Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Summary

Here, we present an optimized protocol to rapidly and semiquantitatively measure ligand-receptor interactions in trans in a heterologous cell system using fluorescence microscopy.

Abstract

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse formation and maintenance. Many of these fundamental interactions occur in trans and are typically induced by heterophilic or homophilic interactions between cells expressing membrane anchored binding pairs. Elucidating how disease relevant mutations disrupt these fundamental protein interactions can provide insight into a myriad of cell biology fields. Many protein-protein interaction assays do not typically disambiguate between cis and trans interactions, which potentially leads to an overestimation of the extent of binding that is occurring in vivo and involve labor intensive purification of protein and/or specialized monitoring equipment. Here, we present an optimized simple protocol that allows for the observation and quantification of only trans interactions without the need for lengthy protein purifications or specialized equipment. The HEK cell aggregation assay involves the mixing of two independent populations of HEK cells, each expressing membrane-bound cognate ligands. After a short incubation period, samples are imaged and the resulting aggregates are quantified.

Introduction

Synaptic interactions facilitated by synaptic adhesion molecules are foundational for the development, organization, specification, maintenance and function of synapses and the generation of neural networks. The identification of these transsynaptic cell adhesion molecules is rapidly increasing; thus, it is fundamentally important to identify binding partners and understand how these new adhesion molecules interact with each other. Additionally, genome sequencing has identified mutations in many of these adhesion molecules that are commonly linked to a multitude of neurodevelopmental, neuropsychiatric, and addiction disorders¹. Mutations in gen....

Protocol

1. Cell culture and transfection

1. Make HEK cell media with DMEM, 1x (Dulbecco's Modification of Eagle's Medium) supplemented with 4.5 g/L glucose, L-glutamine & sodium pyruvate and 10% FBS. Sterile filter.
2. Predetermine suitable ligands and receptors for aggregation assay.
   NOTE: Neurexin3α SS4+/- and one of its known ligands, LRRTM2, were used in this study. Ligands and receptors of interest were expressed from cDNAs in pcDNA3.1. A Gibson assembly was used to insert Neurexin3α into pcDNA3.1¹². Neurexin3α F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGAGCTTTACCCTCCACTC/
   GAGCGGCCGCCACTG....

Results

The A687T mutation increases Neurexin3α SS4- binding to LRRTM2⁷
To investigate how intercellular interactions of two known synaptic proteins are affected by the introduction of a point mutation found in a patient with intellectual disability and epilepsy, we used the above HEK cell aggregation assay (Figure 1). Cells were transfected according to section 1 and prepared for imaging according to sections 1 and 2 of the protocol. Cells were imaged at baseline whe.......

Discussion

Dissecting the protein-protein interactions that occur in trans during cell adhesion can lead to a better understanding of the molecular mechanisms underlying basic cellular processes including the formation, function and maintenance of synapses during maturation and remodeling. The implications of cell-to-cell interactions expand beyond neurobiology and have broader roles in signal transduction, cell migration and tissue development¹⁴. Aberrations in cell adhesion can disrupt cellular processes i.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
1.5 mL disposable microtubes with snap caps	VWR	89000-028	Incubation of mixed population of HEK cells
1000 mL Rapid—Flow Filter Unit, 0.2 um aPES membrane	Thermo Fisher	567-0020	Sterilization of HEK media
15 mL SpectraTube centrifuge tubes	Ward’s Science	470224-998	Harvesting HEK cells
6 well sterile tissue culture plates	VWR	100062-892	culturing HEK cells
Calcium Chloride	Sigma	223506-500G	Calcium phosphate transfection, HEK cell resuspension
Centrifuge- Sorvall Legend RT	Kendro Laboratory Products	75004377	Harvesting HEK cells
CO2 cell incubator	Thermo Scientific	HERACELL 150i	Incubation of HEK cells during growth
DMEM, 1x (Dulbecco's Modification of Eagle's Medium) with 4.5 g/L glucose, L-glutamine & sodium pyruvate	Corning	10-013-CV	HEK cell maintenance
Dulbecco’s Phosphate Buffered Saline PBS (1X)	Gibco	14190-144	Passaging/harvesting HEK cell
Ethylenediaminetetraacetic acid	Sigma	ED-500G	Harvesting HEK cells
Falcon Vented culture flasks, 75cm2 growth area	Corning	9381M26	Culturing HEK cells
Fetal Bovine Serum	Sigma	17L184	HEK cell maintenance
HEK293T cells	ATCC		Model system
ImageJ	NIH	V: 2.0.0-rc-69/1.52p	Image analysis
Magnesium Chloride hexahydrate	Sigma	M9272-500G	HEK cell resuspension
Sodium phosphate dibasic anhydrous	Fisher BioReagents	BP332-500	Calcium phosphate transfection
Trypsin 0.25% (1X) Solution	GE Healthcare Life Sciences	SH30042.01	Passaging HEK cells
Tube rotator			Incubation of mixed population of HEK cells
UltraClear Microscope slides. White Frosted, Positive Charged	Denville Scientific Inc.	M1021	Image acquisition
Wide-field microscope	Zeiss	Axio Vert 200M	Image acquisition