Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
JoVE Science Education
Environmental Microbiology

A subscription to JoVE is required to view this content.
You will only be able to see the first 20 seconds.

כימות מיקרואורגניזמים סביבתיים ווירוסים באמצעות qPCR
 
Click here for the English version

כימות מיקרואורגניזמים סביבתיים ווירוסים באמצעות qPCR

Overview

מקור: מעבדות של ד"ר איאן פפר וד"ר צ'ארלס גרבה - אוניברסיטת אריזונה
מחבר מפגין: בראדלי שמיץ

תגובת שרשרת פולימראז כמותית (qPCR), הידועה גם בשם PCR בזמן אמת, היא טכניקה מולקולרית נפוצה לספירת מיקרואורגניזמים בסביבה. לפני גישה זו, כימות מיקרואורגניזמים הוגבל במידה רבה לטכניקות המבוססות על תרבות קלאסית. עם זאת, פולחן של חיידקים מדגימות סביבתיות יכול להיות מאתגר במיוחד, והוא בדרך כלל נקבע כי רק 1 עד 10% של מיקרואורגניזמים נוכחים בתוך דגימות סביבתיות ניתנים לזיהוי באמצעות טכניקות אלה. הופעתו של qPCR במחקר מיקרוביולוגיה סביבתית ולכן קידם את התחום מאוד על ידי מתן אפשרות לקביעת מדויקת יותר של ריכוזים של מיקרואורגניזמים כגון פתוגנים גורמי מחלות בדגימות סביבתיות. עם זאת, מגבלה חשובה של qPCR כניקה מיקרוביולוגית יישומית היא שלא ניתן להבדיל בין אוכלוסיות חיות, חיות, לא יכולות להיות מובחנות מאוכלוסיות לא פעילות או לא חיות.

וידאו זה מדגים את השימוש ב- qPCR כדי לזהות וירוס פלפל מתון מדגימת מים סביבתית.

Principles

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

העקרונות הבסיסיים מאחורי qPCR זהים ל- PCR רגיל – מחזורים חוזרים ונשנים של חישול פריימר לתבנית, התארכות של מוצר PCR, ו denaturation של המוצר מתבנית, המוביל הגברה מעריכית של רצף יעד של עניין, המכונה "amplicon", מתוך מאגר של חומר מתחיל. החידוש של qPCR הוא בנוסף של כימיקלים פלואורסצנטיים לתוך התגובה, אשר מאפשר את הסינתזה של מוצר PCR בכל מחזור להיות חזותי ישירות "בזמן אמת" על ידי thermocyclers מיוחדים, מה שמאפשר לכמת את כמות רצף התבניות במדגם המקורי. הכמות נמדדת בדרך כלל במונחים של מחזור הסף (Ct, הידוע גם בשם מחזור כימות או Cq), שהוא מחזור PCR שבו כמות המוצרים הפלואורסצנטי עולה על רמת הרקע.

כימות יכול להיות יחסי, כאשר ערך Ct של רצף אחד מושווה לזה של רצף סטנדרטי או פקד אחר. לחלופין, אם סדרה של DNA של כמות ידועה מופעלת לצד הדגימות בתגובה, ניתן לייצר "עקומה סטנדרטית" המשווה את ערך הפלואורסצנטיות לכמות ה- DNA, ומאפשרת כמות DNA מדגם לחלוטין.

בשיטת qPCR אחת, רצועה קצרה של דנ"א, המכונה בדיקה, מתוכננת כנגד רצף יעד ספציפי של עניין. הגשושית מחוברת כימית לצבע פלואורסצנטי וכן למולקולת "קוונצ'ר" המדכאת את אות הפלואורסצנטיות מהצבע בסמיכות. לאנזים פולימראז, אשר סינתזה של מוצר ה- DNA, יש פעילות משפילה DNA שתגרום למולקולה הפלואורסצנטית להשתחרר מהגשוש, ובכך להפריד את הצבע מהקונצ'ר ולאפשר את אות הפלואורסצנטיות להיות מזוהה. רמות פלואורופור נמדדות כמותית לאחר כל מחזור PCR, עם כוח אות גובר בקורלציה לרמות גבוהות יותר של רצפי יעד מוגברים (המכונים "אמפליקולונים") הקיימים במדגם הסביבתי.

Subscription Required. Please recommend JoVE to your librarian.

Procedure

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. איסוף דוגמאות

  1. לאסוף אדמה באמצעות אוגר או את חפירה לעומק נחוש. אם אוספים אדמה מהקרניזון, אוספים אדמה רק בתוך 7 מ"מ סביב שורש הצמח, על ידי פגיעה באדמה עודפת מהשורש ושריטת האדמה הרצויה לחבית איסוף.
  2. מניחים בקבוק נלג'ין סטרילי במקל טבילה. החזק את קצה המקל ולאסוף מים על ידי בקבוק שקוע. מניחים את הבקבוק בצידנית עם קרח.
  3. העבר דגימות למעבדה.

2. מיצוי חומצות גרעין

  1. כדי לבודד מיקרואורגניזמים מהדגימות שנאספו ולחלץ מהם דנ"א ו/או רנ"א, אנא עיין בסרטון החינוך המדעי של JoVE על הפקת חומצת גרעין קהילתית.

3. תמלול הפוך

  1. אם החומר הגנטי שנבחנ הוא RNA, יש להשתמש בו כדי ליצור DNA משלים (cDNA) באמצעות תמלול הפוך לפני שתמשיך ל- PCR. לפרטים, אנא עיינו בסרטון החינוך המדעי של JoVE ב- RT-PCR.

4. הגדרת qPCR

  1. יש לאחזר ריאגנטים המאוחסנים בטמפרטורה של -20 מעלות צלזיוס, ולהפשיר אותם על קרח או בטמפרטורת החדר בתוך מכסה המנוע הנקי. ריאגנטים המשמשים בדוגמה זו כוללים את תמהיל התגובה של qPCR (התלוי במכונת qPCR המשמשת; מכיל פולימראז DNA), פריימרים קדמיים והופכים, ואת הבדיקה TaqMan. רצפי הפריימר והגשוש מתוכננים עם רצפים ספציפיים לאורגניזם שנמנה. עיין בספרות הנוכחית כדי למצוא רצפים של עניין. בדוגמה זו, Roche אור מחזור 480 בדיקות לערבב מערכת ריאגנט ישמש. נגיף מנומר קל פלפל יומר בדגימת המים. 1,2 ראה טבלה 1 עבור פריימר ורצפי בדיקה.
  2. הפשרה שחולצה (ג) DNA מדגימות ואת ה- DNA שליטה חיובית (המורכב רצפים ספציפיים לאורגניזם משובטים לתוך plasmids חיידקי) בטמפרטורת החדר.
  3. הכן תבנית טבלה בת 96 תאים הדומה ללוח qPCR בן 96 הבאר. סמן כל תא בתגובה שתיטען על הצלחת. כלול תגובות עבור כל דגימה ותקן משולש, כמו גם עבור שליטה חיובית ושליטה שלילית, כגון תגובה ללא DNA.
  4. חשב את כרכים ריאגנט הדרושים עבור תגובה "תערובת מאסטר", הכולל את כל הריאגנטים כי הם קבועים בין התגובות, בהתבסס על הוראות היצרן ואת הספרות. הכן מספיק תערובת מאסטר לתגובות משולשות עבור כל הדגימות בתוספת פקדים, ו-10% נוספים כדי להסביר שגיאת צנרת. למתכון לתערובת ראשית לדוגמה, עיין בטבלה 2.
  5. עבודה בתוך מכסה המנוע נקי, ברגע שכל הריאגנטים מופשרים לחלוטין, הוסיפו כמות מחושבת של כל ריאגנט לצינור מיקרו-קשירה נמוך של 1.5 מ"ל כדי ליצור תערובת ראשית. מערבולת וקצרה minicentrifuge כל ריאגנט לפני הוספת. שנה את קצה הפיפטה בין כל ריאגנט כדי למנוע זיהום ולהבטיח ריכוזים נכונים. לאחר כל ריאגנטים נוספו, מערבולת וצינור minicentrifuge עם תערובת מאסטר כדי להבטיח הומוגניות.
  6. Aliquot את הנפח המתאים של תערובת מאסטר לתוך כל באר ייעודית בצלחת PCR 96 טוב.
  7. הוסף את הנפח המתאים של (ג) דגימת DNA, plasmid שליטה חיובית, ושליטה שלילית (מים כיתה מולקולרית) לתוך בארות ייעודיות.
  8. לאחר שכל הדגימות והפקדים נוספו, צלחת איטום עם רדיד איטום. השתמש בכלי איטום כדי לדחוף אוויר מתחת רדיד הכסף ולמנוע בועות. תקרעו את קצוות נייר הכסף בזהירות.
  9. צנטריפוגות צלחת 96 באר אטום בצנטריפוגה עם מחזיק צלחת כדי לאסוף תערובת בתחתית כל באר. הקפד להשתמש בצלחת משקל נגד כדי להבטיח כי הצנטריפוגה תהיה מאוזנת כראוי בעת סיבוב. צנטריפוגה דופק עד 1000 סל"ד, ולאחר מכן לתת צנטריפוגה לאט לעצור ללא בלמים.

5. פעולת qPCR

  1. מניחים צלחת אטומה 96-באר לתוך מכונת qPCR. ודא שהמחשב מציין שהוא מוכן להפעלה.
  2. בצע את הוראות מחשב qPCR כדי להזין כראוי את כל המידע הדרוש לתוכנה ולאחר מכן הגדר את מחשב qPCR לפעול.
  3. לאחר שהמכונה תשלים את ההפעלה, התוכנה תוכל להשתמש בריכוזים הידועים של הפקד החיובי כדי לחשב את כמות cDNA בכל תגובה. לאחר מכן ניתן לחשב את כמות הנגיף במדגם המקורי, בהתבסס על תהליכי הדילול, הסינון, הריכוז, ההגברה ו/או החילוץ המבוצעים כדי להשיג את דגימת ה- DNA.
מגיב רצף (5' → 3') נפח (μL / well) קונק סופי.
פריימר קדמי GAGTGGTTTGACCTTAACGTTTGA 2.25 900 ננומטר
פריימר הפוך TTGTCGGTTGCAATGCAAGT 2.25 900 ננומטר
בדיקה FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 ננומטר

טבלה 1. פריימר מדגם ורצפי בדיקה לאיתור וירוס מנומר קל פלפל.

מגיב נפח (μL / well) מספר וולס אמצעי אחסון מיקס ראשי (μL)
תערובת LC 480 12.5 26 325
מולקולרית H2O 4.5 117
פריימר קדמי 2.25 58.5
פריימר הפוך 2.25 58.5
בדיקה 1.0 26
סך 22.5 585

טבלה 2. כרכים ריאגנט לתגובה אישית ותערובת מאסטר.

הופעתה של תגובת שרשרת פולימראז כמותית, או qPCR, אפשרה לקבוע כמותית את כמות כל מיקרואורגניזם במדגם סביבתי.

בדומה ל- PCR רגיל, qPCR מזהה מיקרואורגניזמים על ידי זיהוי נוכחות או היעדר רצפי DNA ספציפיים לאורגניזמים מעניינים. זה מאפשר זיהוי של חיידקים שלא ניתן לתרבות במעבדה, מה שמאפשר לראות מגוון רחב בהרבה של אורגניזמים סביבתיים. בנוסף, qPCR מאפשר להעריך כמות DNA כמותית. אבל באותו הזמן, מתודולוגיות PCR לזהות DNA מכל האורגניזמים מתים או חיים, הגבלת היכולת לחפש רק חיידקים הגדלים באופן פעיל במדגם.

וידאו זה יסקור את החידושים הכימיים המבדילים בין qPCR לבין PCR רגיל, יסביר כיצד ניתן להשתמש ב- qPCR כדי למדוד כמותית DNA, להדגים פרוטוקול לשימוש ב- qPCR כדי לזהות וירוס RNA מדגימות קרקע, ולבסוף, להראות כיצד qPCR מוחל על מיקרוביולוגיה סביבתית כיום.

העקרונות הבסיסיים מאחורי qPCR זהים ל- PCR רגיל - מחזורים חוזרים ונשנים של חישול פריימר לתבנית, התארכות של מוצר PCR, ו denaturation של המוצר מתבנית, המוביל הגברה מעריכית של רצף יעד של עניין, המכונה amplicon, ממאגר של חומר מתחיל.

החידוש של qPCR הוא בנוסף של כימיקלים פלואורסצנטיים לתוך התגובה, אשר מאפשר את הסינתזה של מוצר PCR בכל מחזור להיות חזותי ישירות "בזמן אמת" על ידי thermocyclers מיוחדים, מה שמאפשר לכמת את כמות רצף התבניות במדגם המקורי. הכמות נמדדת בדרך כלל במונחים של מחזור הסף, C מקוצרt, הידוע גם בשם מחזור הכימות או Cq, שהוא מחזור PCR שבו כמות המוצרים פלואורסצנטי עולה על רמת הרקע.

כימות יכול להיות יחסי, כאשר ערך Ct של רצף אחד מושווה לזה של רצף סטנדרטי או פקד אחר; הכמות היחסית שווה לשניים שהועלו לעוצמה של ההפרש ב- Ct. לחלופין, אם סדרה של DNA של כמות ידועה מופעלת לצד הדגימות בתגובה, ניתן לייצר עקומה סטנדרטית המשווה את ערך הפלואורסצנטיות לכמות ה- DNA, ומאפשרת כמות DNA של הדגימה לחלוטין.

ישנם שני סוגים רחבים של מולקולות פלואורסצנטיות המשמשות ב- qPCR. במקרה אחד, צבעים פלואורסצנטיים שנקשרים במיוחד לדנ"א כפול גדילים כלולים בתגובה. הצבע מתנפח רק כאשר הוא קשור לדנ"א, ובכך מאפשר כמות של מוצר דנ"א דו-גדילי.

בשיטה השנייה, רצועה קצרה של דנ"א, המכונה בדיקה, מתוכננת כנגד רצף מטרות ספציפי של עניין. הגשושית מחוברת כימית לצבע פלואורסצנטי וכן למולקולת "קוונצ'ר" המדכאת את אות הפלואורסצנטיות מהצבע בסמיכות. האנזים פולימראז, אשר לסנתז את מוצר ה- DNA, יש פעילות משפילה DNA שיגרום למולקולה פלואורסצנטית "להשתחרר" מהגשוש, ובכך להפריד את הצבע מן quencher ולאפשר את אות פלואורסצנטי להיות מזוהה.

עכשיו שאתם מבינים את העקרונות שמאחורי qPCR, בואו נסתכל על פרוטוקול לשימוש בטכניקה זו לזיהוי וירוס RNA שמדביק צמחים, נגיף העכוז המתון של הפלפל, מדגימות קרקע.

בהדגמה זו, מדגם ייאסף מן rhizosphere, אזור הקרקע כ 7 מ"מ סביב שורשי הצמח המושפעים השורשים ואת המיקרואורגניזמים הסימביוטיים שלהם.

כדי לאסוף אדמה rhizosphere, תחילה בזהירות לחלץ את הצמח של עניין מהקרקע, ופגע בו כדי להסיר כמה שיותר אדמה בתפזורת עודף ככל האפשר. לארוז את המפעל לעיבוד נוסף במעבדה.

לאחר החזרת הדגימות למעבדה, השתמש במרית סטרילית כדי לגרד את האדמה הרצויה לתוך כלי איסוף. לאחר מכן, לאסוף את הנגיף מהאדמה ולחלץ את הרנ"א.

לאחר איסוף RNA מהדגימה, המר אותו ל- משלים או ל- cDNA באמצעות תמלול הפוך. אנא עיין בסרטון ה- JoVE SciEd בתעתיק הפוך-PCR לקבלת פרטים על הליך זה.

כאשר הם מוכנים לבצע את ה-qPCR, הפשירו ריאגנטים קפואים בטמפרטורת החדר בתוך מכסה המנוע הזרימי הייעודי של למינאר, והניחו על קרח לאחר שהופשרו. רכיבי ריאגנט המכילים את האנזים פולימראז DNA תמיד צריך להישמר על קרח.

להפשיר את cDNA הדגימה ודנ"א שליטה חיובית, כגון פיסת DNA מעגלית הידועה בשם פלסמיד שיש לה את האמפליקון של עניין משובט לתוכו.

לפני הרכבת התגובות בלוח qPCR של 96 בארות, הכינו תבנית טבלה בת 96 תאים על הנייר ותייגו כל תא בתגובה שתיטען לתוך הצלחת. כלול תגובות עבור כל דגימה ותקן משולש, כמו גם עבור שליטה חיובית ושליטה שלילית, כגון תגובה ללא DNA.

חשב את כרכי ריאגנט הדרושים לתגובה "תערובת מאסטר", הכוללת את כל הריאגנטים הקבועים בין התגובות. הכן מספיק תערובת מאסטר לתגובות משולשות עבור כל הדגימות בתוספת פקדים, ו-10% נוספים כדי להסביר שגיאת צנרת.

לאחר ריאגנטים מופשרים, להרכיב את תערובת האב בצינור מיקרו-סופג 1.5 מ"ל נמוך ספיחה. כדי לעשות זאת, בקצרה מערבולת כל ריאגנט לערבב ביסודיות, לאסוף כל נוזל בצד הצינורות באמצעות מיני צנטריפוגה, ו pipette ריאגנט לתוך צינור microfuge. הקפד להשתמש בטיפים חדשים של pipette עבור כל רכיב תגובה. אחרי כל ריאגנטים נוספו, מערבולת לערבב צנטריפוגה. לאחר מכן, aliquot את הכמות המתאימה של תערובת מאסטר לתוך בארות ייעודיות על צלחת PCR.

לאחר מכן, מערבולת וצנטריפוגות כל צינור עם דגימה ושליטה DNA, ו pipette את הכמות המתאימה לתוך הבארות המתאימות על צלחת PCR. לאחר הוספת דגימות, לאטום את הצלחת עם רדיד איטום, ולהשתמש בכלי האיטום כדי לשטח את החותם באופן מלא לדחוף החוצה את כל בועות האוויר. בזהירות לקרוע את הכרטיסיות שאינן דבק מקצוות החותם.

כדי לאסוף את תערובת התגובה באופן מלא לתחתית הבארות, מניחים את צלחת התגובה לצנטריפוגה עם מחזיק צלחת ומאזנים כראוי את הרוטור עם צלחת נגד משקל. צנטריפוגות דופק עד 1,000 סל"ד, ולאחר מכן לתת הצנטריפוגה לאט לעצור ללא בלמים.

מקם את לוח התגובה לתוך מכונת qPCR. הגדר את תוכנית ה- PCR בהתאם למפרט היצרן, הגדרת טמפרטורת ההיתוך בהתאם לזוג הפריימרים המשמשים. הגדר את תוכנית התגובה לפעולה.

לאחר השלמת תוכנית qPCR, התוכנה תוכל להשתמש בריכוזים הידועים של הפקד החיובי כדי לחשב את כמות cDNA בכל תגובה. לאחר מכן ניתן לחשב את כמות הווירוס במדגם המקורי.

לאחר השלמת תוכנית qPCR, התוכנה תוכל להשתמש בריכוזים הידועים של הפקד החיובי כדי לחשב את כמות cDNA בכל תגובה.

עם התוצאות של qPCR, הנפח שהועבר לבארות, החילוץ מהקרקע, ואת הגורם מן התמלול ההפוך, ניתן לחשב את מספר הנגיפים בדגימת הקרקע הראשונית.

כעת, כאשר אתם יודעים כיצד מתבצע qPCR, בואו נבחן כיצד ניתן להשתמש בו כדי לנתח דגימות סביבתיות שונות.

qPCR יכול לשמש כדי לכמת את כמות הווירוסים התאוששו סוגים רבים ושונים של דגימות. ביישום זה, שני סוגים שונים של אדנווירוסים התרכזו מדגימות מים על ידי מספר שיטות שונות. DNA הוצא אז מהוירוסים ונחשף ל- qPCR, כדי להעריך את היעילות היחסית של שיטות הריכוז.

יישום נוסף לספירה מיקרוביאלית מבוססת qPCR הוא לכמת תוכן חיידקי בדגימות מזון וחקלאות - בדוגמה זו, דגימות צואה ופסולת מחוות עוף. במקום להתמקד במינים בודדים, המדענים ביצעו qPCR באמצעות פריימרים נגד גן שמור מאוד שנמצא בכל החיידקים וכימתו את הקהילה החיידקית הכוללת שנמצאה בדגימות.

לבסוף, כאמור, חיסרון אחד של מתודולוגיית qPCR המסורתית הוא שלא ניתן להבחין בין חיידקים חיים ומתים. עם זאת, על ידי הוספת כימיקל המכונה propidium monoazide, או PMA, אשר יכול להיכנס רק תאים מתים שבו הוא נקשר ל- DNA כדי לעכב תגובות אנזימטיות הבאות כגון PCR, החוקרים כאן הצליחו להבחין בין תרבויות חיות ומתות של E. coli O157:H7, זן פתוגניים נפוץ שנמצא במזון ומים מזוהמים.

הרגע צפיתם בהקדמה של JoVE לכימות מיקרואורגניזמים סביבתיים ווירוסים באמצעות qPCR. כעת עליך להבין כיצד qPCR פועל, כיצד להשתמש ב- qPCR כדי למדוד את כמות החיידק במדגם סביבתי, וכמה יישומים של טכניקה זו. תודה שצפיתם!

Subscription Required. Please recommend JoVE to your librarian.

Applications and Summary

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

היכולת לכמת עותקים גנומיים ממוקדים באמצעות טכניקת qPCR היא בעלת חשיבות במספר תחומים מדעיים. יישומים לדוגמה כוללים:

(1) דום פתוגנים במים, אדמה, מזון, משטחים וכו '.

PCR בזמן אמת משמש לספירת פתוגנים בסביבות שונות. במהלך התפרצויות, ניתן לנתח דגימות מים ואדמה עבור הפתוגן של עניין כדי למצוא את המקור הגורם להתפשטות. לאחר מכן ניתן לנתח את המקור כדי למנות את ריכוז הפתוגן ולקבוע את כמות הזיהום. לדוגמה, במהלך התפרצות של norovirus על ספינת תענוגות שגרמה גסטרואנטריטיס חמורה, הקאות, ושלשולים בקרב נוסעים, דגימות מים ומזון עשוי להיות נתון PCR בזמן אמת כדי לזהות את מקור הנגיף, למשל,מים שלא טופלו כראוי והכילו זיהום צואה גבוה.

(2) מדידת הפחתת חיידקים פתוגניים על ידי טיפול בשפכים

מי ביוב גולמיים מכילים שפע של מיקרואורגניזמים הגורמים למחלות ולכן יש לטפל בהם על מנת להגן על בריאות הציבור. ניתן לאסוף דגימות מים בנקודות שונות לאורך רכבת לטיפול בשפכים, ולנתח באמצעות qPCR כדי לקבוע את הירידה ברמות של מיקרואורגניזמים פתוגניים כולל וירוסים. ההפחתות המחושב מספקות מידע רב ערך באשר ליעילותם של תהליכי טיהור שפכים ויישומים פוטנציאליים לשימוש חוזר במים.

(3) מדידת סמני גנים פונקציונליים בסביבה

קהילות מיקרוביות כפופות לשינויים בחברות ולתנודות בפעילות בשל לחצים סביבתיים. משמרות אלה ניתן לפקח באמצעות ניתוח של גנים פונקציונליים שעשויים להיות מופעלים על ידי גורמי לחץ סביבתיים מסוימים. ניתן להשתמש ב-PCR בזמן אמת כדי לכמת את הביטוי של גנים אלה בדגימות כדי לעקוב אחר שינויים בפעילות הקהילתית המיקרוביאלית. לדוגמה, qPCR מאפשר לאקולוגים מיקרוביאליים לכמת את הביטוי של גנים המופעלים עבור מסלולי מתכלים בנוכחות מזהמים מעשה ידי אדם הנמצאים בקרקעות.

Subscription Required. Please recommend JoVE to your librarian.

References

  1. Zhang, T., Breitbart, M., et al. RNA Viral Community in Human Feces: Prevalence of Plant Pathogenic Viruses. PLoS Biology. 4, e3 (2005).
  2. Haramoto, E., et al. Occurrence of Pepper Mild Mottle in Drinking Water Sources in Japan. Applied Environmental Microbiology. 79, 7413-7418 (2013).

Transcript

Please note that all translations are automatically generated.

Click here for the English version.

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter