. خذ المرحلة الخارقة (المرحلة المائية) وأضف حجمًا واحدًا (حوالي 80 ميكرولتر من الكلوروفورم).
  9. دوامة لمدة 1 دقيقة، ومن ثم الطرد المركزي لمدة 1 دقيقة لفصل المراحل.
  10. تأخذ supernatant، إضافة 1:10 فول KAc و 2.5 فول الإيثانول، وراسب في -20 درجة مئوية لمدة 1-4 ح. الطرد المركزي في 4 درجة مئوية لمدة 30 دقيقة بأقصى سرعة (21،000 × ز). سيكون هناك بيليه أزرق صغير في الأسفل.
  11. إزالة supernatant، وغسل مع الإيثانول 80٪. السماح للهواء الجاف لمدة 5 دقيقة في درجة حرارة الغرفة، وتذوب في 10 ميكرولتر الماء.

11- تحليل RT-PCR

  1. استخدام 1 ميكروغرام من الحمض النووي الريبي لكل رد فعل RT.
  2. جعل مزيج رد الفعل لحجم إجمالي نهائي من 20 ميكرولتر لكل رد فعل. لتفاعل واحد، استخدم 1 ميكرولتر من 10 ممل dNTPs، 1 μL من 0.1 M Dithiothreitol (DTT)، 4 μL من 5x المخزن المؤقت أول ستراند، و 0.5 μL من النسخة العكسية.
  3. Aliquot 6.5 ميكرولتر من مزيج التفاعل في أنابيب PCR جديدة.
  4. مزيج يصل إلى 5 التمهيديات في مزيج واحد. ومع ذلك ، قد بعض التمهيديات سوء الزوج مع التمهيديات الأخرى في PCR(الشكل 5). تسلسل التمهيدي في الجدول 2. نحن نستخدم بشكل روتيني البدائيات الخاصة بـ exon-junction ولكن البدائيات مع الهيكسايمرات العشوائية ممكنة أيضًا.
  5. أضف 1 ميكرولتر من 10 ميكرومتر التمهيدي العكسي إلى أنبوب التفاعل RT المطلوب.
  6. إضافة 1 ميكروغرام من الحمض النووي الريبي إلى أنبوب تفاعل PCR.
  7. أضف H2O الخالي من RNase إلى حجم إجمالي قدره 20 ميكرولتر.
  8. تدور أنابيب أسفل لإزالة بقايا على جانب من الأنابيب ووضعها في cycler.
  9. تشغيل رد فعل RT في cycler في 50 درجة مئوية لمدة 50 دقيقة.
  10. تخزين RT cDNA في -20 درجة مئوية أو المضي قدما إلى رد فعل PCR.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تسمح جينات المراسل بتحديد العوامل التنظيمية التي تؤثر على تكوين الحمض النووي الريبي الدائري. ومع ذلك ، فإن هذه الجينات المراسلة كبيرة وتحتوي على عناصر متكررة غالباً ما تجعل الحمض النووي غير مستقر. نظرا لحجمها الكبير ، غالبا ما يكون من الضروري حذف أجزاء من الإنترونات ، وهو ما يتحقق عن طريق تضخيم القطع الجينومية التي تحتوي على الإكسون والأجزاء الغير نظامية المحيطة الأصغر. يتم تجميع قطع الحمض النووي هذه بشكل أنزيمي ، مما يسمح بالبناء دون قيود على الإنزيمات.

مثال على الحمض النووي الريبي الدائري المتولد من التنبيب الدقيق للبروتين المرتبط تاو (MAPT) يظهر تطبيق نهج minigene لتحليل الحمض النووي الريبي الدائري. كان الجين المينيجين تاو 9→12 المستخدم في هذا المثال مصابًا بالعدوى مع عوامل الربط المختلفة وتم اكتشاف تأثير هذه العوامل الالربط ية بواسطة RT-PCR(الشكل 6). عوامل مختلفة عبر المفعول تؤثر على كل من الحمض النووي الريبي الدائري وتشكيل ما قبل الحمض النووي الريبي الخطي. وتبين التجربة أيضا أن جميع عناصر التسلسل اللازمة لتكوين الحمض النووي الريبي الدائري مترجمة في الجزء المستنسخة.

Figure 1
الشكل 1: نظرة عامة على هذه التقنية. (أ)يظهر جين افتراضي. الانترونات هي خطوط ، الإكسرون صناديق ، عناصر Alu هي مربعات مخططة أصغر. backsplicing من Exon C إلى A يخلق الجيش الملكي النيبالي دائرية. ويرد هيكل هذا الحمض النووي الريبي دائرية في لوحة(E). (ب)لإنشاء جين مراسل، يتم تضخيم الإصدارات النافرة والإنترونات المحيطة بها (ما لا يقل عن 500 NT على كل جانب). يجب أن تحتوي الهياكل على عناصر متكررة ، والتي عادة ما تكون عناصر Alu في البشر. وأُدرج أحد الطاردين السابقين في المنبع لتوفير عنصر إضافي من عناصر Alu. سوف تتداخل الشظايا الجينومية مع 25 nts المحيطة بها. (C)يتم استنساخ الشظايا في متجه تعبير ، يقودها مروج CMV. يتم الكشف عن إعادة التركيب الناجحة بواسطة التمهيديات الكشف والتحقق من صحتها من قبل التسلسل. (D)يتم نقل الخلايا مع هذا البناء. (E)يتم عزل الحمض النووي الريبي الدائري و(F)تضخيمها باستخدام التمهيديات الخاصة بالحمض النووي الريبي الدائري ، تفضل التمهيديات تقاطع exon. أثناء تضخيم PCR ، يمكن أيضًا تضخيم الحمض النووي الريبي الخطي(G). (G)توجيه الدعارات المستخدمة للكشف عن الحمض النووي الريبي الدائري. التمهيدي إلى الأمام هو في الاتجاه بمعنى (أي، لديه نفس التسلسل كما الجيش الملكي النيبالي) والتمهيدي العكسي هو في اتجاه مضاد للشعور (أي، هو تكملة عكس من الجيش الملكي النيبالي). لاحظ أنه يختلف عن RT-PCR لـ mRNAs الخطية، التمهيدي العكسي هو المنبع من التمهيدي إلى الأمام. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2: اختيار التسلسل لبناء الجين الصغير. (A)عرض المتصفح بعد أن يتم تشغيل التسلسل المبين في الشكل التكميلي 1 ضد قاعدة بيانات الجينوم البشري باستخدام BLAT. يشار إلى أرقام الإكسون الأدب36 في عرض الجينات، فهي مختلفة عن الأرقام التي قدمها المتصفح.
1. يتم عرض التسلسلات المنحازة تحت "YourSeq"
2-4. لاحظ أنه بسبب دائرية الجيش الملكي النيبالي، BLAT لا يربط جميع السبناء مع خطوط كما هو الحال في الجيش الملكي النيبالي الخطي. الإكساب 10 و 11 (المقابلة ل2 و 3) متصلة، ولكن لا يرتبط الإكسون 12 (المقابلة إلى 4) إلى 11 exon.
5. تظهر عناصر Alu في مسار العنصر المتكرر.
(ب)محاذاة التسلسل بين البناء المخطط له والحمض النووي الجينومي.
6- تم تشغيل البناء المخطط له مقابل قاعدة البيانات باستخدام BLAT.
7. لاحظ إدراج العديد من عناصر Alu في البناء. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3: مثال على الأمبلأيقونات قبل الاستنساخ. (A)الأمثل PCR المنتجات فصل على هلام أغاروز 1٪ التي تحتوي على 1x GelGreen. تمثل النطاقات الفردية منتجات PCR التي سيتم استخدامها في تجميع الحمض النووي الأنزيمي. (ب)تم قطع العصابات من (أ) من الجل وتنقيتها. تم فصل منتجات PCR المنقى على هلام أغروز 1٪ ، والذي كان ملطخًا لاحقًا ببروميد الإيتهيديوم. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 4
الشكل 4: تحليل القيود على جينات المراسلين. تم قطع الجين المينيجين تاو 9-12 المستخدمة كمثال مع الانزيمات القيود المشار إليها لاستبعاد إعادة تركيبات رئيسية. حارة 1: قطع مع NcoI الأحجام المتوقعة 735 bp، 3345 bp, 6266 bp, حارة 2 قطع مع XbaI الحجم المتوقع 10346 bp, حارة 3 قطع مع HindIII الأحجام المتوقعة 3951 bp, 6395 bp, حارة 4 قطع مع SmaI الأحجام المتوقعة 1168 bp, 1688 bp, 2708 bp. 4782 bp. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 5
الشكل 5: تأثير التمهيدي multixing وRNase R العلاج على الكشف عن الحمض النووي الريبي دائرية. (أ)تم تضخيم cDNA من العينات A و B المشتقة من أنسجة الدماغ البشري مع التمهيديات الحمض النووي الريبي الدائري ة circTau exon12_10 عكس وcircTau exon10_11 إلى الأمام. تم إجراء النسخ العكسي لـ cDNA مع الدعارات للحمض النووي الريبي تاو الخطي والدائري. يظهر النطاق المتوقع المطابق لـ RNA الدائري تاو بواسطة مثلث. العصابات القوية الأخرى هي القطع الأثرية التي لا تتطابق مع الجينوم البشري. (ب)تكررت التجربة مع ظروف PCR متطابقة، ولكن تم إجراء النسخ العكسي فقط مع exon12_10 التمهيدي العكسي. فقط الفرقة المتوقعة تم تضخيمها والتحقق من صحتها من خلال التسلسل. (C)تم التعامل مع الجيش الملكي النيبالي مع RNase R الذي يزيل الحمض النووي الريبي الخطي. يمكن اكتشاف الحمض النووي الريبي الدائري بعد العلاج (يسار)، في حين أن الحمض النووي الريبي الخطي لم يعد يعطي إشارة يمكن اكتشافها (يمين) الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 6
الشكل 6: مثال على تحليل جين مراسل سيركنا. تم نقل 1 ميكروغرام من جين مراسل تاو 9→1237 مع 1 ميكروغرام من عوامل الربط المشار. تم عزل الحمض النووي الريبي 24 ح نقل بعد وتحليلها من قبل RT-PCR. (أ)تضخيم مرنا تاو الخطية. واجبة إلى الربط بديلة من [إكسونّر10' لاحظت اثنان نطاقات. تتغير نسبتهم بسبب التعبير المفرط لعوامل الربط38،39. (ب)تضخيم التعميم 12→10 تاو RNA23. لاحظ الاعتماد على التعبير circRNA تاو على التعبير عن بعض العوامل الربط، وخاصة cdc2 مثل كيناز clk2 والبروتين SR 9G8. (ج)تم استخدام الحمض النووي الريبي الدائري من HIPK3 كتحكم إيجابي يشير إلى التحميل المتساوي. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

الجدول 1: قائمة الجينات المصغرة الحالية التي تعبر عن الحمض النووي الريبي الدائري. الرجاء الضغط هنا لتحميل هذا الملف.

التعميم HIPK3 التحكم التمهيدي
HIPK3 عكس
HIPK3 إلى الأمام
TGCTGGCTCTACTTGAGTTC
TCGGCCAGTGTATCAA
التمهيديات الخطية
تاو إكسون 12 عكس
تاو إكسون 9 إلى الأمام
CCCAATCTTCGACTGGACTC
TGTCAAGTCCAACGCGGCT
التمهيديات الدائرية
exon12_10 عكس circTau
exon10_11
CAGCTTCTTATTAATATCTACCTTTTT
GAGGCGGGGCAGTGTGCA

الجدول 2: قائمة المبادئ التمهيدية.

Supplemental Figure 1
الشكل التكميلي 1: تاو تسلسل اختبار الحمض النووي الريبي دائرية. تسلسل الاختبار المطابق لـ RNA دائري من موضع MAPT. ويشار إلى الإكسيد مختلفة من قبل تسطير، قبعات صغيرة وقبعات كبيرة. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Supplemental Figure 2
الشكل التكميلي 2: تسلسل الجينوم الذي يحتوي على الجين الصغير المخطط له. يتم تمييز الأكدان في اللون ويتم تسطير العناصر المتكررة ، مائلة وجريئة. يشير التّلّاقّل الرمادي إلى المناطق المُحاطة ذات التعقيد المنخفض التي يمكن استخدامها لتوليد الكبيّات. الرجاء الضغط هنا لتحميل هذا الملف.

Supplemental Figure 3
الشكل التكميلي 3: تسلسل جين المراسل المخطط له. يتم عرض تسلسل المتجه والشظايا الجينومية المخططلها. الرجاء الضغط هنا لتحميل هذا الملف.

Supplemental Figure 4
الشكل التكميلي 4: تصميم الالتمهيديات للتجميع. تم إدخال التسلسل من الشكل التكميلي 3 في أداة البناء. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Supplemental Figure 5
الشكل التكميلي 5: تسلسل جين مراسل تاو 9->12 المستخدم كمثال. الرجاء الضغط هنا لتحميل هذا الملف.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

بشكل عام ، الحمض النووي الريبي الدائري منخفضة وفيرة1، مما يعقد دراسة وظيفتها وتشكيلها. على غرار RNAsالخطية 13، واستخدام minigenes مراسل يسمح لتحديد رابطة الدول المستقلة والعوامل عبر المفعول التي تنظم تشكيل الحمض النووي الريبي الدائري. وهكذا، يولد هذا النهج فرضيات يمكن اختبارها باستخدام الجينات الذاتية.

الخطوة الأكثر أهمية هي تصميم جين المراسل. التجميع الأنزيمي لشظايا الحمض النووي ("غيبسون الاستنساخ"27)يسهل هذا التصميم، كما أنه يسمح بناء جينات المراسل كبيرة مستقلة عن مواقع التقييد.

يتم جمع مواقع الربط الخلفي من خلال تكرار مقلوب يحيط ، والتي ينبغي أن تؤخذ في الاعتبار في بناء الجينات المراسل. يتم مشروح التكرارات في متصفح الجينوم "تكرار المسار" واختيارها يظهر اتجاهها. نضع في اعتبارنا أن البروتينات يمكن أيضا قوة المواقع الخلفية الربط في هيكل ثانوي اللازمة للتعبير الحمض النووي الريبيدائري28 وتحليل غير متحيزة 1-2 كيلوبايت من المناطق intronic الجناح ينبغي التحقيق.

لضمان استقرار البنى ، هناك اعتبار مهم هو نوع السلالات البكتيرية وظروف نموها. لأقصر، وتستخدم بسيطة يبني البكتيريا الاستنساخ القياسية، والتي هي متطابقة تقريبا إلى DH5-ألفا (huA2 Ο (argF-lacZ)U169 phoA glnV44 Ο80 Ο (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). لشظايا أطول، تحتوي على أكثر من 6 عناصر Alu، وتستخدم "مستقرة" الخلايا المختصة التي تفتقر إلى الإعادة الدمج (recA) وendonuclease (endA1) (F' proA+ B + lacIq fhuA -lacX74 galK16 galE15 e14- Ο80dlacZ -M15 recA1 relA1 endA1 nupG rpsL (StrR)rph spoT1 -(mrr-hsdRMS-mcrBC). إذا ظهرت مشاكل مع إعادة التركيب، المشار إليها من قبل عدد التحول المنخفض، لوحة البكتيريا المتحولة على طبقين والسماح لهم تنمو في 30 درجة مئوية و 37 درجة مئوية، على التوالي. نظرًا لوجود العديد من العناصر المتكررة في الجينات المصغرة ، فإنها تحتاج إلى تسلسل كامل باستخدام تسلسل الجيل التالي ، والذي يتوفر تجاريًا مقابل حوالي 150 دولارًا لكل بلازميد بمعدلات عام 2019. يظهر تسلسل المثال في الشكل التكميلي 5. بالإضافة إلى ذلك ، يتم إجراء تحليل تعدد الأشكال لطول جزء التقييد لإعداد أكبر جديد للبنيات بشكل روتيني. على سبيل المثال، باستخدام المواقع التي تقطع 1-4 مرات يؤدي إلى نمط الفرقة المميزة التي تستبعد إعادة تركيبات(الشكل 4). وينبغي اختيار الإنزيمات التي تعطي نمط الفرقة المميزة من الشظايا التي يمكن فصلها على هلام أغاروز.

يتم تحليل الحمض النووي الريبي الدائري مع RT-PCR باستخدام التمهيديات تقاطع exon التي تتداخل مع الحدث backsplicing(الشكل 1F). نظرًا للطبيعة الدائرية للـ RNA ، فإن التمهيدي العكسي (أي مضادات الحواس) هو المنبع من التمهيدي إلى الأمام (أي الإحساس)(الشكل 1G). يتم استخدام التمهيديات الكشف عن بوفرة المثلية التفاعل البروتين كيناز 3 (HIPK3) دائرية RNA1 كتحكم إيجابي. HIPK3 وminigene محددة الكبيات عكس عكس نسخ عكس في نفس الأنبوب، مما يسمح مقارنتها. يتم تنفيذ تفاعلات PCR مع التمهيديات تضخيم mRNAs الخطية لمقارنة أنماط المعالجة من mrnAs الدائرية والخطية. لاحظنا في كثير من الأحيان العصابات الشاذة عندما تم خلط المبادئ التمهيدية للالحمض النووي الريبي الخطي والدائري(الشكل 5)، وبالتالي الحفاظ على النسخ العكسي لهذه العينات منفصلة.

تحليل RT-PCR من الحمض النووي الريبي الدائري هو التحدي ويحتاج إلى مراقبة بعناية. في حين حساسة ومريحة، فإنه يمكن أن تنتج القطع الأثرية فريدة من نوعها لRNAsدائرية 29. يمكن للنسخة العكسية التحرك عدة مرات حول دائرة الجيش الملكي النيبالي، الذي يولد concatemers. معظم الجينات مراسل الجيش الملكي النيبالي دائريتوليد كل من الحمض النووي الريبي الدائري والخطي، والتي يمكن عبر هجين، مما يؤدي إلى المزيد من القطع الأثرية PCR21،30،31. وبالتالي فمن الضروري لتسلسل منتجات PCR والتحقق من صحة النتائج باستخدام تقنيات مختلفة باستخدام بقع الشمالية32 أو RNase الحماية23.

يمكن أن تنشأ النطاقات غير المبررة أيضًا من التضخيم الشاذ للحمض النووي الريبي الخطي. يمكن إزالة الحمض النووي الريبي الخطي باستخدام exonuclease RNase R، الذي يثري RNAsدائري33 (الشكل 5C). RNase R العلاج يساعد في التحسين الأولي للكشف التمهيديات وغالبا ما يمكن حذفها مرة واحدة يتم تحسين التمهيديات.

يمكن أن يسهم الربط الخلفي البديل أيضًا في النطاقات غير المبررة حيث يمكن تشكيل الحمض النووي الريبي الدائري المتعدد من موضع الجينوم34. هذا البديل الربط الخلفي هو في كثير من الأحيان نتيجة لهياكل ما قبل مرنا المتنافسة التي شكلتها أكثر من عنصرين مكررين مقلوبين. وبالإضافة إلى ذلك، يمكن أن تحدث مواقع خفي لصق الظهر32،35. اعتمادا على الهدف التجريبي، يمكن تكرار عناصر Alu أو إضافتها إلى الإنشاءات. يمكن أن تكون المناطق التكميلية المحيطة بمواقع الربط الخلفي قصيرة مثل 30-40 nt35 واستبدال عناصر Alu مع مناطق تكميلية أقصر يمكن أن تزيد من تكوين الحمض النووي الريبي الدائري2، والتي يمكن اختبارها لتحسين تكوين الحمض النووي الريبي الدائري. وبمجرد تحديد متواليات ما قبل مرنا التي تسبب الربط الخلفي، فمن الممكن بالتالي تقصير الحمض النووي الريبي الدائري الذي يعبر عن الهياكل، التي يمكن أن تحسن كفاءة الترانزفيشن في بعض الحالات.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

لا شيء للكشف عنه.

Acknowledgments

تم دعم هذا العمل من قبل وزارة الدفاع وزارة الدفاع منحة AZ180075. ستيفان ستام يشكر جاكلين نونان الوقف. آنا Pawluchin كان مدعوما من قبل DAAD، الألمانية برنامج التبادل الأكاديمي، جوستين R. ويلدن كان حاصلا على جائزة جامعة كنتاكي ماكس ستيكلر.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
استخدام عنصر <em>Alu</em> الذي يحتوي على جينات صغيرة لتحليل الحمض النووي الريبي الدائري
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter