Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
JoVE Science Education
Environmental Microbiology

A subscription to JoVE is required to view this content.
You will only be able to see the first 20 seconds.

Quantificando microrganismos e vírus ambientais usando qPCR
 
Click here for the English version

Quantificando microrganismos e vírus ambientais usando qPCR

Overview

Fonte: Laboratórios do Dr. Ian Pepper e Dr. Charles Gerba - Universidade do Arizona
Autor de Demonstração: Bradley Schmitz

A reação quantitativa em cadeia de polimerase (qPCR), também conhecida como PCR em tempo real, é uma técnica molecular amplamente utilizada para enumerar microrganismos no ambiente. Antes dessa abordagem, a quantificação dos microrganismos limitava-se em grande parte às técnicas clássicas baseadas na cultura. No entanto, o cultivo de micróbios a partir de amostras ambientais pode ser particularmente desafiador, e geralmente se sustenta que apenas 1 a 10% dos microrganismos presentes em amostras ambientais são detectáveis usando essas técnicas. O advento da qPCR em pesquisas de microbiologia ambiental tem, portanto, avançado muito o campo, permitindo uma determinação mais precisa das concentrações de microrganismos, como patógenos causadores de doenças em amostras ambientais. No entanto, uma limitação importante da qPCR como técnica microbiológica aplicada é que populações vivas e viáveis não podem ser diferenciadas de populações inativos ou não vivas.

Este vídeo demonstra o uso de qPCR para detectar o vírus de mottle leve pimenta de uma amostra de água ambiental.

Principles

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Os princípios básicos por trás do qPCR são os mesmos do PCR regular – ciclos repetidos de remarcação de primer ao modelo, alongamento do produto PCR e desnaturação do produto do modelo, levando à amplificação exponencial de uma sequência de destino de interesse, conhecida como "amplicon", a partir de um pool de material inicial. A inovação do qPCR é a adição de produtos químicos fluorescentes na reação, o que permite que a síntese do produto PCR em cada ciclo seja diretamente visualizada em "tempo real" por termociclistas especializados, possibilitando quantificar a quantidade de sequência de modelos na amostra original. A quantidade é geralmente medida em termos do ciclo limiar (Ct, também conhecido como ciclo de quantificação ou Cq), que é o ciclo PCR no qual a quantidade de produtos fluorescentes excede o nível de fundo.

A quantificação pode ser relativa, onde o valor Ct de uma sequência é comparado com o de outro padrão ou sequência de controle. Alternativamente, se uma série de DNA de quantidade conhecida é executado ao lado das amostras na reação, uma "curva padrão" comparando o valor da fluorescência com a quantidade de DNA pode ser produzida, e permite que o DNA da amostra seja absolutamente quantitado.

Em um método qPCR, um pequeno trecho de DNA, conhecido como sonda, é projetado contra uma sequência específica de interesse. A sonda é quimicamente ligada a um corante fluorescente, bem como uma molécula "quencher" que suprime o sinal de fluorescência do corante quando está perto. A enzima polimerase, que sintetiza o produto de DNA, tem uma atividade degradante de DNA que faria com que a molécula fluorescente fosse liberada da sonda, separando assim o corante da sátria e permitindo que o sinal de fluorescência fosse detectado. Os níveis de fluoróforo são medidos quantitativamente após cada ciclo de PCR, com aumento da força do sinal correlacionando-se a níveis mais elevados de sequências de alvo amplificadas (denominadas "amplicons") presentes na amostra ambiental.

Subscription Required. Please recommend JoVE to your librarian.

Procedure

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Coleta de Amostras

  1. Colete o solo usando um auger ou uma pá a uma profundidade determinada. Se coletar o solo da rizosfera, colete apenas o solo dentro de 7 mm ao redor da raiz vegetal, atingindo o excesso de solo da raiz e raspando o solo desejado em um barril de coleta.
  2. Coloque uma garrafa Nalgene estéril em uma vara de mergulho. Segure a ponta da vara e colete água submergindo garrafa. Coloque a garrafa em um refrigerador com gelo.
  3. Transfira amostras para o laboratório.

2. Extração de ácidos nucleicos

  1. Para isolar os microrganismos das amostras coletadas e extrair DNA e/ou RNA deles, consulte o vídeo da JoVE Science Education sobre extração de ácido nucleico comunitário.

3. Transcrição reversa

  1. Se o material genético que está sendo testado for RNA, ele deve ser usado para gerar DNA complementar (cDNA) via transcrição reversa antes de prosseguir para PCR. Para obter detalhes, consulte o vídeo da JoVE Science Education no RT-PCR.

4. Configuração de qPCR

  1. Recupere os reagentes armazenados a -20 °C e descongele-os no gelo ou à temperatura ambiente dentro de um capô limpo. Os reagentes utilizados neste exemplo incluem a mistura de reação qPCR (dependente da máquina qPCR usada; contém polimerase de DNA), primers dianteiros e reversos, e a sonda TaqMan. As sequências de primer e sonda são projetadas com sequências específicas do organismo que está sendo enumerada. Consulte a literatura atual para encontrar sequências de interesse. Neste exemplo, será utilizado o sistema de reagente Roche Light Cycler 480 Mix. O vírus da mísera de pimenta será enumerado na amostra de água. 1,2 Consulte a tabela 1 para sequências de primer e sonda.
  2. Degelo extraído (c)DNA de amostras e o DNA de controle positivo (que consiste em sequências específicas do organismo clonadas em plasmídeos bacterianos) à temperatura ambiente.
  3. Prepare um modelo de tabela de 96 células que se assemelha à placa qPCR de 96 poços. Rotule cada célula com a reação que será carregada na placa. Inclua reações para cada amostra e padrão em triplicado, bem como para o controle positivo e controle negativo, como uma reação sem DNA.
  4. Calcule os volumes de reagentes necessários para uma reação "master mix", que inclui todos os reagentes que são constantes entre as reações, com base nas instruções do fabricante e na literatura. Prepare mistura mestre suficiente para reações triplicadas para todas as amostras mais controles, e um adicional de 10% para explicar o erro de pipetação. Para obter uma receita de mix de mestre de amostra, consulte a Tabela 2.
  5. Trabalhando dentro de um capô limpo, uma vez que todos os reagentes são completamente descongelados, adicione a quantidade calculada de cada reagente em um tubo de microfuça de baixa ligação de 1,5 mL para criar mistura mestre. Vórtice e minicentrifuugar brevemente cada reagente antes de adicionar. Altere a ponta da pipeta entre cada reagente para evitar contaminação e garantir as concentrações corretas. Depois de todos os reagentes terem sido adicionados, vórtice e tubo de minicentrifuge com a mistura mestre para garantir a homogeneidade.
  6. Aliquot o volume apropriado de mistura mestre em cada poço designado na placa PCR de 96 poços.
  7. Adicione o volume apropriado de (c)amostra de DNA, plasmídeo de controle positivo e controle negativo (água de grau molecular) em poços designados.
  8. Uma vez adicionadas todas as amostras e controles, a placa de vedação com papel alumínio de vedação. Use uma ferramenta de vedação para empurrar o ar para fora debaixo da folha e evitar bolhas. Rasgue as bordas da folha com cuidado.
  9. Centrifugar a placa selada de 96 poços em uma centrífuga com um porta-placas para coletar mistura na parte inferior de cada poço. Certifique-se de usar uma placa de contrapeso para garantir que a centrífuga seja adequadamente equilibrada durante a rotação. Centrífuga de pulso até 1000 rpm, depois deixe a centrífuga parar lentamente sem freios.

5. operação qPCR

  1. Coloque placa selada de 96 poços na máquina qPCR. Certifique-se de que a máquina indica que está pronta para iniciar.
  2. Siga as instruções da máquina qPCR para inserir corretamente todas as informações necessárias pelo software e, em seguida, defina a máquina qPCR para funcionar.
  3. Após a execução da máquina, o software poderá usar as concentrações conhecidas do controle positivo para calcular a quantidade de cDNA em cada reação. A quantidade de vírus na amostra original pode então ser calculada, com base nos processos de diluição, filtração, concentração, amplificação e/ou extração realizados para obter a amostra de DNA.
Reagente Sequência (5' → 3') Volume (μL / bem) Conc Final.
Primer avançado GAGTGGTTTGACCTTAACGTTTGA 2.25 900 nM
Primer reverso TTGTCGGTTGCAATGCAAGAGT 2.25 900 nM
Sondar FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 nM

Mesa 1. Prove sequências de primer e sonda para detectar o vírus da mísola de pimenta.

Reagente Volume (μL / bem) Número de Poços Volume de mixagem mestre (μL)
LC 480 Mix 12.5 26 325
Molecular H2O 4.5 117
Primer avançado 2.25 58.5
Primer reverso 2.25 58.5
Sondar 1.0 26
Total 22.5 585

Mesa 2. Volumes de reagentes para reação individual e mistura mestre.

O advento da reação quantitacionária da cadeia de polimerase, ou qPCR, tornou possível determinar quantitativamente a quantidade de qualquer microrganismo em uma amostra ambiental.

Como o PCR padrão, o qPCR identifica microrganismos detectando para a presença ou ausência de sequências de DNA específicas dos organismos de interesse. Isso permite a detecção de micróbios que não podem ser cultivados em laboratório, possibilitando avaliar uma gama muito maior de organismos ambientais. Além disso, o qPCR permite que a quantidade de DNA seja avaliada quantitativamente. Mas, ao mesmo tempo, as metodologias pcr detectam DNA de todos os organismos vivos ou mortos, limitando a capacidade de procurar apenas micróbios em crescimento ativo na amostra.

Este vídeo revisará as inovações químicas que distinguem o qPCR do PCR regular, explicará como o QPCR pode ser usado para medir quantitativamente o DNA, demonstrará um protocolo para o uso de qPCR para detectar um vírus RNA a partir de amostras de solo e, finalmente, mostrará como o qPCR está sendo aplicado à microbiologia ambiental hoje.

Os princípios básicos por trás do qPCR são os mesmos do PCR regular - ciclos repetidos de remarcação de primer ao modelo, alongamento do produto PCR e desnaturação do produto do modelo, levando à amplificação exponencial de uma sequência de juros alvo, conhecida como amplicon, a partir de um pool de material inicial.

A inovação do qPCR é a adição de produtos químicos fluorescentes na reação, o que permite que a síntese do produto PCR em cada ciclo seja diretamente visualizada em "tempo real" por termociclistas especializados, possibilitando quantificar a quantidade de sequência de modelos na amostra original. A quantidade é geralmente medida em termos do ciclo limiar, abreviado Ct, também conhecido como ciclo de quantificação ou Cq,que é o ciclo PCR no qual a quantidade de produtos fluorescentes excede o nível de fundo.

A quantificação pode ser relativa, onde o valor Ct de uma sequência é comparado ao de outro padrão ou sequência de controle; a quantidade relativa é igual a duas elevadas ao poder da diferença em Ct. Alternativamente, se uma série de DNA de quantidade conhecida é executado ao lado das amostras na reação, uma curva padrão comparando o valor da fluorescência com a quantidade de DNA pode ser produzida, e permite que o DNA da amostra seja absolutamente quantitado.

Existem dois tipos amplos de moléculas fluorescentes usadas em qPCR. Em um caso, corantes fluorescentes que se ligam especificamente ao DNA de dupla fita está incluído na reação. O corante só fluoresce quando vinculado ao DNA, permitindo assim que a quantidade de produto de DNA de dupla cadeia seja quantificada.

No outro método, um pequeno trecho de DNA, conhecido como sonda, é projetado contra uma sequência específica de interesse. A sonda é quimicamente ligada a um corante fluorescente, bem como uma molécula "quencher" que suprime o sinal de fluorescência do corante quando está perto. A enzima polimerase, que sintetiza o produto de DNA, tem uma atividade degradante de DNA que faria com que a molécula fluorescente fosse "liberada" da sonda, separando assim o corante da quencher e permitindo que o sinal de fluorescência fosse detectado.

Agora que você entende os princípios por trás do qPCR, vamos olhar para um protocolo para usar esta técnica para identificar um vírus RNA que infecta plantas, o vírus da pimenta, a partir de amostras de solo.

Nesta demonstração, a amostra será coletada da rizosfera, a zona do solo de aproximadamente 7 mm em torno das raízes vegetais que é influenciada pelas raízes e seus microrganismos simbióticos.

Para coletar solo da rizosfera, primeiro extrair cuidadosamente a planta de interesse do solo, e atingi-la para remover o máximo de excesso de solo a granel possível. Embale a planta para mais processamento no laboratório.

Depois de trazer as amostras de volta ao laboratório, use uma espátula estéril para raspar o solo desejado em um vaso de coleta. Então, recolhe o vírus do solo e extraia o RNA.

Uma vez coletado o RNA da amostra, converta-o em complementar ou cDNA via transcrição reversa. Consulte o vídeo JoVE SciEd sobre transcrição reversa-PCR para obter detalhes deste procedimento.

Quando estiver pronto para executar o qPCR, descongele reagentes congelados à temperatura ambiente dentro de um capô de fluxo laminar dedicado, e coloque no gelo uma vez descongelado. Os componentes do reagente contendo a enzima polimerase de DNA devem ser sempre mantidos no gelo.

Descongele a amostra cDNA e um DNA de controle positivo, como um pedaço circular de DNA conhecido como plasmídeo que tem o amplicon de interesse clonado nele.

Antes de montar as reações em uma placa qPCR de 96 poços, prepare um modelo de mesa de 96 células no papel e rotule cada célula com a reação que será carregada na placa. Inclua reações para cada amostra e padrão em triplicado, bem como para o controle positivo e controle negativo, como uma reação sem DNA.

Calcule os volumes de reagente necessários para uma reação "master mix", que inclui todos os reagentes que são constantes entre as reações. Prepare mistura mestre suficiente para reações triplicadas para todas as amostras mais controles, e um adicional de 10% para explicar o erro de pipetação.

Uma vez que os reagentes são descongelados, monte a mistura mestre em um tubo de microfuge de baixa adsorção de 1,5 mL. Para isso, bata brevemente cada reagente para misturar bem, coletar qualquer líquido na lateral dos tubos usando uma mini-centrífuga e pipeta o reagente no tubo de microfuge. Certifique-se de usar novas dicas de pipeta para cada componente de reação. Depois de todos os reagentes terem sido adicionados, vórtice para misturar e centrífuga. Em seguida, aliquotar a quantidade apropriada de mistura mestre nos poços designados na placa PCR.

Em seguida, vórtice e centrífuga cada tubo com DNA de amostra e controle, e pipeta a quantidade apropriada nos respectivos poços na placa PCR. Uma vez adicionadas as amostras, sele a placa com uma folha de vedação e use a ferramenta de vedação para achatar totalmente o selo e empurrar quaisquer bolhas de ar. Retire cuidadosamente as abas não adesivas das extremidades do selo.

Para coletar totalmente a mistura de reação na parte inferior dos poços, coloque a placa de reação em uma centrífuga com um suporte de placa e equilibre corretamente o rotor com uma placa de contrapeso. Centrifugar a placa até 1.000 rpm, depois deixe a centrífuga lentamente parar sem freios.

Coloque a placa de reação na máquina qPCR. Defina o programa PCR de acordo com a especificação do fabricante, definindo a temperatura de fusão de acordo com o par de primer que está sendo usado. Defina o programa de reação para ser executado.

Uma vez que o programa qPCR seja concluído, o software poderá usar as concentrações conhecidas do controle positivo para calcular a quantidade de cDNA em cada reação. A quantidade de vírus na amostra original pode então ser calculada.

Uma vez que o programa qPCR seja concluído, o software poderá usar as concentrações conhecidas do controle positivo para calcular a quantidade de cDNA em cada reação.

Com os resultados da qPCR, o volume transferido para os poços, a extração do solo e o fator da transcrição reversa, o número de vírus na amostra inicial do solo pode ser calculado.

Agora que você sabe como o qPCR é realizado, vamos ver como ele pode ser usado para analisar diferentes amostras ambientais.

qPCR pode ser usado para quantificar a quantidade de vírus recuperados de muitos tipos diferentes de amostras. Nesta aplicação, dois tipos diferentes de adenovírus foram concentrados a partir de amostras de água por uma série de métodos diferentes. O DNA foi então extraído dos vírus e submetido à qPCR, para avaliar a eficiência relativa dos métodos de concentração.

Outra aplicação para enumeração microbiana baseada em qPCR é quantificar o conteúdo bacteriano em amostras de alimentos e agrícolas - neste exemplo, amostras fecais e de lixo de granjas de frango. Em vez de atingir espécies individuais, os cientistas realizaram qPCR usando primers contra um gene altamente conservado encontrado em todas as bactérias e quantificaram a comunidade bacteriana total encontrada nas amostras.

Finalmente, como mencionado anteriormente, uma desvantagem da metodologia tradicional qPCR é que micróbios vivos e mortos não podem ser distinguidos. No entanto, adicionando um químico conhecido como monóxido de propídio, ou PMA, que só pode entrar em células mortas onde se liga ao DNA para inibir reações enzimáticas subsequentes, como o PCR, os pesquisadores aqui foram capazes de distinguir entre culturas vivas e mortas de E. coli O157:H7, uma cepa patogênica comum encontrada em alimentos e água contaminados.

Você acabou de assistir a introdução do JoVE para quantificar microrganismos ambientais e vírus usando qPCR. Agora você deve entender como funciona o qPCR, como usar qPCR para medir a quantidade de um micróbio em uma amostra ambiental, e algumas aplicações dessa técnica. Obrigado por assistir!

Subscription Required. Please recommend JoVE to your librarian.

Applications and Summary

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A capacidade de quantificar cópias direcionadas do segmento genômico utilizando a técnica qPCR é importante em vários campos científicos. Os aplicativos de exemplo incluem:

(1) Enumerando patógenos na água, solo, alimentos, superfícies, etc.

O PCR em tempo real é utilizado para enumerar patógenos em vários ambientes. Durante os surtos, amostras de água e solo podem ser analisadas para que o patógeno de interesse encontre a fonte que causa a propagação. A fonte pode então ser analisada para enumerar a concentração do patógeno e determinar a quantidade de contaminação. Por exemplo, durante um surto de norovírus em um navio de cruzeiro que causou gastroenterite grave, vômitos e diarreia entre os passageiros, amostras de água e alimentos podem ser submetidas a PCR em tempo real para identificar a origem do vírus, por exemplo,água que não foi tratada adequadamente e continha alta contaminação fecal.

(2) Medir a redução de micróbios patogênicos por tratamento de águas residuais

A água de esgoto bruto contém uma abundância de microrganismos causadores de doenças e, portanto, deve ser tratada para proteger a saúde pública. Amostras de água podem ser coletadas em diferentes pontos ao longo de um trem de tratamento de águas residuais, e analisadas usando qPCR para determinar a redução dos níveis de microrganismos patogênicos, incluindo vírus. As reduções calculadas fornecem então informações valiosas sobre a eficácia dos processos de tratamento de águas residuais e possíveis aplicações de reaproveitamento de água.

(3) Medir marcadores genéticos funcionais no ambiente

As comunidades microbianas estão sujeitas a mudanças na adesão e flutuações na atividade devido às pressões ambientais. Essas mudanças podem ser monitoradas através da análise de genes funcionais que podem ser ativados por estressores ambientais específicos. O PCR em tempo real pode ser usado para quantificar a expressão desses genes em amostras para monitorar mudanças na atividade da comunidade microbiana. Por exemplo, o qPCR permite que os ecologistas microbianos quantifiquem a expressão de genes ativados para vias de biodegradação na presença de contaminantes feitos pelo homem presentes nos solos.

Subscription Required. Please recommend JoVE to your librarian.

References

  1. Zhang, T., Breitbart, M., et al. RNA Viral Community in Human Feces: Prevalence of Plant Pathogenic Viruses. PLoS Biology. 4, e3 (2005).
  2. Haramoto, E., et al. Occurrence of Pepper Mild Mottle in Drinking Water Sources in Japan. Applied Environmental Microbiology. 79, 7413-7418 (2013).

Transcript

Please note that all translations are automatically generated.

Click here for the English version.

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter