Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Uso de Minigenes que contienen elementos Alu para analizar ARN circulares

doi: 10.3791/59760 Published: March 10, 2020

Summary

Clonamos y analizamos genes de reportero generando ARN circulares. Estos genes reporteros son más grandes que las construcciones para analizar el empalme lineal y contener elementos Alu. Para investigar los ARN circulares, las construcciones se transinfectan en células y el ARN resultante se analiza utilizando RT-PCR después de la eliminación del ARN lineal.

Abstract

Además de los ARNm lineales, muchos genes eucariotas generan ARN circulares. La mayoría de los ARN circulares se generan uniendo un sitio de empalme de 5' con un sitio de empalme ascendente de 3' dentro de un pre-mRNA, un proceso llamado back-splicing. Esta circularización es probablemente ayudada por estructuras secundarias en el pre-mRNA que acercan los sitios de empalme. En los genes humanos, se piensa que los elementos Alu promueven estas estructuras secundarias de ARN, ya que los elementos Alu son abundantes y exhiben complementariedades de base entre sí cuando están presentes en direcciones opuestas en el pre-ARNm. Aquí, describimos la generación y el análisis de grandes elementos Alu que contienen genes de reportero que forman ARN circulares. A través de la optimización de los protocolos de clonación, se pueden generar genes de reportero con una longitud de inserción de hasta 20 kb. Su análisis en experimentos de co-transfección permite la identificación de factores regulatorios. Por lo tanto, este método puede identificar secuencias de ARN y componentes celulares involucrados en la formación de ARN circular.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RNA circulares
Los ARN circulares (arnar circ) se cierran covalentemente en ARN de una sola trenza que se expresan en la mayoría de los organismos. Se generan uniendo un sitio de empalme descendente de 5' a un sitio de empalme ascendente de 3', un proceso llamado back-splicing(Figura 1A)1. Las secuencias en el pre-mRNA que exhiben base complementaria tan corta como 30-40 nt llevan los sitios de empalme hacia atrás en la alineación adecuada para la formación de ARN circn.2. En los seres humanos, los elementos Alu 1, que representan alrededor del 11% del genoma3,forman extensas estructuras de ARN de doble cadena en pre-arNM debido a su autocomplementariedad4,5 y así promueven la formación de circRNAs1.

Actualmente, se han descrito tres funciones principales de los circRNAs. Algunos círculos se unen microRNAs (miRNAs) y a través del secuestro actúan como esponjas de miRNA6. Los CircRNAs se han implicado en la regulación transcripcional y post transcripcional, a través de la competencia con el empalme lineal7 o la modulación de la actividad del factor de transcripción8. Por último, los círculos contienen marcos de lectura abiertos cortos y estudios de prueba de principio muestran que se pueden traducir9,10. Sin embargo, la función de la mayoría de los círculos narinás sigue siendo enigmática. La mayoría de los ARN circulares se han detectado utilizando métodos de secuenciación de próxima generación11. Los análisis detallados de genes individuales utilizando enfoques RT-PCR específicos revelan que un gran número de ARN circulares aún está por descubrir12.

Uso de genes reportero según el procesamiento previo al ARNm
El análisis del ARNm derivado de construcciones de reporteros de ADN transfectó en células es un método bien establecido para estudiar el empalme alternativo antes del ARNm, que se puede aplicar a los ARN circulares. En general, el exón alternativo, sus intrones circundantes y exons constitutivos se amplifican y clonan en un vector de expresión eucariota. Con frecuencia, los intrones se acortan. Las construcciones están infectadas en células eucariotas y generalmente analizadas por RT-PCR13,14. Este enfoque se ha utilizado ampliamente para mapear sitios de empalme sregulador y factores de acción trans en experimentos de co-transfección13,15,16,17,18. Además, la generación de minigenes de expresión de proteínas permitió el cribado de sustancias que cambian el empalme alternativo19,20.

El método se ha aplicado a los ARN circulares. Actualmente, al menos 12 espina dorsales de minigene se han descrito en la literatura y se resumen en la Tabla 1. Con la excepción del sistema de expresión basado en ARNm21,22, todos dependen de los promotores de la polimerasa II. Aquí, describimos un método para generar minigenes de reporteros humanos para determinar los factores cis y trans-acting involucrados en la generación de ARN circulares. En la Figura 1se muestra una descripción general del método utilizando secuencias de un gen de reportero publicado23.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Diseño de las construcciones

  1. Utilice el navegador del genomaCPSC 24 para identificar los elementos repetitivos necesarios para la formación de ARN circular e incorporarlos en las construcciones. Es importante destacar que las imprimaciones para amplificación deben estar fuera de los elementos repetitivos.
  2. Pegue la secuencia de ARN circular(Figura suplementaria 1 es una secuencia de prueba) en https://genome.ucsc.edu/cgi-bin/hgBlat?command=start y seleccione el organismo adecuado. Envíe la secuencia y vaya a la vista del navegador, aléjese 1.5x o según corresponda(Figura 2A).
    NOTA: La secuencia de búsqueda aparece en la línea superior(Figura 2A, 1). Dependiendo del orden de los exons en el ARN circular, BLAT no conectará todos los exons. En este ejemplo, el exón 12(Figura 2A, 4) no está conectado a 11(Figura 2A, 2, 3), porque el exón 12 es aguas arriba del exón 11 en la secuencia de ARN circular(Figura suplementaria 1). Los elementos repetitivos están en la pista 'repetir enmascarador', indicada por cajas, donde el color negro a gris indica la conservación evolutiva(Figura 2A, 5).
  3. Pase el ratón sobre los elementos repetitivos para identificar su subtipo en una ventana flotante. Los elementos Alu se encuentran en la línea SINE (elemento nuclear intercalado corto). Utilice el botón 'pistas predeterminadas' debajo de la ventana para restablecer el navegador si se obtiene una imagen diferente de la Figura 2.
    NOTA: Mousing sobre los exons en la pantalla del gen genera una ventana con números de exón generados por computadora. Estos números no corresponden a la numeración de exón establecida en la literatura y también cambian entre isoformas.

2. Seleccione la secuencia que se va a clonar en un vector de expresión

  1. Descargue la secuencia de ADN que se muestra en la ventana yendo a Ver el ADN en la línea superior del navegador del genoma UCSC. En la opción Formato de secuenciación, seleccione Opciones de mayúsculas y minúsculas/colores extendidas.
  2. Seleccione el caso predeterminado como Inferior y seleccione alternar mayúsculas y minúsculas para NCBI refseq. Seleccione subrayado, negrita y cursiva para Máscara de repetición. Haga clic en Enviar. Habrá exons como letras mayúsculas e intrones como letras pequeñas. Compruebe los bordes del exón/intron.
  3. En este ejemplo hay una secuencia 'ccctttacCTTTTT', que indica que el navegador muestra el complemento inverso. Si este es el caso, vuelva atrás y seleccione el cuadro de complemento inverso hasta ver los bordes intrones de exón correctos (agEXONgt), en este ejemplo AAAAAGgtaaaggg.
  4. Copie el archivo con la orientación correcta (los exons internos están rodeados de ag... gt) en un documento de procesamiento de textos y resalte los exons(Figura Suplementaria 2).
    NOTA: En este ejemplo, el fragmento genómico que abarca los exons 9-12 es de alrededor de 24 kb y, por lo tanto, demasiado grande para ser amplificado a partir del ADN genómico. Por lo tanto, cada exón rodeado por aproximadamente 1 kb de región intrónica se amplifica individualmente y estos cuatro fragmentos se ensamblan en un vector de clonación.
  5. Seleccione los fragmentos que desea amplificar (exón a 500 nt intron). Asegúrese de que el intrón no comience ni termine en una región repetitiva, ya que los imprimadores de estas regiones no amplificarán secuencias específicas. Las regiones seleccionadas se muestran en la Figura 2By sus secuencias se muestran en la Figura suplementaria 3.
    NOTA: En general, cuanto más grandes sean las construcciones, más difícil será la clonación. Los fragmentos se pueden ensamblar paso a paso sabio (es decir, el exón 9 se combina con el vector y en el siguiente paso el exón 10 se introduce en esta construcción a través de la clonación hasta que todos los exons están en su lugar), o alternativamente, todos los fragmentos se ensamblan simultáneamente. Un enfoque escalonado siempre funciona, pero requiere más tiempo. Un ensamblaje simultáneo no siempre funciona y depende de lo bien que los fragmentos individuales se pueden amplificar a partir del ADN genómico y del tamaño total de la construcción. Por lo tanto, normalmente comenzamos con ambos enfoques simultáneamente.

3. Imprima imprimaciones para clonación

  1. Utilice una herramienta web (https://nebuilder.neb.com/#!/) para diseñar las imprimaciones para la clonación. Por ejemplo, escriba los fragmentos 9, 10, 11 y 12 y la secuencia vectorial(Figura suplementaria 3)a esta herramienta.
  2. Para la secuencia vectorial, agregue el sitio de inserción como el último nucleótido y, posteriormente, agregue los fragmentos. Puesto que la numeración vectorial no comienza con un sitio de inserción dado, se encuentra el sitio de inserción en el vector y la parte descendente se coloca delante de la secuencia ascendente. En este ejemplo, las plaquitas comienzan directamente después del sitio HindIII [AAGCTT] y terminan directamente después del sitio PmeI [GTTTAAAC] de pcDNA3.1. La secuencia de cccgctgatcag ... ccgtaaaaaagccgc se pega delante de la posición 1 en la secuencia pcDNA3.1 (gttgctggcgtttttcc ...).
  3. Ajuste las imprimaciones si sus puntos de fusión están separados a más de 4 oC, ya que no funcionarán en la amplificación. El montaje de los fragmentos y secuencias de imprimación diseñados se muestran en la Figura Suplementaria 4. Las imprimaciones para clonación también se pueden diseñar manualmente25.

4. Detección de PCR y amplicon

  1. Reacción PCR estándar: Haga una mezcla de reacción para un volumen total de 50 s por reacción. A continuación se muestra la receta para una reacción usando la polimerasa 1:
    10 l de búfer de reacción de 5x
    1 L de 10 mM de dNtPs
    2,5 s de 10 m de imprimación delantera
    2,5 ml de imprimación inversa de 10 m
    0,5 l de polimerasa 1
    32,5 l de Nuclease libre H2O
    1. Opcionalmente, agregue 10 s l de 5x GC Enhancer si el producto tiene un alto contenido de GC; hacer una mezcla separada que contenga GC Enhancer para probar la reacción de PCR.
  2. Aliquot 49 l de la mezcla en tubos PCR por muestra de reacción.
  3. Añadir 1 l de ADN a la PCR, la cantidad oscila entre 10 pg y 1 ng.
  4. Gire las muestras para eliminar los residuos de los lados y colóquelos en una máquina pcR. Utilice la misma máquina, así como los mismos puntos en la máquina al optimizar las condiciones de PCR.

5. Optimización de fragmentos de ADN más largos para el uso de diferentes polimerasas

  1. Temperatura
    1. Optimice la polimerasa de largo alcance 2.
      1. Utilizar una temperatura de desnaturalización más baja (Polimerasa 1: 98 oC, Polimerasa 2: 94 oC).
      2. Utilizar un tiempo de desnaturalización más largo (Polimerasa 1: 10 s, Polimerasa 2: 30 s).
      3. Utilice un tiempo de recocido más largo (Polimerasa 1: 30 s, Polimerasa 2: 60 s).
      4. Utilice un tiempo de extensión más largo (Polimerasa 1: 30 s/kb, Polimerasa 2: 50 s/kb).
      5. Utilice una temperatura de extensión más baja (Polimerasa 1: 72 oC, Polimerasa 2: 65 oC).
      6. Utilice una temperatura de recocido 5 oC por debajo de la Tm de las imprimaciones.
    2. Optimizar las concentraciones de imprimación (5 veces menos a 5 veces más que la concentración de imprimación original). Optimizar las concentraciones de ADN de 10 pg a 50 pg, 100 pg, 1 ng, 5 ng, 10 ng.
    3. Como ejemplo de un programa de PCR para amplificar un tamaño de producto de 15 kb usando Polymerase 2, realice una desnaturalización inicial a 94 oC durante 30 s, desnaturalización del ADN a 94 oC para 30 s seguida de recocido a 58 oC para 30 s, y extensión de ADN a 65 oC durante 12 min 30 s. Realizar una extensión final a 65 oC durante 10 minutos con una retención final de 4 oC.
      NOTA: La temperatura de recocido (Ta) específica para las imprimaciones determinada por los cálculos de temperatura basados en web que son específicos para cada polimerasa. Los tiempos de extensión pueden variar y deben optimizarse si los fragmentos son mayores de 10 kb.
  2. Tiempos de extensión y concentraciones de ADN
    1. Utilice tiempos de extensión más largos para fragmentos de ADN de más de 6 kb: 1 min por 1 kb. Los fragmentos más largos deben usar menos ADN.
    2. Realizar diluciones de ADN para encontrar la concentración óptima de ADN para la amplificación, por lo general de 1 pg a 1 ng para plásmidos o 1 ng a 1 g para el ADN genómico.
      NOTA: Para la mayoría de la clonación, utilice la polimerasa 1, diseñada fusionando el dominio de unión al ADN Sso7d a una polimerasa de ADN termoestable patentada26. La polimerasa tiene una baja tasa de error y debido al dominio Sso7d una alta procesatividad, necesaria para amplificar fragmentos genómicos grandes (10-15 kb). Debido a este gran tamaño de fragmento, el conjunto enzimático de moléculas de ADN27 se utiliza para la inserción en vectores, ya que este método no requiere enzimas de restricción. La amplificación de fragmentos de más de 15 kb se vuelve cada vez más difícil con la polimerasa 1. Para la amplificación de fragmentos grandes, utilice la polimerasa 2 hecha de pirococo-como la polimerasa de corrección fusionada con Sso7d o el kit de PCR de largo alcance que da, sin embargo, tasas de error más altas.

6. Purificación de productos de PCR para clonación

  1. Ejecute la mitad de los productos de PCR en geles de agarosa al 1% que contengan una mancha de ácido nucleico intercalante (por ejemplo, 1x GelGreen). Visualice los geles manchados en un transiluminador lector oscuro. Este ADN manchado no se ajusta al tamaño.
    NOTA: GelGreen intercala en EL ADN, similar al bromuro de etidio, pero se excita por la luz alrededor de 500 nm (cian), una longitud de onda que no daña el ADN, lo que mejora en gran medida la clonación.
  2. Paralelamente, ejecute la mitad de los productos PCR en un gel del 1% que se tiñe después de la ejecución con bromuro de etidio(Figura 3A,B).
  3. Bandas especiales del tamaño adecuado del gel teñido (paso 6.1) y aislar el ADN utilizando un gel y un kit de limpieza de PCR. En desviación de su protocolo estándar, eluir el ADN en sólo 20 l de agua destilada doble, ya que por lo general las concentraciones de ADN son bajas.
  4. Antes de clonar, compruebe la concentración e integridad del ADN aislado de un gel de agarosa(Figura 3B). Apunte a una relación de inserción molar a vector 2:1. Cuando se utilizan varias plaquitas, la relación es 2:2:2:1.

7. Montaje de ADN y detección de clones

NOTA: La clonación se realiza utilizando un kit de ensamblaje de ADN enzimático, con modificaciones menores. El montaje se realiza durante 60 minutos a 50 oC y generalmente se utiliza el rango inferior de ADN para el montaje (reacción de 20-100 fmol/20 l). Toda la mezcla de reacción se añade a las células químicas competentes y las células enteras chapadas en una placa de agar de 6 cm.

  1. Combine el vector e insértelo en una relación molar de 1:2 (20-500 fmol cada uno) en 10 ml de agua.
  2. Añadir 10 l de mezcla maestra de ensamblaje de ADN.
  3. Incubar muestras durante 60 minutos a 50oC.
  4. A continuación, transforme las celdas competentes con la reacción total de ensamblaje. Aquí, utilice e. coli cepa 1 células para construcciones más cortas o E. coli colaunitaria 2 células para construcciones más largas o inestables. Las celdas deben estar en un volumen de 50 l.
  5. Descongelar las células sobre hielo y añadir 2 ml del producto enfriado ensamblado a las células competentes. Mezclar moviendo suavemente el tubo 4-5 veces. No vórtice.
  6. Deje que la mezcla se sente en hielo durante 30 minutos.
  7. Choque de calor a 42oC durante 30 s. No mezclar.
  8. Transfiera el tubo de nuevo al hielo durante 2 min.
  9. Añadir 950 l de SOC a temperatura ambiente al tubo.
  10. Incubar el tubo de reacción a 37oC durante 60 min. Agitar vigorosamente (300 rpm).
  11. Placas de selección calientes con el antibiótico adecuado durante la incubación a 37oC.
  12. Reventar las células a través de centrifugación (10.000 x g,30 s) y la placa de salida 1/4 y 3/4 de células en dos placas de selección e incubar a 37oC durante la noche.

8. Validación de clones

  1. Utilice la PCR de colonia, empleando imprimaciones PCR que abarcan los sitios de montaje(Figura 1C)para la detección.
  2. Tome un palillo estéril y toque una sola colonia bacteriana.
  3. Toque la parte inferior de un tubo de PCR con el palillo de dientes que tiene la colonia y luego raye el palillo de dientes en una placa de agar antibiótico, incubar la placa rayada a 37 oC o temperatura ambiente para construcciones sensibles durante la noche.
  4. Superponer el tubo PCR tocado con la colonia con una mezcla de PCR que contiene las imprimaciones de detección. Estos están diseñados con imprimación 3 (http://bioinfo.ut.ee/primer3-0.4.0/). El programa tiene la opción de forzar el diseño de imprimación a través de una secuencia definida utilizando los signos "[ccc]" para seleccionar imprimaciones a través de la unión de ensamblaje. El ADN de cepas positivas se aísla y verifica mediante secuenciación.

9. Análisis del ARN circular que expresa los genes del reportero

  1. Para el análisis, los genes de reporteros transfectos en células eucariotas. Aquí, utilice las células HEK293 (ATTC #CRL-1573) ya que proporcionan una alta eficiencia de transfección. Para ahorrar costes, utilice las soluciones PEI (polietilenimina).
  2. Para la solución PEI, disolver el clorhidrato lineal de polieetilemímine (PEI) a 1 mg/ml en agua a un pH bajo, pH 2. Sube el pH a 7 con NaOH. Filtro estéril con filtros de 0,22 m y guárdelo a 4 oC.
  3. Divida las células en seis pozos (aproximadamente 150.000 células por pozo) y déjelas crecer durante la noche en 10% FBS en medios DMEM.
  4. Aliquot 1 g del gen del reportero en un tubo estéril y añadir 200 ml de NaCl filtrado estéril de 150 mM. Mezclar con el ADN por vórtice.
  5. Añadir la solución PEI a esta mezcla y vórtice, centrífuga brevemente para recoger muestras en la parte inferior del tubo. Utilice una proporción de 1 g de ADN por cada 3 ml de PEI.
  6. Incubar a temperatura ambiente durante 10 minutos y luego añadir directamente a las células HEK 293.
  7. Incubar células HEK293 a 37oC, 5%CO2,durante la noche.
  8. Aísle el ARN para RT-PCR a través de un kit de aislamiento de ARN.

10. Tratamiento RNase R para eliminar ARN lineales

  1. Utilice 10 g de ARN total en un tubo libre de RNase.
  2. Añadir 10 l de tampón 10x R Nase R (0,2 M Tris-HCl (pH 8,0), 1 M KCl, 1 mM MgCl2) al ARN.
  3. Añadir RNase R al ARN (1 l a 20U).
  4. Añadir 1 l de glicol azul al ARN y llevar el volumen hasta 100 l con agua estéril.
  5. Incubar muestras a 37oC durante 30 min.
  6. Añadir 100 l de fenol/cloroformo y vórtice durante 1 min.
  7. Centrífuga a 21.000 x g durante 1 min para separar las fases.
  8. Tomar el sobrenadante (fase acuosa) y añadir 1 volumen (alrededor de 80 l de cloroformo).
  9. Vórtice durante 1 min, y luego centrifugar durante 1 min para separar las fases.
  10. Tomar sobrenadante, añadir 1:10 vol KAc y 2.5 vol etanol, y precipitar a -20 oC para 1-4 h. Centrifugar a 4 oC durante 30 minutos a toda velocidad (21.000 x g). Habrá un pequeño pellet azul en la parte inferior.
  11. Retire el sobrenadante y lávelo con un 80% de etanol. Dejar secar al aire durante 5 minutos a temperatura ambiente y disolver en agua de 10 s.

11. Análisis RT-PCR

  1. Utilice 1 g de ARN por reacción RT.
  2. Hacer una mezcla de reacción para un volumen total final de 20 s por reacción. Para una reacción, utilice 1 l de dNTPs de 10 mM, 1 l de ditiothreitol de 0,1 M (TDT), 4 ml de búfer de primera cadena de 5 x y 0,5 ml de transcriptasa inversa.
  3. Aliquot 6,5 l de mezcla de reacción en nuevos tubos PCR.
  4. Mezclar hasta 5 imprimaciones en una sola mezcla. Sin embargo, algunos imprimadores pueden emparejarse erróneamente con otros imprimadores en el PCR(Figura 5). Las secuencias de imprimación están en la Tabla 2. Usamos rutinariamente imprimaciones de unión de exónitos específicas de genes, pero también es posible cebar con hexamers aleatorios.
  5. Añadir 1 l de imprimación inversa de 10 m al tubo de reacción RT deseado.
  6. Añadir 1 g de ARN al tubo de reacción de PCR.
  7. Añadir H2O libre de RNase hasta un volumen total de 20 l.
  8. Esgire los tubos hacia abajo para eliminar los residuos en el lado de los tubos y colocarlos en el termociclador.
  9. Ejecuta la reacción RT en termociclador a 50oC durante 50 minutos.
  10. Almacene el ADNC RT a -20 oC o proceda a la reacción de la PCR.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Los genes reporteros permiten determinar factores reguladores que influyen en la formación circular de ARN. Sin embargo, estos genes reporteros son grandes y contienen elementos repetitivos que a menudo hacen que las construcciones de ADN sean inestables. Debido a su gran tamaño, a menudo es necesario eliminar partes de los intrones, lo que se logra mediante la amplificación de piezas genómicas que contienen los exons y partes intrónicas de flanqueo más pequeñas. Estas piezas de ADN se ensamblan enzimáticamente, permitiendo la construcción sin enzimas de restricción.

El ejemplo de un ARN circular generado a partir del microtúbulo asociado a la proteína tau (MAPT) muestra una aplicación del enfoque minigene para analizar ARN circulares. El minigen tau 9-12 utilizado en este ejemplo fue co-transtrusado con diferentes factores de empalme y el efecto de estos factores de empalme fue detectado por RT-PCR(Figura 6). Diferentes factores de acción trans influyen tanto en el ARN circular como en la formación lineal de pre-mRNA. El experimento también muestra que todos los elementos de secuencia necesarios para la formación de ARN circular están localizados en el fragmento clonado.

Figure 1
Figura 1: Visión general de la técnica. (A) Se muestra un gen hipotético. Los intrones son líneas, los exons son cajas, los elementos Alu son cajas de rayas más pequeñas. El backsplicing del exón C a a crea un ARN circular. La estructura de este ARN circular se muestra en el panel (E). (B) Para crear un gen de reportero, se amplifican los exons y los intrones circundantes (al menos 500 nt en cada lado). Las construcciones deben contener elementos repetitivos, que generalmente son elementos Alu en los seres humanos. Se incluyó un exón aguas arriba del exón A para proporcionar un elemento Alu adicional. Los fragmentos genómicos se superpondrán con sus 25 nts de flanqueo. (C) Los fragmentos se clonan en un vector de expresión, impulsado por un promotor de CMV. La recombinación correcta se detecta mediante la detección de imprimaciones y validada por secuenciación. (D) Las células están transllenadas con esta construcción. (E) ARN circular se aísla y (F) amplificado utilizando imprimaciones específicas de ARN circular, imprimaciones de unión exón preferibles. Durante la amplificación de PCR, el ARN lineal también se puede amplificar (G). (G) Orientación de las imprimaciones utilizadas para detectar ARN circulares. La imprimación hacia adelante es en sentido sentido orientación (es decir, tiene la misma secuencia que el ARN) y la imprimación inversa está en orientación antisentido (es decir, es el complemento inverso del ARN). Tenga en cuenta que, a diferencia de RT-PCR para los ARNM lineales, la imprimación inversa es aguas arriba de la imprimación directa. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Selección de la secuencia para la construcción de minigénicos. (A) Visualización del navegador después de que la secuencia mostrada en la Figura Suplementaria 1 se ejecute en la base de datos genómica humana utilizando BLAT. Los números de exón de literatura36 se indican en la pantalla del gen, son diferentes de los números dados por el navegador.
1. Las secuencias alineadas se muestran en 'YourSeq'
2-4. Tenga en cuenta que debido a la circularidad del ARN, BLAT no conecta todos los exons con líneas como lo hace en el ARN lineal. Los exons 10 y 11 (correspondientes a 2 y 3) están conectados, pero el exón 12 (correspondiente a 4) no está conectado al exón 11.
5. Los elementos Alu se muestran en la pista de elementos repetitivos.
(B) Alineación secuencial entre la construcción planificada y el ADN genómico.
6. La construcción planificada se ejecutó en la base de datos mediante BLAT.
7. Tenga en cuenta la inclusión de varios elementos Alu en la construcción. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Ejemplo de los amplicons antes de la clonación. (A) Productos PCR optimizados separados en un gel de agarosa del 1% que contiene 1gelGreen. Las bandas individuales representan los productos de PCR que se utilizarán en el ensamblaje de ADN enzimático. (B) Las bandas de (A) se cortaron del gel y se purificaron. Los productos de PCR purificados se separaron en un gel de agarosa del 1%, que posteriormente se tiñó con bromuro de etidio. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: Análisis de restricciones de genes de reportero. El minigen tau 9-12 utilizado como ejemplo fue cortado con enzimas de restricción indicadas para descartar recombinaciones importantes. Carril 1: corte con NcoI tamaños esperados 735 bp, 3345 bp, 6266 bp, carril 2 cortado con XbaI tamaño esperado 10346 bp, carril 3 cortado con HindIII tamaños esperados 3951 bp, 6395 bp, carril 4 cortado con Tamaños esperados De SmaI 1168 bp, 1688 bp, 2708 bp, 4782 bp.

Figure 5
Figura 5: Efecto de la multiplexación de imprimación y el tratamiento RNase R en la detección circular de ARN. (A) cDNA de las muestras A y B derivadas de los tejidos cerebrales humanos se amplificó con imprimaciones de ARN circulares circTau exon12_10 Reverse y circTau exon10_11 Forward. La transcripción inversa para el ADNc se realizó con las imprimaciones para ARN tau lineal y circular. La banda esperada correspondiente al ARN circular tau se muestra mediante un triángulo. Las otras bandas fuertes son artefactos que no coincidieron con el genoma humano. (B) El experimento se repitió con condiciones de PCR idénticas, pero la transcripción inversa se realizó sólo con la imprimación circTau exon12_10 Inversa. Sólo la banda esperada fue amplificada y validada a través de la secuenciación. (C) El ARN fue tratado con RNase R que elimina el ARN lineal. El ARN circular es detectable después del tratamiento (izquierda), mientras que el ARN lineal ya no da una señal detectable (derecha) Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6: Ejemplo de un análisis de un gen de reportero de circRNA. 1 g del gen del reportero tau 9-1237 se transfectó con 1 g de factores de empalme indicados. El ARN fue aislado 24 h después de la transfección y analizado por RT-PCR. (A) Amplificación del ARNm de tau lineal. Debido al empalme alternativo del exón 10 se observan dos bandas. Su relación cambia debido a la sobreexpresión de los factores de empalme38,39. (B) Amplificación del ARN circular 12-10 tau23. Observe la dependencia de la expresión tau circRNA en la expresión de algunos factores de empalme, especialmente el cdc2 como la quinasa clk2 y la proteína SR 9G8. (C) El ARN circular de HIPK3 se utilizó como un control positivo que indica la misma carga. Haga clic aquí para ver una versión más grande de esta figura.

Tabla 1: Lista de minigenes actuales que expresan ARN circulares. Haga clic aquí para descargar este archivo.

Circular HIPK3 Control Primers
HIPK3 Invertir
HIPK3 Adelante
TGCTTGGCTCTACTTTGAGTTTC
TCGGCCAGTCATGTATCAAAA
Primers lineales
Tau Exon 12 Reverse
Tau Exon 9 Forward
CCCAATCTTCGACTGGACTC
TGTCAAGTCCAAGATCGGCT
Imprimaciones circulares
circTau exon12_10 Invertir
circTau exon10_11 Adelante
CAGCTTCTTATTAATTATCTGCACCTTTT
GAGGCGGCAGTGTGCAAA

Tabla 2: Lista de Imprimaciones.

Supplemental Figure 1
Figura suplementaria 1: Secuencia de prueba de ARN circular Tau. Secuencia de prueba correspondiente a un ARN circular del locus MAPT. Diferentes exones se indican con subrayado, gorras pequeñas y tapas grandes. Haga clic aquí para ver una versión más grande de esta figura.

Supplemental Figure 2
Figura suplementaria 2: Secuencia genómica que contiene el minigen planificado. Los exons se resaltan en color y los elementos repetitivos están subrayados, cursiva y negrita. El sombreado gris indica regiones flanqueantes de baja complejidad que se pueden utilizar para generar imprimaciones. Haga clic aquí para descargar este archivo.

Supplemental Figure 3
Figura complementaria 3: Secuencias del gen del reportero planificado. Se muestran la secuencia vectorial y los fragmentos genómicos planificados. Haga clic aquí para descargar este archivo.

Supplemental Figure 4
Figura suplementaria 4: Diseño de imprimaciones para montaje. La secuencia de la Figura suplementaria 3 se introdujo en la herramienta del generador. Haga clic aquí para ver una versión más grande de esta figura.

Supplemental Figure 5
Figura suplementaria 5: Secuencia del gen de reportero tau 9->12 utilizado como ejemplo. Haga clic aquí para descargar este archivo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En general, los ARN circulares son de bajo abundante1, lo que complica el estudio de su función y formación. Al igual que los ARN lineales13,el uso de minigenes de reportero permite la identificación de cis y factores de acción trans que regulan la formación de ARN circulares. Por lo tanto, este enfoque genera hipótesis que se pueden probar aún más utilizando los genes endógenos.

El paso más crítico es el diseño del gen reportero. El conjunto enzimático de fragmentos de ADN ("Clonación Gibson"27) facilita este diseño, ya que permite la construcción de grandes genes reporteros independientes de los sitios de restricción.

Los sitios de empalme posterior se reúnen a través de repeticiones invertidas flanqueantes, que deben tenerse en cuenta en la construcción del gen reportero. Las repeticiones se anotan en el navegador del genoma 'pista de repetición' y al seleccionarlas se muestra su orientación. Tenga en cuenta que las proteínas también pueden forzar los sitios de empalme posterior en una estructura secundaria necesaria para la expresión de ARN circular28 y para un análisis imparcial 1-2 kb de regiones indirectas de flanqueo debe ser investigado.

Para garantizar la estabilidad de las construcciones, una consideración importante es el tipo de cepas bacterianas y sus condiciones de crecimiento. Para las construcciones más cortas, se utilizan bacterias de clonación estándar de construcciones simples, que son casi idénticas a DH5-alfa (huA2 (argF-lacZ)U169 phoA glnV44 a 80 o80 o 80 o80 o 80 o (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). Para fragmentos más largos, que contengan más de 6 elementos Alu, Se utilizan células competentes "estables" que carecen de una recombinasa (recA) y endonucleasa (endA1) (F' proA+B+ lacIq (lacZ)M15 zzf::Tn10 (TetR) 9 fhu -A lacX74 galK16 galE15 e14- á80dlacZ-M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1(mrr-hsdRMS-mcrBC). Si aparecen problemas con la recombinación, indicadopor los recuentos de baja transformación, placar las bacterias transformadas en dos placas y dejarlas crecer a 30 oC y 37 oC, respectivamente. Debido a la presencia de numerosos elementos repetitivos en los minigenes, deben ser completamente secuenciados utilizando la secuenciación de próxima generación, que está disponible comercialmente por alrededor de $150 por plásmido a las tarifas de 2019. La secuencia del ejemplo se muestra en la Figura suplementaria 5. Además, el análisis de polimorfismo de longitud de fragmento de restricción para una nueva preparación más grande de las construcciones se realiza rutinariamente. Por ejemplo, el uso de sitios que cortan 1-4 veces da como resultado un patrón de banda característica que descarta las recombinaciones (Figura 4). Se deben seleccionar enzimas que den un patrón característico de banda de fragmentos que se pueden separar en un gel de agarosa.

Los ARN circulares se analizan con RT-PCR utilizando imprimaciones de unión exón que se superponen con el evento de backsplicing(Figura 1F). Debido a la naturaleza circular del ARN, la imprimación inversa (es decir, antisentido) es aguas arriba de la imprimación delantera (es decir, sentido)(Figura 1G). Los primeros que detectan elARN circular 1 de la proteína quinasa 3 (HIPK3) que interactúa con el homeodominio(asinteridad abundantemente expresado) se utilizan como control positivo. Las imprimaciones inversas específicas HIPK3 y minigene se transcriben inversamente en el mismo tubo, lo que permite su comparación. Las reacciones de PCR se realizan con imprimaciones que amplifican los ARNM lineales para comparar patrones de procesamiento de pre-ARNM circulares y lineales. Frecuentemente observamos bandas aberrantes cuando se mezclaban imprimaciones para ARN lineales y circulares(Figura 5),y así mantenemos separada la transcripción inversa de estas muestras.

El análisis RT-PCR de los ARN circulares es un reto y debe controlarse cuidadosamente. Aunque es sensible y conveniente, puede producir artefactos únicos para los ARN circulares29. La transcriptasa inversa puede moverse varias veces alrededor del círculo de ARN, lo que genera concatemers. La mayoría de los genes reporteros de ARN circular generan ARN circular y lineal, lo que puede hibridar, lo que lleva a más artefactos de PCR21,30,31. Por lo tanto, es imprescindible secuenciar los productos de PCR y validar los hallazgos utilizando diferentes técnicas utilizando las protecciones Northern blots32 o RNase23.

Las bandas inexplicables también pueden originarse a partir de la amplificación aberrante del ARN lineal. El ARN lineal se puede eliminar utilizando la exonucleasa RNase R, que enriquece los ARN circulares33 (Figura 5C). El tratamiento RNase R ayuda en la optimización inicial de las imprimaciones de detección y a menudo se puede omitir una vez que se optimizan los imprimadores.

El empalme posterior alternativo también puede contribuir a bandas inexplicables, ya que se pueden formar varios ARN circulares a partir de un locus genómico34. Este empalme posterior alternativo es a menudo el resultado de estructuras pre-mRNA competidoras formadas por más de dos elementos de repetición invertidos. Además, los sitios crípticos de back-splice pueden ocurrir32,35. Dependiendo del objetivo experimental, los elementos Alu se pueden repetir o agregar a las construcciones. Las regiones complementarias que flanquean los sitios de empalme posterior pueden ser tan cortas como 30-40 nt35 y la sustitución de elementos Alu por regiones complementarias más cortas puede aumentar la formación de ARN circular2,que se puede probar para mejorar la formación de ARN circular. Una vez identificadas las secuencias previas al ARNm que causan el traspise posterior, es posible acortar las construcciones de expresión de ARN circular, lo que puede mejorar la eficiencia de la transfección en algunos casos.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Nada que revelar.

Acknowledgments

Este trabajo fue apoyado por la concesión AZ180075 del Departamento de Defensa. Stefan Stamm gracias Jacqueline Noonan Endowment. Anna Pawluchin fue apoyada por el DAAD, programa de intercambio académico alemán, Justin R. Welden fue galardonado con el Premio de la Universidad de Kentucky Max Steckler.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Uso de Minigenes que contienen <em>elementos Alu</em> para analizar ARN circulares
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter