Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Brug af Alu Element, der indeholder Minigenes til at analysere cirkulære RNA'er

doi: 10.3791/59760 Published: March 10, 2020

Summary

Vi klon og analysere reporter gener genererer cirkulære RNAs. Disse reporter gener er større end konstruktioner til at analysere lineær splejsning og indeholder Alu elementer. For at undersøge de cirkulære RNA'er transkaperer konstruktionerne til celler, og det resulterende RNA analyseres ved hjælp af RT-PCR efter fjernelse af lineært RNA.

Abstract

Ud over lineære mRNAs, mange eukaryote gener generere cirkulære RNA'er. De fleste cirkulære RNA'er genereres ved at tilslutte sig et 5' splejsningssted med et opstrøms 3' splejsningssted inden for et præ-mRNA, en proces kaldet back-splejsning. Denne cirkularisering er sandsynligvis hjulpet af sekundære strukturer i præ-mRNA, der bringer splejsning steder i umiddelbar nærhed. I menneskelige gener, Alu elementer menes at fremme disse sekundære RNA strukturer, som Alu elementer er rigelige og udviser base komplementariteter med hinanden, når de er til stede i modsatte retninger i præ-mRNA. Her beskriver vi generering og analyse af store, Alu element, der indeholder reporter gener, der danner cirkulære RNA'er. Gennem optimering af kloningsprotokoller kan der genereres reportergener med en skærlængde på op til 20 kb. Deres analyse i samtransfection eksperimenter gør det muligt at identificere lovgivningsmæssige faktorer. Således kan denne metode identificere RNA-sekvenser og cellulære komponenter involveret i cirkulær RNA-dannelse.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cirkulære RNA'er
Cirkulære RNA'er (circRNAs) er kovalent lukkede enkeltstrandede RNA'er, der er udtrykt i de fleste organismer. De genereres ved at slutte sig til et nedstrøms 5'splice site til en opstrøms 3'splice site, en proces kaldet back-splejsning (Figur 1A)1. Sekvenser i præ-mRNA, der udviser base komplementære så kort som 30-40 nt bringe back-splejsning steder i korrekt tilpasning til circRNA dannelse2. Hos mennesker danner Alu-grund1 , der repræsenterer ca. 11 % af genomet3, omfattende dobbeltstrengede RNA-strukturer i præ-mRNA på grund af deres selvkomplementaritet4,5 og fremmer dermed dannelsen af circRNAs1.

I øjeblikket er tre vigtige funktioner i circRNAs blevet beskrevet. Nogle circRNAs binder microRNAs (miRNAs) og gennem binding fungerer som miRNA svampe6. CircRNAs har været involveret i transskriptionel og post transskriptionel regulering, gennem konkurrence med lineær splejsning7 eller graduering af transskription faktor aktivitet8. Endelig indeholder circRNAs korte åbne læserammer og principbevissundersøgelser, at de kan oversættes9,10. Men funktionen af de fleste circRNAs forbliver gådefuld. Størstedelen af de cirkulære RNA'er er blevet opdaget ved hjælp af næste generations sekventeringsmetoder11. Detaljerede analyser af individuelle gener ved hjælp af målrettede RT-PCR-tilgange viser , at der stadig er et stort antal cirkulære rna'er , der mangler at blive opdaget12.

Brug af reporter gener til at analysere pre-mRNA behandling
Analysen af mRNA stammer fra DNA reporter konstruktioner transfected i celler er en veletableret metode til at studere alternative pre-mRNA splejsning, som kan anvendes på cirkulære RNA'er. Generelt forstærkes den alternative ekson, dens omgivende introner og konstituerende eksoner og klonerer til en eukaryote ekspressionsvektor. Ofte er intronerne forkortet. Konstruktionerne transktres i eukaryote celler og analyseres normalt af RT-PCR13,14. Denne fremgangsmåde er i vid udstrækning blevet anvendt til at kortlægge reguleringssplejsningsanlæg og trans-acting faktorer i samtransfection eksperimenter13,15,16,17,18. Desuden gav generering af proteineksyderier mulighed for screening af stoffer, der ændrer alternativ splejsning19,20.

Metoden er blevet anvendt på cirkulære RNA'er. I øjeblikket er mindst 12 minigene backbones blevet beskrevet i litteraturen og er sammenfattet i tabel 1. Med undtagelse af tRNA-baserede ekspressionssystem21,22, er de alle afhængige af polymerase II-promotorer. Her beskriver vi en metode til at generere menneskelige reporter minigenes at bestemme cis og trans-handler faktorer, der er involveret i dannelsen af cirkulære RNA'er. En oversigt over metoden ved hjælp af sekvenser af et offentliggjort reporter-gen23 er vist i figur 1.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Konstruktionernes konstruktioner er udformet

  1. Brug UCSC genom browser24 til at identificere gentagne elementer er nødvendige for cirkulærRNA dannelse og indarbejde dem i konstruktioner. Vigtigere er det, primere til forstærkning skal være uden for de gentagne elementer.
  2. Indsæt den cirkulære RNA-sekvens(Supplerende figur 1 er en testsekvens) i https://genome.ucsc.edu/cgi-bin/hgBlat?command=start og vælg den rigtige organisme. Indsend sekvensen og gå til browservisning, zoom ud 1,5x eller efter behov (Figur 2A).
    BEMÆRK: Søgesekvensen vises i den øverste linje (Figur 2A, 1). Afhængigt af rækkefølgen af exons i det cirkulære RNA, vil BLAT ikke forbinde alle exons. I dette eksempel er exon 12 (Figur 2A, 4) ikke forbundet til 11 ( Figur2A, 2, 3), fordi exon 12 er opstrøms for exon 11 i den cirkulære RNA-sekvens (Supplerende figur 1). De gentagne elementer er i 'repeat masker' spor, angivet med kasser, hvor sort til grå farve angiver den evolutionære bevarelse (Figur 2A, 5).
  3. Hold musen over de gentagne elementer for at identificere deres undertype i et flydende vindue. Alu elementer er i SINE (korte afbrudt nukleare element) linje. Brug knappen 'standardspor' under vinduet til at nulstille browseren, hvis der opnås et andet billede end figur 2.
    BEMÆRK: Mousing over exons i genvisningen genererer et vindue med exon numre, der er computergenereret. Disse tal svarer ikke til den exon nummerering etableret i litteraturen og også ændre mellem isoformer.

2. Vælg den sekvens, der skal klones i et udtryk vektor

  1. Download DNA-sekvensen vist i vinduet ved at gå til View → DNA på den øverste linje i UCSC genom browser. Vælg Udvidede indstillinger for store og småbogstaver i indstillingen Sekvenseringsformatering.
  2. Vælg standardtilfældet som Lavere, og vælg til/fra-etui for NCBI refseq. Vælg understregning og fed og kursiv for Gentag masker. Klik på Send. Der vil være exons som store bogstaver og introner som små bogstaver. Tjek exon/intron-grænserne.
  3. I dette eksempel er der en 'ccctttacCTTTTT'-sekvens, der angiver, at browseren viser det omvendte supplement. Hvis dette er tilfældet, skal du gå tilbage og vælge den omvendte komplementboks, indtil du ser de korrekte exon intron-grænser (agEXONgt), i dette eksempel AAAAAGgtaaaggg.
  4. Kopier filen med den korrekte retning (interne exons er omgivet af intronic ag... gt) i et tekstbehandlingsprogram og fremhæve exons(Supplerende figur 2).
    BEMÆRK: I dette eksempel er det genomiske fragment, der omfatter exons 9-12, omkring 24 kb og dermed for stort til at blive forstærket af genomisk DNA. Derfor er hver exon omgivet af omkring 1 kb intronic region individuelt forstærket, og disse fire fragmenter er samlet i en kloning vektor.
  5. Vælg de fragmenter, der skal forstærkes (exon ± 500 nt intron). Sørg for, at intronen ikke begynder eller slutter i et gentaget område, da primere i disse regioner ikke vil forstærke specifikke sekvenser. De valgte områder er vist i figur 2B, og deres sekvenser er vist i supplerende figur 3.
    BEMÆRK: Generelt, jo større konstruktioner, jo vanskeligere kloning vil være. Fragmenterne kan samles enten trinklogt (dvs. exon 9 kombineres med vektoren og i næste trin indsættes exon 10 i denne konstruktion via kloning, indtil alle exoner er på plads), eller alternativt samles alle fragmenter samtidigt. En trinvis tilgang virker altid, men kræver mere tid. En samtidig samling virker ikke altid og afhænger af, hvor godt de enkelte fragmenter kan forstærkes fra genomisk DNA og af konstruktionens samlede størrelse. Vi starter derfor som regel med begge tilgange samtidigt.

3. Design primere til kloning

  1. Brug et webværktøj (https://nebuilder.neb.com/#!/) til at designe primerne til kloning. Indtast for eksempel fragmenter 9, 10, 11 og 12 og vektorsekvensen (Supplerende figur 3) til dette værktøj.
  2. For vektorsekvensen tilføjes indsætningsstedet som den sidste nukleotid og derefter tilføje fragmenterne. Da vektornummereringen ikke starter med et givet indføringssted, er indsætningsstedet i vektoren placeret, og downstream-delen sættes ind foran opstrømssekvensen. I dette eksempel starter indsatserne direkte efter HindIII-webstedet [AAGCTT] og slutter direkte efter pmei-webstedet [GTTTAAAC] af pcDNA3.1. Sekvensen fra cccgctgatcag ... ccgtaaaaaggccgc indsættes foran position 1 i pcDNA3.1-sekvensen (gttgctggcgttttcc ...).
  3. Juster primere, hvis deres smeltepunkter er mere end 4 °C fra hinanden, da de ikke vil arbejde i forstærkning. Samlingen af de designede fragmenter og primersekvenser er vist i supplerende figur 4. Primere til kloning kan også designes manuelt25.

4. PCR og amplicon detektion

  1. Standard PCR-reaktion: Der forekommer en reaktionsblanding for et samlet volumen på 50 μL pr. reaktion. Nedenfor er opskriften på en reaktion ved hjælp af polymerase 1:
    10 μL 5x reaktionsbuffer
    1 μL af 10 mM dNTPs
    2,5 μL af 10 μM fremadprimere
    2,5 μL af 10 μM omvendt primer
    0,5 μL Polymerase 1
    32,5 μL Nuclease gratis H2O
    1. Eventuelt tilsættes 10 μL 5x GC Enhancer, hvis produktet har højt GC-indhold. lave en separat blanding, der indeholder GC Enhancer, for at teste PCR-reaktionen.
  2. Aliquot 49 μL af blandingen i PCR-rør pr. reaktionsprøve.
  3. Der tilsættes 1 μL DNA til PCR, hvor meget varierer fra 10 stil til 1 ng.
  4. Drej prøverne ned for at fjerne rester fra siderne og læg dem i en PCR-maskine. Brug den samme maskine samt samme pletter i maskinen, når du optimerer PCR-forholdene.

5. Optimering til længere DNA-fragmenter til brug af forskellige polymeraser

  1. Temperatur
    1. Optimer den langtrækkende Polymerase 2.
      1. Brug en lavere denatureringstemperatur (Polymerase 1: 98 °C, Polymerase 2: 94 °C).
      2. Brug en længere denatureringstid (Polymerase 1: 10 s, Polymerase 2: 30 s).
      3. Brug en længere glødetid (Polymerase 1: 30 s, Polymerase 2: 60 s).
      4. Brug en længere forlængelsestid (Polymerase 1: 30 s/kb, Polymerase 2: 50 s/kb).
      5. Brug en lavere forlængelsestemperatur (Polymerase 1: 72 °C, Polymerase 2: 65 °C).
      6. Brug en glødetemperatur 5 °C under Tm af primerne.
    2. Optimer primerkoncentrationerne (5x mindre til 5x mere end den oprindelige primerkoncentration). Optimer DNA-koncentrationer fra 10 pg til 50 pg, 100 pg, 1 ng, 5 ng, 10 ng.
    3. Som et eksempel på et PCR-program til at forstærke en 15 kb produktstørrelse ved hjælp af Polymerase 2, udføre en indledende denaturering ved 94 °C for 30 s, DNA denaturering ved 94 °C for 30 s efterfulgt af glødning ved 58 °C for 30 s, og DNA udvidelse ved 65 °C i 12 min 30 s. Der udføres en endelig forlængelse ved 65 °C i 10 minutter med et endeligt 4 °C-hold.
      BEMÆRK: Den glødetemperatur (Ta), der er specifik for primerne, bestemt af webbaserede temperaturberegninger, der er specifikke for hver polymerase. Forlængelsestiderne kan variere og skal optimeres, hvis fragmenterer er større end 10 kb.
  2. Forlængelsestider og DNA-koncentrationer
    1. Brug længere forlængelsestider for DNA-fragmenter på over 6 kb: 1 min pr. 1 kb. Længere fragmenter bør bruge mindre DNA.
    2. Udfør fortyndinger af DNA for at finde den optimale DNA-koncentration til forstærkning, normalt 1 pg til 1 ng for plasmider eller 1 ng til 1 μg for genomisk DNA.
      BEMÆRK: For de fleste kloning brug polymerase 1, manipuleret ved at sammensmelte Sso7d DNA bindende domæne til en proprietær termostabil DNA polymerase26. Polymerase har en lav fejlrate og på grund af Sso7d domæne en høj processivitet, der er nødvendig for at forstærke store (10-15 kb) genomiske fragmenter. På grund af denne store fragmentstørrelse anvendes enzymatisk samling af DNA-molekyler27 til indsættelse i vektorer, da denne metode ikke kræver restriktionsenzymer. Forstærkningen af fragmenter længere end 15 kb bliver stadig vanskeligere med polymerase 1. Til stor fragment forstærkning brug polymerase 2 lavet af pyrococcus-lignendekorrekturlæsning polymerase smeltet til Sso7d eller langtrækkende PCR kit, der giver dog højere fejlprocenter.

6. Rensning af PCR-produkter til kloning

  1. Kør halvdelen af PCR-produkterne på 1% agarosegeler indeholdende en intercalaing nukleinsyreplet (f.eks. 1x GelGreen). Visualiser de farvede geler på en mørk læser transilluminator. Denne farvede DNA kører ikke tro mod størrelse.
    BEMÆRK: GelGreen interkalaterer i DNA, svarende til ethidium bromid, men det er ophidset af lys omkring 500 nm (cyan), en bølgelængde, der ikke skader DNA, som i høj grad forbedrer kloning.
  2. Parallelt hermed skal halvdelen af PCR-produkterne køres på en 1% gel, der er plettet efter kørsel med ethidiumbromid (figur 3A,B).
  3. Punktafgifter bånd af den rigtige størrelse fra den farvede gel (trin 6.1) og isolere DNA ved hjælp af en gel og PCR oprydning kit. I afvigelse fra standardprotokollen udgår DNA'et i kun 20 μL dobbelt destilleret vand, da DNA-koncentrationerne normalt er lave.
  4. Før kloning kontrolleres det isolerede DNA på en agarosegel for koncentration og integritet (figur 3B). Sigt efter en 2:1 molære skær til vektor forhold. Når du bruger flere skær, er forholdet 2:2:2:1.

7. DNA-samling og klondetektion

BEMÆRK: Kloning sker ved hjælp af et enzymatisk DNA-monteringssæt med mindre ændringer. Samlingen udføres i 60 min ved 50 °C, og generelt anvendes det nedre DNA-område til montering (20-100 fmol/20 μL reaktion). Hele reaktionsblandingen tilsættes til kemiske kompetente celler, og hele cellerne er belagt på en 6 cm agarplade.

  1. Skær vektoren og skær den i et 1:2 molarforhold (20-500 fmol hver) i 10 μL vand.
  2. Der tilsættes 10 μL DNA Assembly Master Mix.
  3. Inkuberprøver i 60 minutter ved 50 °C.
  4. Derefter omdannes kompetente celler med den samlede samlingsreaktion. Her skal du bruge E. coli stamme 1 celler til kortere konstruktioner eller E. coli stamme 2 celler i længere eller ustabile konstruktioner. Cellerne skal være i et 50 μL volumen.
  5. Tø celler op på is og tilsæt 2 μL af det kølede samlede produkt til de kompetente celler. Bland ved forsigtigt at svippe røret 4-5 gange. Må ikke vortex.
  6. Lad blandingen sidde på is i 30 min.
  7. Varmechok ved 42 °C i 30 s. Bland ikke.
  8. Overfør røret tilbage til is i 2 min.
  9. 950 μL soc-medier med rumtemperatur tilsættes til røret.
  10. Reaktionsrøret inkuberes ved 37 °C i 60 min. Ryst kraftigt (300 omdr./min.).
  11. Varm markeringsplader med det relevante antibiotikum under inkubation ved 37 °C.
  12. Pellet cellerne gennem centrifugering (10.000 x g,30 s) og plade ud 1/4 og 3/4 af celler på to udvælgelsesplader og inkubere ved 37 °C natten over.

8. Validering af kloner

  1. Brug koloni PCR, der anvender PCR-primere, der spænder over samlingsstederne (Figur 1C) til detektion.
  2. Tag en steril tandstikker og røre en enkelt bakteriel koloni.
  3. Rør bunden af et PCR-rør med tandstikkeren, der har kolonien, og stæn derefter tandstikkeren på en antibiotisk agarplade, inkuber den stribede plade ved 37 °C eller stuetemperatur for følsomme konstruktioner natten over.
  4. Overlay PCR rør rørt med kolonien med en PCR mix, der indeholder detektion primere. Disse er designet ved hjælp af primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/). Programmet har mulighed for at tvinge primer design på tværs af en defineret sekvens ved hjælp af "[ccc]" tegn til at vælge primere på tværs af samlingkrydset. DNA fra positive stammer isoleres og verificeres ved sekvensering.

9. Analyse af cirkulære RNA udtrykke reporter gener

  1. Til analyse, transfect reporter gener i eukaryote celler. Her skal du bruge HEK293 celler (ATTC #CRL-1573), da de giver høj transfektionseffektivitet. For at spare omkostninger skal du bruge PEI-opløsninger (polyethyleneimin).
  2. For PEI-opløsningen opløses lineær polyethylendiminhydrochlorid (PEI) ved 1 mg/ml i vand ved lav pH, pH 2. Opdrage pH til 7 med NaOH. Sterilt filter med 0,22 μm filtre og opbevares ved 4 °C.
  3. Opdel celler i seks brønde (ca. 150.000 celler pr. brønd) og lad dem vokse natten over i 10% FBS i DMEM-medier.
  4. Aliquot 1 μg af reportergenet i et sterilt rør tilsættes 200 μL sterilt filtreret 150 mM NaCl. Bland med DNA ved vortexing.
  5. Tilsæt PEI-opløsning til denne blanding og vortex, centrifuger kortvarigt for at indsamle prøver i bunden af røret. Der anvendes et forhold på 1 μg DNA pr. 3 μL PEI.
  6. Inkuber ved stuetemperatur i 10 min og derefter tilføje direkte til HEK 293 celler.
  7. Inkuber HEK293-celler ved 37 °C, 5% CO2natten over.
  8. Isoler RNA for RT-PCR via et RNA-isolationssæt.

10. RNase R behandling for at fjerne lineære RNA'er

  1. Brug 10 μg totalRNA i et RNase-frit rør.
  2. Der tilsættes 10 μL 10x RNase R-buffer (0,2 M Tris-HCl (pH 8.0), 1 M KCl, 1 mM MgCl2) til RNA.
  3. Føj RNase R til RNA (1 μl = 20U).
  4. Der tilsættes 1 μL glykolblåt til RNA og tilbring volumen op til 100 μL med sterilt vand.
  5. Inkuberprøver ved 37 °C i 30 min.
  6. Der tilsættes 100 μL phenol/chloroform og vortex i 1 min.
  7. Der centrifugeres ved 21.000 x g i 1 min. for separate faser.
  8. Tag supernatanten (vandig fase) og tilsæt 1 volumen (ca. 80 μL chloroform).
  9. Vortex i 1 min, og derefter centrifugere i 1 min til separate faser.
  10. Tag supernatant, tilsæt 1:10 vol KAc og 2,5 vol ethanol, og udfældeved -20 °C for 1-4 h. Centrifuge ved 4 °C i 30 min ved fuld hastighed (21.000 x g). Der vil være en lille blå pellet i bunden.
  11. Fjern supernatanten, og vask med 80% ethanol. Lad luften tørre i 5 min ved stuetemperatur, og opløses i 10 μL vand.

11. RT-PCR-analyse

  1. Brug 1 μg RNA pr. RT-reaktion.
  2. Der foretag reaktionsblanding for et endeligt samlet volumen på 20 μL pr. reaktion. For én reaktion anvendes 1 μL af 10 mM dNTPs, 1 μL på 0,1 M Dithiothreitol (DTT), 4 μL 5x First-Strand Buffer og 0,5 μL omvendt transkriptase.
  3. Aliquot 6,5 μL reaktion blandes i nye PCR-rør.
  4. Bland op til 5 primere i én blanding. Nogle primere kan dog parre sig forkert med andre primere i PCR (Figur 5). Primersekvenser findes i tabel 2. Vi bruger rutinemæssigt genspecifikke exon-junction primere, men priming med tilfældige hexamers er også muligt.
  5. Der tilsættes 1 μL af 10 μM omvendt primer til det ønskede RT-reaktionsrør.
  6. Der tilsættes 1 μg RNA til PCR-reaktionsrøret.
  7. Der tilsættes RNase-fri H2O op til et samlet volumen på 20 μL.
  8. Spin rør ned for at fjerne rester på siden af rør og sted i thermocycler.
  9. Rt-reaktionen køres i termocycleren ved 50 °C i 50 minutter.
  10. Opbevar RT cDNA ved -20 °C, eller fortsæt til PCR-reaktionen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reporter gener tillader bestemmelse af lovgivningsmæssige faktorer, der påvirker cirkulær RNA-dannelse. Men disse reporter gener er store og indeholder gentagne elementer, der ofte gør DNA konstruktioner ustabile. På grund af deres store størrelse er det ofte nødvendigt at slette dele af intronerne, hvilket opnås ved at forstærke genomstykker, der indeholder exons og mindre flankerende introniske dele. Disse DNA-stykker er enzymatisk samlet, så konstruktion uden begrænsning enzymer.

Eksemplet med et cirkulært RNA, der er genereret fra det mikrotubuleassocierede protein tau (MAPT), viser en anvendelse af minigene-tilgangen til at analysere cirkulære RNA'er. Den tau 9→12 minigene, der anvendes i dette eksempel, var samtransfected med forskellige splejsningsfaktorer, og effekten af disse splejsningsfaktorer blev påvist af RT-PCR (Figur 6). Forskellige transvirkende faktorer påvirker både cirkulærrna og lineær præ-mRNA-dannelse. Eksperimentet viser også, at alle de sekvenselementer, der er nødvendige for cirkulær RNA-dannelse, er lokaliseret i det klonede fragment.

Figure 1
Figur 1: Oversigt over teknikken. (A) Der vises et hypotetisk gen. Introner er linjer, exons er kasser, Alu elementer er mindre stribede kasser. Backsplicing fra exon C til A skaber et cirkulært RNA. Strukturen af dette cirkulære RNA er vist i panel (E). (B) For at skabe en reporter gen, exons og omkringliggende introner (mindst 500 nt på hver side) forstærkes. Konstruktionerne skal indeholde gentagne elementer, som normalt er Alu-elementer hos mennesker. En exon opstrøms af exon A blev inkluderet for at give en ekstra Alu element. De genomiske fragmenter vil overlappe med deres flankerende 25 nts. (C) Fragmenter klones til en udtryksvektor, drevet af en CMV-promotor. Den vellykkede rekombination registreres ved at registrere primere og valideret ved sekvensering. (D) Celler transserer med denne konstruktion. (E) Cirkulærrna isoleres og (F) forstærkes ved hjælp af cirkulære RNA-specifikke primere, helst exon junction primere. Under PCR-forstærkning kan lineærRNA også forstærkes (G). (G) Orientering af de primere, der anvendes til at detektere cirkulære RNA'er. Den forreste primer er i fornuft orientering (dvs. har samme rækkefølge som RNA) og den omvendte primer er i antisense orientering (dvs. er det modsatte supplement af RNA). Bemærk, at forskellig fra RT-PCR for lineære mRNA'er, den omvendte primer er opstrøms for den forreste primer. Klik her for at se en større version af dette tal.

Figure 2
Figur 2: Udvælgelse af sekvensen til minigene konstruktion. (A) Browserdisplay efter den rækkefølge, der er vist i supplerende figur 1, køres mod den menneskelige genomiske database ved hjælp af BLAT. Litteratur exon numre36 er angivet i genvisningen, de er forskellige fra de tal, som browseren.
1. De justerede sekvenser vises under 'YourSeq'
2-4. Bemærk, at blat på grund af RNA's cirkularitet ikke forbinder alle exons med linjer, som det gør i lineærT RNA. Exons 10 og 11 (svarende til 2 og 3) er forbundet, men exon 12 (svarende til 4) er ikke forbundet til exon 11.
5. Alu elementer er vist i det gentagne element spor.
(B) Sekvenstilpasning mellem den planlagte konstruktion og genomisk DNA.
6. Den planlagte konstruktion blev kørt mod databasen ved hjælp af BLAT.
7. Bemærk, at flere Alu-elementer er medtaget i konstruktionen. Klik her for at se en større version af dette tal.

Figure 3
Figur 3: Eksempel på forstærkeren før kloning. (A) Optimerede PCR-produkter adskilt på en 1% agarose gel indeholdende 1x GelGreen. De enkelte bånd repræsenterer pcr-produkter, der vil blive brugt i enzymatisk DNA samling. B) Båndene fra (A) blev skåret ud af gelen og renset. De rensede PCR-produkter blev adskilt på en 1% agarosegel, som efterfølgende blev plettet med ethidiumbromid. Klik her for at se en større version af dette tal.

Figure 4
Figur 4: Begrænsningsanalyse af reportergener. Tau 9-12 minigene anvendes som et eksempel blev skåret med begrænsning enzymer angivet til at udelukke større rekombinationer. Lane 1: cut med NcoI forventede størrelser 735 bp, 3345 bp, 6266 bp, lane 2 cut med XbaI forventede størrelse 10346 bp, lane 3 cut med HindIII forventede størrelser 3951 bp, 6395 bp, lane 4 skåret med SmaI forventede størrelser 1168 bp, 1688 bp, 2708 bp, 4782 bp. Klik her for at se en større version af dette tal.

Figure 5
Figur 5: Effekt af primermultiplexing og RNase R-behandling på cirkulær RNA-detektion. (A) cDNA fra prøve A og B fra humane hjernevæv blev forstærket med cirkulære RNA-primere circTau exon12_10 Reverse og circTau exon10_11 Forward. Den omvendte transskription for cDNA blev udført med primerne for lineær og cirkulær tau RNA. Det forventede bånd, der svarer til tau cirkulært RNA, vises ved en trekant. De andre stærke bånd er artefakter, der ikke matchede det menneskelige genom. (B) Forsøget blev gentaget med identiske PCR betingelser, men den omvendte transskription blev kun udført med circTau exon12_10 Reverse primer. Kun det forventede band blev forstærket og valideret gennem sekvensering. (C) RNA blev behandlet med RNase R, der fjerner lineærRNA. Det cirkulære RNA kan detekterbare efter behandlingen (venstre), mens lineærRNA ikke længere giver et påviseligt signal (til højre) Klik her for at se en større version af dette tal.

Figure 6
Figur 6: Eksempel på en analyse af et circRNA-reportergen. 1 μg af det tau 9→1237 reporter gen blev transfemected med 1 μg af splejsning faktorer angivet. RNA blev isoleret 24 h efter transfektion og analyseret af RT-PCR. (A) Forstærkning af den lineære tau mRNA. På grund af alternativ splejsning af exon 10 to bands er observeret. Deres forhold ændrer sig som følge af overeksplikatfaktorernesplejsningsfaktorerne 38,39. B) Forstærkning af cirkulæret 12→10 tau RNA23. Bemærk afhængigheden af tau circRNA udtryk på udtryk for nogle splejsning faktorer, især cdc2 som kinase clk2 og SR protein 9G8. (C) Det cirkulære RNA af HIPK3 blev anvendt som en positiv kontrol, der indikerer lige belastning. Klik her for at se en større version af dette tal.

Tabel 1: Liste over aktuelle minigenes, der udtrykker cirkulære RNA'er. Klik her for at downloade denne fil.

Cirkulære HIPK3-styringsprimere
HIPK3 omvendt
HIPK3 Fremad
TGCTTGGCTCTTTGAGTTTC
TCGGCCAGTGTATCAAA
Lineære primere
Tau Exon 12 Omvendt
Tau Exon 9 Fremad
CCCAATCTTCGACTGGACTC
TGTCAAGTCCAAGATCGGCT
Cirkulære primere
circTau exon12_10 omvendt
circTau exon10_11 fremad
CAGCTTCTTATTAATTATCTGCACCTTTTT
GAGGCGGCAGTGTGCAA

Tabel 2: Liste over primere.

Supplemental Figure 1
Supplerende figur 1: Tau cirkulær RNA-testsekvens. Testsekvens svarende til et cirkulært RNA fra MAPT locus. Forskellige exons er angivet med understregning, kapitæler og store hætter. Klik her for at se en større version af dette tal.

Supplemental Figure 2
Supplerende figur 2: Genomisk sekvens, der indeholder den planlagte minigene. Exons er fremhævet i farver og gentagne elementer er understreget, kursiv og fed. Grå skygge angiver flankerende områder med lav kompleksitet, der kan bruges til at generere primere. Klik her for at downloade denne fil.

Supplemental Figure 3
Supplerende figur 3: Sekvenser af det planlagte reportergen. Vektorsekvensen og de planlagte genomfragmenter vises. Klik her for at downloade denne fil.

Supplemental Figure 4
Supplerende figur 4: Primers design til montering. Sekvensen fra supplerende figur 3 blev indtastet i builder-værktøjet. Klik her for at se en større version af dette tal.

Supplemental Figure 5
Supplerende figur 5: Sekvens af tau 9->12 reporter genet bruges som et eksempel. Klik her for at downloade denne fil.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Generelt cirkulære RNA'er er lav rigelige1, hvilket komplicerer studiet af deres funktion og dannelse. I lighed med lineære RNA'er13gør brugen af reporterminigenes det muligt at identificere cis og transvirkende faktorer, der regulerer dannelsen af cirkulære rna'er. Således genererer denne tilgang hypoteser, der kan testes yderligere ved hjælp af de endogene gener.

Det mest kritiske skridt er udformningen af reporter genet. Den enzymatiske samling af DNA-fragmenter ("Gibson kloning"27) letter dette design, da det giver mulighed for opførelse af store reporter gener uafhængigt af restriktioner steder.

De back-splejsning steder er samlet gennem flankerende omvendte gentagelser, som bør tages i betragtning i reporter genkonstruktion. Gentagelserne er kommenteret i genombrowseren 'repeat track', og hvis du vælger dem, vises deres orientering. Husk, at proteiner også kan tvinge back-splejsningsteder ind i en sekundær struktur, der er nødvendig for cirkulært RNA-udtryk28, og til en upartisk analyse bør 1-2 kb af flankerende introniske områder undersøges.

For at sikre stabiliteten af konstruktionerne, en vigtig overvejelse er den type bakterielle stammer og deres vækstbetingelser. For kortere, enkle konstruktioner standard kloning bakterier anvendes, som er næsten identisk e-dh5-alpha (huA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). For længere fragmenter, der indeholder mere end 6 Alu-elementer, "stabile" kompetente celler anvendes, som mangler en rekombinase (recA) og endonuclease (endA1) (F' proA+B+ lacIq ▌(lacZ)M15 zzf::Tn10 (TetR) ▲(ara-leu) 7697 araD139 fhuA ▲lacX74 galK16 galE15 e14- Φ80dlacZ▲M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 (mrr-hsdRMS-mcrBC). Hvis der opstår problemer med rekombination, angivet ved lave transformationstal, skal de transformerede bakterier pladepå to plader og lade dem vokse ved henholdsvis 30 ºC og 37 ºC. På grund af tilstedeværelsen af mange gentagne elementer i minigenes, skal de være fuldt sekventeret ved hjælp af næste generation sekventering, som er kommercielt tilgængelig for omkring $ 150 per plasmid på 2019 satser. Sekvensen af eksemplet er vist i Supplerende figur 5. Desuden udføres der rutinemæssigt polymorfianalyse af restriktionslængden for nye større fremstillinger af konstruktionerne. For eksempel, ved hjælp af websteder, der skærer 1-4 gange resulterer i en karakteristisk bånd mønster, der udelukker rekombinationer (Figur 4). Enzymer bør vælges, der giver et karakteristisk båndmønster af fragmenter, der kan adskilles på en agarosegel.

Cirkulære RNA'er analyseres med RT-PCR ved hjælp af exon junction primere, der overlapper med backsplicing-hændelsen (Figur 1F). På grund af RNA'ets cirkulære natur er den omvendte (dvs. antisense) primer opstrøms for den forreste (dvs. forstand) primer (Figur 1G). Primere, der detekterer det rigeligt udtrykte homeodomain-interagerende proteinkinase 3 (HIPK3) cirkulært RNA1, anvendes som en positiv kontrol. HIPK3 og minigene specifikke omvendte primere er omvendt transskriberet i samme rør, som gør det muligt at sammenligne dem. PCR-reaktioner udføres med primere, der forstærker de lineære mRNA'er for at sammenligne behandlingsmønstre for cirkulære og lineære præ-mRNA'er. Vi observerede ofte afvigende bånd, når primere til lineære og cirkulære RNA'er blev blandet (Figur 5), og dermed holde den omvendte transskription af disse prøver adskilt.

RT-PCR-analyse af cirkulære RNA'er er udfordrende og skal kontrolleres nøje. Mens følsomme og praktisk, kan det producere artefakter unikke for cirkulære RNAs29. Den omvendte transkriptase kan bevæge sig flere gange rundt om RNA-cirklen, som genererer concatemers. De fleste cirkulære RNA reporter gener generere både cirkulære og lineære RNA, som kan krydshybridisere, hvilket fører til flere PCR artefakter21,30,31. Det er derfor bydende nødvendigt at sortere PCR-produkterne og validere resultaterne ved hjælp af forskellige teknikker ved hjælp af Northern blots32 eller RNase-beskyttelse23.

Uforklarlige bånd kan også stamme fra afvigende forstærkning af lineærRNA. LineærRNA kan fjernes ved hjælp af exonuclease RNase R, som beriger cirkulære RNAs33 (Figur 5C). RNase R behandling hjælper i den indledende optimering af detektion primere og kan ofte udelades, når primere er optimeret.

Alternativ back-splejsning kan også bidrage til uforklarlige bånd som flere cirkulære RNA'er kan dannes fra en genomisk locus34. Denne alternative back-splejsning er ofte et resultat af konkurrerende pre-mRNA strukturer dannet af mere end to inverterede gentage elementer. Desuden kan kryptiske back-splejsning steder forekomme32,35. Afhængigt af det eksperimentelle mål kan Alu-elementer gentages eller føjes til konstruktionerne. De komplementære regioner, der flankerer back-splejsningssteder, kan være så korte som 30-40 nt35, og udskiftning af Alu-elementer med kortere komplementære regioner kan øge cirkulær RNA-formation2, som kan testes for at forbedre cirkulær RNA-dannelse. Når de præ-mRNA-sekvenser, der forårsager back-splejsning, er blevet identificeret, er det således muligt at forkorte cirkulære RNA-ekspressionskonstruktioner, hvilket kan forbedre transfektionseffektiviteten i nogle tilfælde.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Intet at afsløre.

Acknowledgments

Dette arbejde blev støttet af Department of Defense DoD tilskud AZ180075. Stefan Stamm tak Jacqueline Noonan Endowment. Anna Pawluchin blev støttet af DAAD, tysk akademisk udvekslingsprogram, Justin R. Welden var en modtager af University of Kentucky Max Steckler Award.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Brug af <em>Alu</em> Element, der indeholder Minigenes til at analysere cirkulære RNA'er
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter