A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

2.9K views

DOI:

10.3791/61237

May 22nd, 2020

In This Article

Summary

Here, we present an optimized protocol to rapidly and semiquantitatively measure ligand-receptor interactions in trans in a heterologous cell system using fluorescence microscopy.

Abstract

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse formation and maintenance. Many of these fundamental interactions occur in trans and are typically induced by heterophilic or homophilic interactions between cells expressing membrane anchored binding pairs. Elucidating how disease relevant mutations disrupt these fundamental protein interactions can provide insight into a myriad of cell biology fields. Many protein-protein interaction assays do not typically disambiguate between cis and trans interactions, which potentially leads to an overestimation of the extent of binding that is occurring in vivo and involve labor intensive purification of protein and/or specialized monitoring equipment. Here, we present an optimized simple protocol that allows for the observation and quantification of only trans interactions without the need for lengthy protein purifications or specialized equipment. The HEK cell aggregation assay involves the mixing of two independent populations of HEK cells, each expressing membrane-bound cognate ligands. After a short incubation period, samples are imaged and the resulting aggregates are quantified.

Introduction

Synaptic interactions facilitated by synaptic adhesion molecules are foundational for the development, organization, specification, maintenance and function of synapses and the generation of neural networks. The identification of these transsynaptic cell adhesion molecules is rapidly increasing; thus, it is fundamentally important to identify binding partners and understand how these new adhesion molecules interact with each other. Additionally, genome sequencing has identified mutations in many of these adhesion molecules that are commonly linked to a multitude of neurodevelopmental, neuropsychiatric, and addiction disorders1. Mutations in genes that code for synaptic cell-adhesion molecules may detrimentally alter trans interactions and may contribute to pathophysiological alterations in synapse formation and or maintenance.

Multiple assays exist to quantitatively assess protein-protein interactions such as isothermal calorimetry, circular dichroism, surface plasmon resonance2 and although quantitative in nature, they have several limitations. First, they require recombinant protein, sometimes demanding lengthy and tedious purification steps. Second, they require sophisticated specialized equipment and technical expertise. Third, they can overestimate the extent of binding as they allow for both cis and trans interactions between proteins that are naturally tethered to a membrane in vivo. Here we propose a simple and relatively rapid assay that exclusively tests trans interactions.

To circumvent many of the complications associated with purified protein assays, we have optimized a cell-based protein interaction assay that recapitulates trans interactions in a reduced heterologous cell system. This assay has been previously used in various forms to study transcellular interactions. In this approach, candidate cell adhesion molecules are transfected into HEK293T cells. At physiological conditions, HEK293T cells do not exhibit self-aggregation, making them exemplary models for this assay. However, when individual populations of HEK cells expressing receptor and ligand are combined, the binding of the receptor and the ligand forces aggregation of HEK cells to occur. This aggregation is mediated exclusively by trans interactions and is usually observable in tens of minutes. No protein purification steps are required in this method, and the efficiency of the method relies on the paradigm that populations of HEK cells expressing cognate adhesion molecules are being combined and then imaged only tens of minutes later. Additionally, this method is relatively inexpensive, as neither antibodies nor costly equipment are required. The only equipment required for the acquisition of data is a standard fluorescent microscope. An additional advantage to this cell-based assay is the ability to quickly screen the effect of disease relevant point mutations on trans interactions. This can be performed by transfecting HEK cells with cDNAs of the mutant variants of the protein of interest.

In this protocol, we present an example in which we investigate whether a missense mutation in Neurexin3α (Neurexin3αA687T), identified in a patient diagnosed with profound intellectual disability and epilepsy, alters interactions in trans with leucine-rich repeat transmembrane protein 2 (LRRTM2). Neurexin3α is a member of the evolutionarily conserved family of presynaptic cell-adhesion molecules and while recent work has identified multiple roles at the synapse3,4,5,6,7, our synaptic understanding of this molecule and all members of the neurexin family remains incomplete. LRRTM2 is an excitatory postsynaptic cell adhesion protein that participates in synapse formation and maintenance8,9,10. Importantly, LRRTM2 exclusively interacts with neurexin isoforms that lack the splice site 4 alternative exon (SS4-) but not with neurexin isoforms containing the splice site 4 alternative exon (SS4+). The human missense mutation (A687T) identified in Neurexin3α is located in an unstudied extracellular region that is evolutionarily conserved and is conserved between all alpha neurexins7. As the interaction between these two molecules has been established8,9,11, we posed the question: is the binding capability of Neurexin3α SS4- to LRRTM2 altered by an A687T point mutation? This assay revealed that the A687T point mutation unexpectedly enhanced the aggregation of Neurexin3α to LRRTM2 suggesting that the extracellular region in which the point mutation is located, plays a role in mediating transsynaptic interactions.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Cell culture and transfection

  1. Make HEK cell media with DMEM, 1x (Dulbecco's Modification of Eagle's Medium) supplemented with 4.5 g/L glucose, L-glutamine & sodium pyruvate and 10% FBS. Sterile filter.
  2. Predetermine suitable ligands and receptors for aggregation assay.
    NOTE: Neurexin3α SS4+/- and one of its known ligands, LRRTM2, were used in this study. Ligands and receptors of interest were expressed from cDNAs in pcDNA3.1. A Gibson assembly was used to insert Neurexin3α into pcDNA3.112. Neurexin3α F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGAGCTTTACCCTCCACTC/
    GAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTTACACATAATACTCCTTGTCCTT.
  3. Prepare HEK293T cells.
    1. Grow HEK293T cells to confluency in one T-75 flask.
    2. Once confluent, use 2 mL of trypsin and place in 37 °C incubator for 2 min. Add 6 mL of HEK media to the flask to resuspend cells and transfer all 8 mL to a 15 mL conical tube.
    3. Pellet at 500 x g for 5 min and resuspend in HEK cell media for a total of 8 mL.
    4. Count cells and add 735,000 cells into each well of a 6-well plate. Adjust final volume to 2 mL for each well using HEK cell media.
    5. Place in 37 °C incubator and allow cells to grow overnight or until they reach 50-60% confluency.
  4. Transfect HEK293T cells using the calcium phosphate method13.
    1. Transfect well-1 with 3 µg of the protein of interest and co-transfect with 1 µg of fluorescent protein (3 µg of pcDNA3.1-Neurexin3αWT SS4- and 1 µg of mCherry).
    2. Transfect well-2 as in step 1.4.1. but with the mutated protein of interest (pcDNA3.1-Neurexin3αA687T SS4-).
    3. Transfect well-3 with 3 µg of the ligand of interest and co-transfect with 1 µg of another fluorescent protein (3 µg of pcDNA3.1 LRRTM2 and 1 µg of GFP).
    4. Transfect well-4 and well-5 to serve as negative controls: well-4 with 1 µg of GFP and well-5 with 1 µg of mCherry.
    5. Prepare another plate (as in step 1.4.1-1.4.4) if requiring additional conditions or controls (Neurexin3αWT/A687T SS4+).
      NOTE: Transfection efficiency is analyzed 24 h after transfection under an epifluorescence microscope and quantified as the number of cells expressing the fluorescent protein they were transfected with. A more streamlined approach would include the transfection of HEK cells with a bicistronic vector coding for a fluorescent protein and the ligand of interest and is highly recommended above co-transfection. In the case of this study, alpha Neurexins are ~4.3 kb and low fluorescence intensity was observed using a bicistronic system necessitating co-transfection.
  5. 48 hours after transfection, harvest cells for aggregation.
    1. Wash each well twice with PBS.
    2. Add 1 mL of 10 mM EDTA in PBS into each well to gently dissociate cell-to-cell interactions and incubate plate at 37 °C for 5 min.
      NOTE: Trypsin is not recommended for step 1.5.2 due to potential proteolytic cleavage of adhesion molecules in study. Additionally, after EDTA addition the protocol may not be stopped until completion as cells will now be exposed to ambient conditions.
    3. Gently tap plate to detach the cells, and harvest each well into separate 15 mL conical tubes.
    4. Centrifuge conical tubes at 500 x g and room temperature for 5 min.
  6. While cells are pelleting, prepare 6 incubation tubes by labeling the top of each microcentrifuge tube with each condition.
    NOTE: Each permutation of GFP and mCherry conditions should be used to encompass all experimental conditions and proper controls. For example: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3αWT SS4-—mCherry, 4. GFP/Neurexin3αA687T SS4- –mCherry, 5. Neurexin3αWT SS4-—mCherry/LRRTM2—GFP, 6. Neurexin3αA687T SS4- –mCherry/LRRTM2—GFP. Make additional tubes to accommodate further conditions and controls.
  7. Remove the supernatant and resuspend cells in 500 µL of HEK media with 10 mM CaCl2 and 10 mM MgCl2 warmed to 37 °C.
    NOTE: The addition of CaCl2 and MgCl2 allows adhesion molecules to reestablish binding and is only required if the transcellular interaction partners in question require divalent cations for adhesion.
  8. Count the cells in each 15 mL conical tube using a hemocytometer and aliquot 200,000 cells of each condition into appropriate tube from step 1.6.1 for a 1:1 mix in a total volume of 500 µL.
    NOTE: It should only take 5 min per condition to count and aliquot amounts.
  9. Incubate tubes at room temperature in a slow tube rotator.

2. Image acquisition

  1. Optimize microscope acquisition parameters for specific samples. In this example, images were taken on a wide-field microscope. Use a 5x air objective (NA: 0.15; WD: 20000 μm) to get a large enough field for analysis.
  2. Assess baseline aggregation immediately after mixing the two conditions of HEK cells in step 1.8. These are now the ‘time zero’ images.
    1. Pipette 40 µL of each sample mixture onto a charged microscope slide and image under fluorescence in both the 488 and 561 channels.
    2. Acquire three different fields of view at one focus plane per sample drop.
  3. Acquire final images at 60 min as the ‘time 60’ image.
    1. To obtain the ‘time 60’ image of the mixture after a 60 min incubation, take another 40 µL sample of each condition from rotating tubes and pipette each sample onto a charged slide. Image as in step 2.2.2.
      NOTE: Cell aggregation should be checked every 15 min until saturation occurs. Timing of aggregation will depend on the proteins being tested.

3. ImageJ/Fiji Analysis

  1. To quantify the extent of aggregation using Fiji/ImageJ, save analysis files.
    1. Save the provided Supplemental coding files into the imageJ macros folder on the computer.
    2. Install the aggregation macro provided (Plugins, Macros, Install, and select the “AggregationAssay.txt” file).
  2. Determine thresholds.
    1. Load a ‘time zero’ .tif file into imageJ and split the channels (Image | Color | Split Channels).
      NOTE: The ‘time zero’ image is used to determine the thresholding and smallest puncta size for the whole experiment.
    2. Mask each channel (Plugins | Macros | AggregationAssay_MakeMask). Make Mask From Image window will appear. Check boxes next to Determine Threshold for Image and Determine Cluster Params from Histogram and click OK.
    3. Determine the threshold of the image using the slide bar, record the number to the right of the slide bar and click OK.
    4. A Histogram of Cluster Size will appear. Select a cluster size from the histogram that suits the experiment, type this number in the Min Cluster Size: box, and click OK. Clusters below this size will not be analyzed.
  3. Run the analysis.
    1. Open the ‘time 60’ image of condition 1 in imageJ and split the channels as in step 3.2.1.
    2. Mask each channel (Plugins, Macros, AggregationAssay_MakeMask). Use the same threshold and size determined in step 3.2.3 and step 3.2.4. Unselect the boxes next to Determine Threshold for Image and Determine Cluster Params from Histogram and manually type the size and thresholds into the appropriate fields then click OK.
    3. Calculate the aggregation index (Plugins | Macros | AggregationAssay_CalculateOverlap). Select the masked channels to be compared and directory into which the resulting files will save.
    4. Repeat steps 3.3.1–3.3.3 for every ‘time 60’ image in every condition.
      NOTE: The aggregation index is defined as the total overlap area divided by the sum of the two channel areas minus the overlap area multiplied by 100 (Aggregation index = overlap area/[area of channel 1 + area of channel 2 – overlap area] x 100). This normalization is an ‘OR’ operation between the two masked channels representing the total pixels in either mask.

Access restricted. Please log in or start a trial to view this content.

Results

The A687T mutation increases Neurexin3α SS4- binding to LRRTM27
To investigate how intercellular interactions of two known synaptic proteins are affected by the introduction of a point mutation found in a patient with intellectual disability and epilepsy, we used the above HEK cell aggregation assay (Figure 1). Cells were transfected according to section 1 and prepared for imaging according to sections 1 and 2 of the protocol. Cells were imaged at baseline whe...

Access restricted. Please log in or start a trial to view this content.

Discussion

Dissecting the protein-protein interactions that occur in trans during cell adhesion can lead to a better understanding of the molecular mechanisms underlying basic cellular processes including the formation, function and maintenance of synapses during maturation and remodeling. The implications of cell-to-cell interactions expand beyond neurobiology and have broader roles in signal transduction, cell migration and tissue development14. Aberrations in cell adhesion can disrupt cellular processes i...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by Grants from the National Institute of Mental Health (R00MH103531 and R01MH116901 to J.A.), a predoctoral training Grant from the National Institute of General Medicine (T32GM007635 to S.R.), and a Lyda Hill Gilliam Fellowship for Advanced Study (GT11021 to S.R.). We thank Dr. Kevin Woolfrey for help with the microscope, Dr. K Ulrich Bayer for the use of his epifluorescent microscope, and Thomas Südhof (Stanford University) for the LRRTM2 plasmid.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1.5 mL disposable microtubes with snap capsVWR89000-028Incubation of mixed population of HEK cells
1000 mL Rapid—Flow Filter Unit, 0.2 um aPES membraneThermo Fisher567-0020Sterilization of HEK media
15 mL SpectraTube centrifuge tubesWard’s Science470224-998Harvesting HEK cells
6 well sterile tissue culture platesVWR100062-892culturing HEK cells
Calcium ChlorideSigma223506-500GCalcium phosphate transfection, HEK cell resuspension
Centrifuge- Sorvall Legend RTKendro Laboratory Products75004377Harvesting HEK cells
CO2 cell incubatorThermo ScientificHERACELL 150iIncubation of HEK cells during growth
DMEM, 1x (Dulbecco's Modification of Eagle's Medium) with 4.5 g/L glucose, L-glutamine & sodium pyruvateCorning10-013-CVHEK cell maintenance
Dulbecco’s Phosphate Buffered Saline PBS (1X)Gibco14190-144Passaging/harvesting HEK cell
Ethylenediaminetetraacetic acidSigmaED-500GHarvesting HEK cells
Falcon Vented culture flasks, 75cm2 growth areaCorning9381M26Culturing HEK cells
Fetal Bovine SerumSigma17L184HEK cell maintenance
HEK293T cellsATCCModel system
ImageJNIHV: 2.0.0-rc-69/1.52pImage analysis
Magnesium Chloride hexahydrateSigmaM9272-500GHEK cell resuspension
Sodium phosphate dibasic anhydrousFisher BioReagentsBP332-500Calcium phosphate transfection
Trypsin 0.25% (1X) SolutionGE Healthcare Life SciencesSH30042.01Passaging HEK cells
Tube rotatorIncubation of mixed population of HEK cells
UltraClear Microscope slides. White Frosted, Positive ChargedDenville Scientific Inc.M1021Image acquisition
Wide-field microscopeZeissAxio Vert 200MImage acquisition

References

  1. Südhof, T. C. Neuroligins and neurexins link synaptic function to cognitive disease. Nature. 455 (7215), 903-911 (2008).
  2. Lakey, J. H., Raggett, E. M. Measuring protein-protein interactions. Current Opinion in Structural Biology. 8 (1), 119-123 (1998).
  3. Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., Südhof, T. C. Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking. Cell. 154 (1), 75-88 (2013).
  4. Aoto, J., Földy, C., Ilcus, S. M. C., Tabuchi, K., Südhof, T. C. Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses. Nature Neuroscience. 18 (7), 997-1007 (2015).
  5. Südhof, T. C. Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits. Cell. 171 (4), 745-769 (2017).
  6. Dai, J., Aoto, J., Südhof, T. C. Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses. Neuron. 102 (5), 993-1008 (2019).
  7. Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. Modeling a Neurexin-3α Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses. The Journal of Neuroscience. 39 (46), 9065-9082 (2019).
  8. Ko, J., Fuccillo, M. V., Malenka, R. C., Südhof, T. C. LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation. Neuron. 64 (6), 791-798 (2009).
  9. de Wit, J., et al. LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation. Neuron. 64 (6), 799-806 (2009).
  10. Linhoff, M. W., et al. An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers. Neuron. 61 (5), 734-749 (2009).
  11. Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development. Journal of Neuroscience. 30 (22), 7495-7506 (2010).
  12. Gibson, D. G., Young, L., Chuang, R. -Y., Venter, J. C., Hutchison, C. A., Smith, H. O. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6 (5), 343-345 (2009).
  13. Bacchetti, S., Graham, F. L. Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA. Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).
  14. Cerchiari, A. E., et al. A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity. Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).
  15. Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. Cell-cell interactions in inflammation and cancer metastasis. IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).
  16. Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. Cell-cell interactions in rheumatoid arthritis synovium. Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).
  17. Yamagata, A., et al. Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction. Nature Communications. 9 (1), 3964(2018).
  18. Nguyen, T., Südhof, T. C. Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules. The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).
  19. Boucard, A. A., Ko, J., Südhof, T. C. High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex. Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

HEK Cell AggregationTrans Adhesion AssayFluorescence ImagingCell CountingEDTA TreatmentCentrifugation ProtocolGFP mCherry LabelingAdhesion Molecule Screening