Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Användning av Alu Element som innehåller Minigenes för att analysera cirkulära RNA

doi: 10.3791/59760 Published: March 10, 2020

Summary

Vi klonar och analyserar reportergener som genererar cirkulära RNAs. Dessa reporter gener är större än konstruktioner för att analysera linjär splitsning och innehåller Alu element. För att undersöka de cirkulära RNA transfecteds konstruktionerna till celler och resulterande RNA analyseras med RT-PCR efter borttagning av linjärRNA.

Abstract

Förutom linjära mRNAs genererar många eukaryota gener cirkulära RNA. De flesta cirkulära RNAs genereras genom att gå med i en 5 'skarv plats med en uppströms 3 ' skarv plats inom en pre-mRNA, en process som kallas back-split. Denna cirkulärisering är sannolikt med hjälp av sekundära strukturer i pre-mRNA som föra skarv platser i närheten. I mänskliga gener, Alu element tros främja dessa sekundära RNA strukturer, som Alu element är rikliga och uppvisar bas komplementarities med varandra när de finns i motsatta riktningar i pre-mRNA. Här beskriver vi generering och analys av stora, Alu-element som innehåller reportergener som bildar cirkulära RNAs. Genom optimering av kloningsprotokoll kan reportergener med upp till 20 kb skärlängd genereras. Deras analys i samtransfection experiment gör det möjligt att identifiera regleringsfaktorer. Således kan denna metod identifiera RNA-sekvenser och cellulära komponenter som deltar i cirkulär RNA-bildning.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cirkulära RNAs
Cirkulära RNAs (circRNAs) är kovalent slutna enda strandsatta RNAs som uttrycks i de flesta organismer. De genereras genom att gå med i en nedströms 5's skarv plats till en uppströms 3 'skarv plats, en process som kallas back-split(figur 1A)1. Sekvenser i pre-mRNA som uppvisar bas kompletterande så kort som 30-40 nt föra back-skarv platser i korrekt anpassning för circRNA formation2. Hos människor bildar Alu element1, som representerar cirka 11% av genomet3, omfattande dubbla strandsatta RNA strukturer i pre-mRNA på grund av deras självkomplementaritet4,5 och därmed främja bildandet av circRNAs1.

För närvarande har tre viktiga funktioner circRNAs beskrivits. Vissa circRNAs binder microRNAs (miRNAs) och genom kvarstad agera som miRNA svampar6. CircRNAs har varit inblandad i transkriptions- och posttranskriptionsreglering, genom konkurrens med linjär splitsning7 eller modulering av transkriptionsfaktoraktivitet8. Slutligen innehåller circRNAs korta öppna läsramar och bevis på principstudier visar att de kan översättas9,10. Funktionen hos de flesta circRNAs förblir dock gåtfull. Majoriteten av cirkulära RNA har upptäckts med hjälp av nästa generations sekvenseringsmetoder11. Detaljerade analyser av enskilda gener med hjälp av riktade RT-PCR-metoder visar att ett stort antal cirkulära RNAs återstår att upptäcka12.

Användning av reportergener för att analysera pre-mRNA-bearbetning
Analysen av mRNA som härrör från DNA-reporter konstruerar transfected i celler är en väletablerad metod för att studera alternativa pre-mRNA splitsning, som kan tillämpas på cirkulära RNAs. I allmänhet förstärks och klonas den alternativa exonen, dess omgivande introner och konstituerande exons och klonas till en eukaryota uttrycksvektor. Ofta förkortas intronerna. Konstruktionerna är transfected i eukaryota celler och vanligtvis analyseras av RT-PCR13,14. Detta tillvägagångssätt har använts i stor utsträckning för att kartlägga reglerande skarvplatser och transverkande faktorer i samtransfection experiment13,15,16,17,18. Dessutom gjorde genereringen av proteinuttryckande minigener det möjligt att undersöka ämnen som ändrar alternativa skarvningar 19,20.

Metoden har tillämpats på cirkulära RNA. För närvarande har minst 12 minigena ryggrader beskrivits i litteraturen och sammanfattas i tabell 1. Med undantag för det tRNA-baserade uttryckssystemet21,22, är de alla beroende av polymeras II-initiativtagare. Här beskriver vi en metod för att generera mänskliga reporter minigener för att bestämma cis och transverkande faktorer som är involverade i genereringen av cirkulära RNA. En översikt över metoden med hjälp av sekvenser av en publicerad reporter gen23 visas i figur 1.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Konstruktionernas konstruktioner

  1. Använd UCSC genomen webbläsare24 för att identifiera repetitiva element som är nödvändiga för cirkulär RNA-bildning och införliva dem i konstruktionerna. Viktigt, primers för förstärkning måste vara utanför repetitiva element.
  2. Klistra in den cirkulära RNA-sekvensen(kompletterande figur 1 är en testsekvens) i https://genome.ucsc.edu/cgi-bin/hgBlat?command=start och välj rätt organism. Skicka sekvensen och gå till webbläsarvyn, zooma ut 1,5 x eller i förekommande fall(bild 2A).
    Söksekvensen visas på den översta raden (bild 2A, 1). Beroende på exonernas ordning i den cirkulära RNA kommer BLAT inte att ansluta alla exons. I det här exemplet är exon 12(figur 2A, 4) inte ansluten till 11 ( figur2A, 2, 3), eftersom exon 12 är uppströms av exon 11 i den cirkulära RNA-sekvensen (tilläggsfigur 1). De repetitiva elementen finns i "repeat masker"-spåret, indikerat av lådor, där svart till grå färg indikerar evolutionärt bevarande (figur 2A, 5).
  3. Musen över de repetitiva elementen för att identifiera deras undertyp i ett flytande fönster. Alu element är i SINE (kort varvat kärnämne) linje. Använd knappen "standardspår" under fönstret för att återställa webbläsaren om en annan bild än figur 2 erhålls.
    OBS: Mousing över exons i gendisplayen genererar ett fönster med exon nummer som är datorgenererade. Dessa siffror motsvarar inte den exonnumrering som fastställts i litteraturen och även förändring mellan isoformer.

2. Välj den sekvens som ska klonas i en uttrycksvektor

  1. Ladda ner DNA-sekvensen som visas i fönstret genom att gå till Visa → DNA på den översta raden i UCSC genomwebbläsare. Välj Utökade case/color options i alternativet Sekvenseringsformatering.
  2. Välj standardfodralet som Gement och välj växlingsfall för NCBI refseq. Välj understrykning och fetstil och kursiv för Upprepa Masker. Klicka på Skicka. Det kommer att finnas exons som versaler och introner som små bokstäver. Kontrollera exon/introngränser.
  3. I det här exemplet finns det en "ccctttacCTTTTT"-sekvens, vilket indikerar att webbläsaren visar det omvända komplementet. Om så är fallet går du tillbaka och väljer den omvända komplementrutan tills du ser rätt exonintrongränser (agEXONgt), i det här exemplet AAAAAGgtaaaggg.
  4. Kopiera filen med rätt orientering (interna exons är omgivna av intronic ag... gt) i ett ordbehandlingsdokument och markera exonerna (tilläggsfigur 2).
    OBS: I det här exemplet är det genomiska fragmentet som omfattar exons 9-12 cirka 24 kb och därmed för stor för att förstärkas från genomiskt DNA. Därför är varje exon omgiven av ca 1 kb intronic region individuellt förstärks och dessa fyra fragment monteras i en kloning vektor.
  5. Välj fragment som ska förstärkas (exon ± 500 nt intron). Se till att intronen inte börjar eller slutar i en repetitiv region, eftersom grundfärger i dessa regioner inte kommer att förstärka specifika sekvenser. De valda områdena visas i figur 2B, och deras sekvenser visas i tilläggsfigur 3.
    OBS: I allmänhet, ju större konstruktioner, desto svårare kloning kommer att bli. Fragmenten kan monteras antingen steg vis (dvs. exon 9 kombineras med vektorn och i nästa steg exon 10 införs i denna konstruktion via kloning tills alla exons är på plats), eller alternativt är alla fragment monterade samtidigt. Ett stegvis tillvägagångssätt fungerar alltid men kräver mer tid. En samtidig montering fungerar inte alltid och beror på hur väl de enskilda fragmenten kan förstärkas från genomiskt DNA och på konstruktionens totala storlek. Vi börjar därför vanligtvis med båda metoderna samtidigt.

3. Design primers för kloning

  1. Använd ett webbverktyg(https://nebuilder.neb.com/#!/) för att utforma grundfärger för kloning. Ange till exempel fragment 9, 10, 11 och 12 och vektorsekvensen (Kompletterande figur 3) till det här verktyget.
  2. För vektorsekvensen lägger du till insättningsplatsen som den sista nukleotiden och lägger därefter till fragmenten. Eftersom vektornumreringen inte startar med en given insättningsplats placeras platsen för insättning i vektorn och den nedströmsdelen sätts in framför uppströmssekvensen. I det här exemplet börjar skären direkt efter HindIII [AAGCTT] plats och slutar direkt efter PMEI [GTTTAAAC] platsen för pcDNA3.1. Sekvensen från cccgctgatcag ... ccgtaaaaaggccgc klistras in framför position 1 i pcDNA3.1 sekvens (gttgctggcgtttttcc ...).
  3. Justera grundfärger om deras smältpunkter är mer än 4 °C isär, eftersom de inte kommer att fungera i förstärkning. Monteringen av de fragment och primersekvenser som utformats visas i tilläggsfigur 4. Primers för kloning kan också utformas manuellt25.

4. PCR- och amplicondetektering

  1. Standard PCR-reaktion: Gör en reaktionsblandning för total volym på 50 μL per reaktion. Nedan är receptet för en reaktion med polymeras 1:
    10 μL 5x reaktionsbuffert
    1 μL av 10 mM dNTPs
    2,5 μL 10 μM framåt primer
    2,5 μL 10 μM Omvänd Primer
    0,5 μL Polymeras 1
    32,5 μL Nuclease fritt H2O
    1. Lägg till 10 μL 5x GC Enhancer om produkten har högt GC-innehåll. göra en separat blandning som innehåller GC Enhancer för att testa PCR-reaktion.
  2. Alikvot49 μL av blandningen i PCR-rör per reaktionsprov.
  3. Tillsätt 1 μL DNA till PCR, mängden varierar från 10 pg till 1 ng.
  4. Snurra ner proverna för att avlägsna rester från sidorna och placera dem i en PCR-maskin. Använd samma maskin samt samma fläckar i maskinen när du optimerar PCR-förhållandena.

5. Optimering för längre DNA-fragment för användning av olika polymeraser

  1. Temperatur
    1. Optimera den långväga Polymerase 2.
      1. Använd en lägre denatureringstemperatur (Polymeras 1: 98 °C, Polymeras 2: 94 °C).
      2. Använd en längre denatureringstid (Polymeras 1: 10 s, Polymeras 2: 30 s).
      3. Använd en längre glödgningstid (Polymeras 1: 30 s, Polymeras 2: 60 s).
      4. Använd en längre förlängningstid (Polymeras 1: 30 s/kb, Polymerase 2: 50 s/kb).
      5. Använd en lägre förlängningstemperatur (Polymeras 1: 72 °C, Polymeras 2: 65 °C).
      6. Använd en glödgningstemperatur 5 °C under grundtopparnas Tm.
    2. Optimera primerkoncentrationerna (5x mindre till 5x mer än den ursprungliga primerkoncentrationen). Optimera DNA-koncentrationer från 10 pg till 50 pg, 100 pg, 1 ng, 5 ng, 10 ng.
    3. Som ett exempel på ett PCR-program för att förstärka en produktstorlek på 15 kb med Polymeras2, utför en första denaturering vid 94 °C för 30 s, DNA-denaturering vid 94 °C för 30 s följt av glödgning vid 58 °C för 30 s och DNA-förlängning vid 65 °C för 12 min 30 s. Utför en slutlig förlängning vid 65 °C i 10 min med en slutlig 4 °C håll.
      OBS: Glödgningstemperaturen (Ta) som är specifik för grundfärger som bestäms av webbaserade temperaturberäkningar som är specifika för varje polymeras. Förlängningstiderna kan variera och behöva optimeras om fragmenten är större än 10 kbbit.
  2. Förlängningstider och DNA-koncentrationer
    1. Använd längre förlängningstider för DNA-fragment över 6 kb: 1 min per 1 kb. Längre fragment bör använda mindre DNA.
    2. Utför utspädningar av DNA för att hitta den optimala DNA-koncentrationen för förstärkning, vanligtvis 1 pg till 1 ng för plasmider eller 1 ng till 1 μg för genomiskt DNA.
      OBS: För de flesta kloning användning polymeras 1, konstruerad genom att smälta Sso7d DNA bindande domän till en egenutvecklad termostabil DNA-polymeras26. Polymerasen har en låg felfrekvens och på grund av Sso7d-domänen behövs en hög processivitet, som behövs för att förstärka stora (10-15 kb) genomiska fragment. På grund av denna stora fragmentstorlek används enzymatisk sammansättning av DNA-molekyler27 för införande i vektorer, eftersom denna metod inte kräver begränsningsenzymer. Förstärkningen av fragment längre än 15 kb blir allt svårare med polymeras 1. För stora fragment förstärkning använda polymeras 2 tillverkad av pyrokock-liknandekorrekturläsning polymeras smält till Sso7d eller lång räckvidd PCR kit som ger dock högre felfrekvens.

6. Rening av PCR-produkter för kloning

  1. Kör hälften av PCR-produkterna på 1% agarose geler som innehåller en intercalating nukleinsyra fläck (t.ex. 1x GelGreen). Visualisera de färgade gelerna på en mörk läsares transilluminator. Detta färgade DNA går inte i sann till storlek.
    OBS: GelGreen intercalates till DNA, liknande ethidium bromid, men det är upphetsad av ljus runt 500 nm (cyan), en våglängd som inte skadar DNA, vilket avsevärt förbättrar kloning.
  2. Parallellt kör hälften av PCR-produkterna på en 1% gel som är färgad efter körning med ethidiumbromid (figur 3A,B).
  3. Punktskatteband av rätt storlek från den färgade gelen (steg 6.1) och isolera DNA med hjälp av en gel och PCR saneringssats. I avvikelse från standardprotokollet, elute DNA i endast 20 μL dubbeldestillerat vatten, som vanligtvis DNA-koncentrationerna är låga.
  4. Kontrollera före kloning det isolerade DNA:t på en agarosgel för koncentration och integritet (figur 3B). Sikta på ett 2:1 molar skär till vektorförhållande. När du använder flera skär är förhållandet 2:2:2:1.

7. DNA-sammansättning och klondetektion

OBS: Kloning sker med hjälp av en enzymatisk DNA-monteringssats, med mindre ändringar. Monteringen utförs i 60 min vid 50 °C och i allmänhet används det lägre DNA-intervallet för montering (20-100 fmol/20 μL reaktion). Hela reaktionsblandningen tillsätts kemiska behöriga celler och hela cellerna pläteras ut på en 6 cm agarplatta.

  1. Kombinera vektorn och sätt i ett 1:2 molarförhållande (20-500 fmol vardera) i 10 μL vatten.
  2. Tillsätt 10 μL DNA Assembly Master Mix.
  3. Inkubera prover i 60 minuter vid 50 °C.
  4. Omforma sedan behöriga celler med den totala monteringsreaktionen. Här använder du E. coli strain 1 celler för kortare konstruktioner eller E. coli stam 2 celler för längre eller instabila konstruktioner. Cellerna ska vara i en volym på 50 μL.
  5. Tina celler på is och tillsätt 2 μL av den kylda monterade produkten till de behöriga cellerna. Blanda genom att försiktigt snärta röret 4-5 gånger. Virvel inte.
  6. Låt blandningen sitta på is i 30 min.
  7. Värmechock vid 42 °C för 30 s. Blanda inte.
  8. Överför röret tillbaka till isen i 2 min.
  9. Tillsätt 950 μL av SOC-media i rumstemperatur till röret.
  10. Inkubera reaktionsröret vid 37 °C i 60 min. Skaka kraftigt (300 rpm).
  11. Varma urvalsplattor med lämpligt antibiotikum under inkubation vid 37 °C.
  12. Pellet cellerna genom centrifugering (10.000 x g,30 s) och plattan ut 1/4 och 3/4 av celler på två urvalsplattor och inkubera vid 37 °C över natten.

8. Validering av kloner

  1. Använd colony PCR, med PCR-grundfärger som spänner över monteringsplatserna (figur 1C) för detektion.
  2. Ta en steril tandpetare och rör vid en enda bakteriekoloni.
  3. Vidrör botten av ett PCR-rör med tandpetaren som har kolonin och sedan strimma tandpetare på en antibiotikaagarplatta, inkubera den streckade plattan vid 37 °C eller rumstemperatur för känsliga konstruktioner över natten.
  4. Överlägg PCR röret rörd med kolonin med en PCR mix som innehåller detektionsprimers. Dessa är utformade med primer 3(http://bioinfo.ut.ee/primer3-0.4.0/). Programmet har möjlighet att tvinga primer design över en definierad sekvens med "[ccc]" tecken för att välja primers över monteringspunkten. DNA från positiva stammar isoleras och verifieras genom sekvensering.

9. Analys av cirkulärRNA som uttrycker reportergener

  1. För analys, transfect reporter gener i eukaryota celler. Här använder hek293 celler (ATTC #CRL-1573) eftersom de ger hög transfection effektivitet. För att spara kostnader, använd PEI(polyetenimin) lösningar.
  2. För PEI-lösningen, lös linjär polyeteniminhydroklorid (PEI) vid 1 mg/ml i vatten vid lågt pH, pH 2. Ta upp pH till 7 med NaOH. Sterilt filter med 0,22 μm filter och förvaras vid 4 °C.
  3. Dela celler i sex brunnar (cirka 150.000 celler per brunn) och låt dem växa över natten i 10% FBS i DMEM media.
  4. Alikvot 1 μg av reportergenen i ett sterilt rör och tillsätt 200 μL sterilt filtrerat 150 mM NaCl. Blanda med DNA genom att virvla.
  5. Lägg PEI lösning till denna mix och virvel, kort centrifug för att samla prover längst ner på röret. Använd ett förhållande på 1 μg DNA per 3 μL PEI.
  6. Inkubera i rumstemperatur i 10 min och lägg sedan direkt till HEK 293 celler.
  7. Inkubera HEK293 celler vid 37 °C, 5% CO2, över natten.
  8. Isolera RNA för RT-PCR via en RNA-isoleringsssats.

10. RNase R-behandling för att ta bort linjära RNA

  1. Använd 10 μg total RNA i ett RNase-fritt rör.
  2. Tillsätt 10 μL 10x RNase R-buffert (0,2 M Tris-HCl (pH 8.0), 1 M KCl, 1 mM MgCl2) till RNA.
  3. Lägg till RNase R i RNA (1 μl = 20E).
  4. Tillsätt 1 μL glykolblått till RNA och för upp volymen upp till 100 μL med sterilt vatten.
  5. Inkubera prover vid 37 °C i 30 min.
  6. Tillsätt 100 μL fenol/kloroform och virvel i 1 min.
  7. Centrifugera vid 21 000 x g i 1 min till separata faser.
  8. Ta supernatanten (vattenfasen) och tillsätt 1 volym (ca 80 μL kloroform).
  9. Vortex i 1 min, och sedan centrifugera i 1 min till separata faser.
  10. Ta supernatant, tillsätt 1:10 vol KAc och 2,5 vol etanol, och fäll vid -20 °C för 1-4 h. Centrifug vid 4 °C i 30 min vid full hastighet (21.000 x g). Det kommer att finnas en liten blå pellet i botten.
  11. Ta bort supernatanten och tvätta med 80% etanol. Låt lufttorka i 5 minuter i rumstemperatur och lös upp i 10 μL vatten.

11. RT-PCR-analys

  1. Använd 1 μg RNA per RT-reaktion.
  2. Gör reaktionsblandning för en slutlig total volym på 20 μL per reaktion. För en reaktion, använd 1 μL 10 mM dNTPs, 1 μL av 0,1 M Dithiothreitol (DTT), 4 μL 5x First-Strand Buffer och 0,5 μL omvänd transkriptas.
  3. Aliquot 6,5 μL reaktionsblandning i nya PCR-rör.
  4. Blanda upp till 5 grundfärger i en blandning. Vissa grundfärger kan dock felkoppla med andra grundfärger i PCR (figur 5). Primer-sekvenser finns i tabell 2. Vi använder rutinmässigt genspecifika exon-junction primers men priming med slumpmässiga hexamers är också möjligt.
  5. Tillsätt 1 μL på 10 μM Omvänd primer till önskat RT-reaktionsrör.
  6. Tillsätt 1 μg RNA till PCR reaktionsrör.
  7. Tillsätt RNase-fri H2O upp till en total volym på 20 μL.
  8. Snurra rören nedåt för att avlägsna rester på sidan av rören och placera i thermocycler.
  9. Kör RT-reaktionen i termocykeliska vid 50 °C i 50 minuter.
  10. Förvara RT cDNA vid -20 °C eller fortsätt till PCR-reaktionen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reporter gener tillåter bestämning av reglerande faktorer som påverkar cirkulär RNA-bildning. Dessa reportergener är dock stora och innehåller repetitiva element som ofta gör DNA-konstruktioner instabila. På grund av deras stora storlek är det ofta nödvändigt att ta bort delar av intronerna, vilket uppnås genom att förstärka genomiska bitar som innehåller exons och mindre flankerande introniska delar. Dessa DNA-bitar är enzymatically monterade, vilket möjliggör konstruktion utan begränsning enzymer.

Exemplet med en cirkulär RNA som genereras från mikrotubuli associerade protein tau (MAPT) visar en tillämpning av minigene metoden för att analysera cirkulära RNAs. Tau 9→12 minigene som används i detta exempel var co-transfected med olika splitsning faktorer och effekten av dessa splitsning faktorer upptäcktes av RT-PCR(figur 6). Olika transverkande faktorer påverkar både cirkulärRNA och linjär pre-mRNA-bildning. Experimentet visar också att alla sekvenselement som behövs för cirkulär RNA-bildning är lokaliserade i det klonade fragmentet.

Figure 1
Bild 1: Översikt över tekniken. ( A) En hypotetisk gen visas. Introner är linjer, exons är lådor, Alu element är mindre randiga lådor. Backsplicing från exon C till A skapar en cirkulär RNA. Strukturen på denna cirkulära RNA visas i panelen (E). (B) För att skapa en reporter gen, exons och omgivande introns (minst 500 nt på varje sida) förstärks. Konstruktionerna bör innehålla repetitiva element, som vanligtvis är Alu-element hos människor. En exon uppströms exon A ingick för att ge ytterligare alu element. Genomiska fragment en överlappning med sina flankerande 25 nts. (C)Fragment klonas till en uttrycksvektor som drivs av en CMV-promotor. Den lyckade rekombinationen upptäcks genom detektionsprimers och valideras genom sekvensering. (D)Cellerna är transinfekterade med denna konstruktion. (E)CirkulärRNA är isolerat och(F)förstärks med cirkulära RNA-specifika grundfärger, att föredra exon junction primers. Under PCR-förstärkning kan även linjärRNA förstärkas (G). (G)Orientering av grundfärger som används för att upptäcka cirkulära RNA. Den främre primern är i avkänningsorientering (dvs. har samma sekvens som RNA) och den omvända primern är i antisenseorientering (dvs. är det omvända komplementet till RNA). Observera att skilja sig från RT-PCR för linjära mRNAs, är den omvända primern uppströms framåt primer. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: Val av sekvens för minigenkonstruktion. (A)Webbläsarvisning efter den sekvens som visas i tilläggsfigur 1 körs mot den mänskliga genomiska databasen med BLAT. Litteraturexonnummer36 anges i gendisplayen, de skiljer sig från de siffror som ges av webbläsaren.
1. De justerade sekvenserna visas under "YourSeq"
2-4. Observera att BLAT på grund av RNA:s cirkuläritet inte ansluter alla exons med linjer som det gör i linjärRNA. Exons 10 och 11 (motsvarande 2 och 3) är anslutna, men exon 12 (motsvarande 4) är inte ansluten till exon 11.
5. Alu-element visas i det repetitiva elementspåret.
(B)Sekvensjustering mellan den planerade konstruktionen och genomisk DNA.
6. Den planerade konstruktionen kördes mot databasen med BLAT.
7. Observera införandet av flera Alu-element i konstruktionen. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: Exempel på amplicons före kloning. (A)Optimerade PCR-produkter åtskilda på en 1% agarose gel som innehåller 1x GelGreen. De enskilda banden representerar PCR-produkterna som kommer att användas i enzymatisk DNA-sammansättning. (B)Banden från(A)skars ut ur gelen och renades. De renade PCR-produkterna separerades på en 1% agarose gel, som därefter färgas med ethidiumbromid. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: Begränsningsanalys av reportergener. Tau 9-12 minigene används som ett exempel skars med begränsning enzymer som anges för att utesluta stora rekombinationer. Körfält 1: skär med NcoI förväntade storlekar 735 bp, 3345 bp, 6266 bp, körfält 2 klippa med XbaI förväntade storlek 10346 bp, körfält 3 skära med HindIII förväntade storlekar 3951 bp, 6395 bp, körfält 4 klippa med SmaI förväntade storlekar 1168 bp, 1688 bp, 2708 bp, 4782 bp. Klicka här för att se en större version av denna siffra.

Figure 5
Bild 5: Effekten av primer multiplexing och RNase R behandling på cirkulär RNA upptäckt. (A)cDNA från prover Na och B som härrör från mänskliga hjärnvävnader förstärktes med cirkulära RNA-primers circTau exon12_10 Reverse och circTau exon10_11 Framåt. Den omvända transkriptionen för cDNA utfördes med grundfärger för linjära och cirkulära tau RNA. Det förväntade bandet som motsvarar tau cirkulärRNA visas av en triangel. De andra starka banden är artefakter som inte matchade det mänskliga genomet. (B) Experimentet upprepades med identiska PCR villkor, men omvänd transkription utfördes endast med circTau exon12_10 Omvänd primer. Endast det förväntade bandet förstärktes och validerades genom sekvensering. (C)RNA behandlades med RNase R som tar bort linjärRNA. Den cirkulära RNA är detekterbar efter behandlingen (vänster), medan linjärRNA ger inte längre en detekterbar signal (höger) Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: Exempel på en analys av en circRNA-reportergen. 1 μg av tau 9→1237 reportergenen transfecteds med 1 μg splitsningsfaktorer indikerade. RNA isolerades 24 h post transfection och analyseras av RT-PCR. (A)Förstärkning av den linjära tau mRNA. På grund av alternativa splitsning av exon 10 två band observeras. Deras förhållande ändras på grund av överuttryck av splitsning faktorer38,39. (B)Förstärkning av cirkulär12→10 tau RNA23. Notera beroendet av tau circRNA uttryck på uttryck för vissa splitsbildning faktorer, särskilt cdc2 som kinas clk2 och SR protein 9G8. (C)HIPK3:s cirkulära RNA användes som en positiv kontroll som indikerar lika belastning. Klicka här för att se en större version av denna siffra.

Tabell 1: Lista över aktuella minigener som uttrycker cirkulära RNA. Klicka här för att ladda ner den här filen.

CirkulärA HIPK3-styrprimer
HIPK3 Omvänd
HIPK3 framåt
TGCTTGGCTCTACTTTGAGTTTC
TCGGCCAGTCATGTATCAAA
Linjära primers
Tau Exon 12 Omvänd
Tau Exon 9 Framåt
CCCAATCTTCGACTGGACTC
TGTCAAGTCCAAGATCGGCT
Cirkulära primers
circTau exon12_10 Omvänd
circTau exon10_11 framåt
CAGCTTCTTATTAATTATCTGCACCTTTTT
GAGGCGGCAGTGTGCAA

Tabell 2: Lista över primers.

Supplemental Figure 1
Kompletterande figur 1: Tau cirkulär RNA testsekvens. Testsekvens som motsvarar en cirkulär RNA från MAPT-locus. Olika exons indikeras av understrykning, kapsyler och stora lock. Klicka här för att se en större version av denna siffra.

Supplemental Figure 2
Kompletterande figur 2: Genomisk sekvens som innehåller den planerade minigenen. Exons är markerade i färg och repetitiva element är understrukna, kursiva och djärva. Grå skuggning indikerar flankerande områden med låg komplexitet som kan användas för att generera primers. Klicka här för att ladda ner den här filen.

Supplemental Figure 3
Kompletterande figur 3: Sekvenser av den planerade reportergenen. Vektorsekvensen och de planerade genomiska fragmenten visas. Klicka här för att ladda ner den här filen.

Supplemental Figure 4
Kompletterande figur 4: Primers design för montering. Sekvensen från tilläggsfigur 3 skrevs in i byggverktyget. Klicka här för att se en större version av denna siffra.

Supplemental Figure 5
Kompletterande figur 5: Sekvens av tau 9->12 reporter gen som används som ett exempel. Klicka här för att ladda ner den här filen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I allmänhet cirkulära RNAs är låga rikliga1, vilket komplicerar studiet av deras funktion och bildning. I likhet med linjära RNAs13, användningen av reporter minigenes tillåter identifiering av cis och transverkande faktorer som reglerar bildandet av cirkulära RNA. Således genererar detta tillvägagångssätt hypoteser som kan testas ytterligare med hjälp av endogena gener.

Det mest kritiska steget är utformningen av reportergenen. Den enzymatiska sammansättningen av DNA-fragment ("Gibson kloning"27) underlättar denna design, eftersom det möjliggör konstruktion av stora reporter gener oberoende av begränsning platser.

De back-splitsning platserna förs samman genom flankerande inverterade upprepningar, som bör beaktas i reporter genkonstruktion. Upprepningarna är kommenterade i genombläddrarens webbläsare "upprepa spår" och välja dem visar deras orientering. Tänk på att proteiner också kan tvinga back-splitsning splicing platser i en sekundär struktur som behövs för cirkulärRNA uttryck28 och för en opartisk analys 1-2 kb flankerande introniska regioner bör undersökas.

För att säkerställa konstruktionernas stabilitet är en viktig faktor den typ av bakteriestammar och deras tillväxtförhållanden. För kortare används enkla konstruktioner standardkloningsbakterier, som är nästan identiska med DH5-alfa (huA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). För längre fragment, som innehåller mer än 6 Alu-element, "stabila" behöriga celler används som saknar rekombinas (recA) och endonuclease (endA1) (F' proA+B+ lacIq ∆(lacZ)M15 zzf::Tn10 (TetR) ∆(ara-leu) 7697 araD 139 fhuA ∆lacX74 galK16 galE15 e14- Φ80dlacZ∆M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 ∆(mrr-hsdRMS-mcrBC). Om problem uppträder med rekombination, indikeras av låga omvandlingsantal, platta de transformerade bakterierna på två plattor och låt dem växa vid 30 ºC respektive 37 ºC. På grund av närvaron av många repetitiva element i minigenesen måste de vara helt sekvenserade med hjälp av nästa generations sekvensering, som är kommersiellt tillgänglig för runt $ 150 per plasmid vid 2019 års priser. Sekvensen av exemplet visas i kompletterande figur 5. Dessutom utförs begränsningfragmentlängdpolymorfism analys för nya större beredning av konstruktionerna rutinmässigt. Om du till exempel använder webbplatser som skär 1-4 gånger resulterar det i ett karakteristiskt bandmönster som utesluter rekombinationer (figur 4). Enzymer bör väljas som ger ett karakteristiskt band mönster av fragment som kan separeras på en agarose gel.

Cirkulära RNAs analyseras med RT-PCR med exon junction primers som överlappar med backsplicing händelsen(Bild 1F). På grund av RNA:s cirkulära natur är den omvända (dvs. antisense)primern uppströms framåt (dvs. känsla) primer (figur 1G). Primers upptäcka rikligt uttryckt homeodomain-interagerande protein kinas 3 (HIPK3) cirkulärRNA1 används som en positiv kontroll. HIPK3 och minigene specifika omvänd primers är omvänd transkriberas i samma rör, vilket gör att deras jämförelse. PCR-reaktioner utförs med primers förstärka de linjära mRNAs att jämföra bearbetningsmönster av cirkulära och linjära pre-mRNAs. Vi observerade ofta avvikande band när grundfärger för linjära och cirkulära RNAs blandades(figur 5),och därmed hålla omvänd transkription av dessa prover separat.

RT-PCR-analys av cirkulära RNAs är utmanande och måste kontrolleras noggrant. Även känsliga och bekväma, kan det producera artefakter unika för cirkulära RNAs29. Den omvända transkriptasen kan röra sig flera gånger runt RNA-cirkeln, vilket genererar sammandragare. De flesta cirkulära RNA reporter gener genererar både cirkuläroch linjärRNA, som kan korshybridisera, vilket leder till fler PCR artefakter21,30,31. Det är därför absolut nödvändigt att sekvensera PCR-produkterna och validera resultaten med hjälp av olika tekniker med hjälp av norra blots32 eller RNase skydd23.

Oförklarliga band kan också härstamma från avvikande förstärkning av linjärRNA. LinjärRNA kan tas bort med hjälp av exonuclease RNase R, som berikar cirkulära RNAs33 (figur 5C). RNase R behandling hjälper till vid den första optimeringen av detektionsprimers och kan ofta utelämnas när primers är optimerade.

Alternativa back-splitsning kan också bidra till oförklarliga band som flera cirkulära RNAs kan bildas från en genomisk locus34. Denna alternativa back-splitsning är ofta resultatet av konkurrerande pre-mRNA strukturer som bildas av mer än två inverterade upprepa element. Dessutom kan kryptiska back-skarv platser förekomma32,35. Beroende på det experimentella målet kan Alu-element upprepas eller läggas till i konstruktionerna. De kompletterande regionerna som flankerar back-splitsningsplatser kan vara så korta som 30-40 nt35 och ersättning av Alu-element med kortare kompletterande regioner kan öka den cirkulära RNA-formationen2, som kan testas för att förbättra cirkulär RNA-bildning. När pre-mRNA sekvenser som orsakar back-splitsning har identifierats, är det därför möjligt att förkorta cirkulära RNA uttryckskonstruktioner, vilket kan förbättra transfection effektivitet i vissa fall.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Inget att avslöja.

Acknowledgments

Detta arbete stöddes av Försvarsdepartementet DoD bidrag AZ180075. Stefan Stamm tackar Jacqueline Noonan Endowment. Anna Pawluchin stöddes av DAAD, tyska akademiska utbytesprogram, Justin R. Welden var mottagare av University of Kentucky Max Steckler Award.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Användning av <em>Alu</em> Element som innehåller Minigenes för att analysera cirkulära RNA
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter