Directe observatie van Enzymen repliceren DNA met behulp van een Single-molecule DNA Stretching Assay

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

We beschrijven een methode voor de waarneming real-time replicatie van individuele DNA-moleculen gemedieerd door eiwitten van de bacteriofaag replicatie systeem.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

We beschrijven een methode voor de waarneming real-time replicatie van individuele DNA-moleculen gemedieerd door eiwitten van de bacteriofaag replicatie systeem. Gelineariseerd λ DNA is gemodificeerd om een ​​biotine aan het uiteinde van een streng, en een digoxigenine groep aan de andere kant van dezelfde streng zijn. De gebiotinyleerde einde is bevestigd aan een gefunctionaliseerd glazen dekglaasje en het digoxigeninated einde aan een kleine kraal. De montage van deze DNA-kraal aanbinden op het oppervlak van een flow cel kan een laminaire stroming te worden toegepast op een sleepkracht op de korrel uit te oefenen. Als gevolg daarvan is de DNA dicht uitgerekt tot en parallel aan het oppervlak van de dekglaasje op een kracht die wordt bepaald door het debiet (figuur 1). De lengte van het DNA wordt gemeten door het toezicht op de positie van de kraal. Lengte verschillen tussen enkel-en dubbelstrengs DNA worden gebruikt om real-time informatie te verkrijgen over de activiteit van de replicatie eiwitten op de vork. Het meten van de positie van de hiel zorgt voor een precieze bepaling van de tarieven en processivities van DNA rust te komen en polymerisatie (figuur 2).

Protocol

1. DNA-replicatie Template

DNA voor de reactie is een gelineariseerde λ DNA gewijzigd door gloeien van oligonucleotiden om een ​​replicatie vork te vormen. Daarnaast is biotine aan het uiteinde van een streng van het DNA λ, en een digoxigenine groep is aan het andere eind van dezelfde streng 1.

Materialen: Bacteriofaag λ DNA, Oligonucleotiden: gebiotinyleerd vork arm (A: 5'-biotine-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 '), λ-complementaire vork arm (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), vork primer (C: 5 ' -TGCCATATCTGAAATCCTCCCTGC-3 '), λ-complementaire digoxigenine end (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-digoxigenine-3'), T4 DNA-ligase, T4 polynucleotidekinase, Heat blokkeren.

  1. Fosforyleren de 5 'uiteinden van oligonucleotiden B en D met behulp van T4 polynucleotidekinase.
  2. Gloeien oligonucleotiden A, B en C aan de λ DNA in een stap door het toevoegen van een 10-voudige overmaat van oligonucleotiden A en B, en een 100-voudige overmaat van de oligonucleotide C in T4 DNA-ligase buffer.
  3. Verwarm het mengsel tot 65 ° C in de hitte te blokkeren. Eenmaal verwarmd, zet het vuur blok uit en laat langzaam afkoelen om goed te gloeien oligonucleotiden.
  4. Voeg T4 DNA ligase aan het mengsel en incubeer bij kamertemperatuur gedurende 2 uur. T4 DNA ligase zal katalyseren de juiste bundeling van oligonucleotiden A en B, en λ DNA.
  5. Tot slot, gloeien de oligonucleotide D naar de DNA-replicatie template door de toevoeging van 100-voudige overmaat van de oligonucleotide D met betrekking tot de l DNA in T4 DNA-ligase buffer.
  6. Incubeer het mengsel bij 45 ° C gedurende 30 minuten in de hitte blok en laat afkoelen tot kamertemperatuur langzaam door te draaien aan warmte te blokkeren uit te schakelen.
  7. De laatste DNA-replicatie sjabloon is nu klaar voor gebruik. Wij slaan de sjabloon in een concentratie van 1,4 nM bij 4 ° C gedurende enkele weken.

2. Beads

Kralen zijn gefunctionaliseerd met een Fab-fragment met specificiteit voor digoxigenine. Ze kunnen dan worden bevestigd aan de DNA-replicatie template 2.

Materialen: tosyl geactiveerd kralen, α-digoxigenine Fab fragment, Buffer A: 0,1 M H3BO3 pH 9,5, buffer B: 0,1 M PBS pH 7,4, 0,1% w / v BSA, Buffer C: 0,2 M Tris-HCl pH 8,5 (25 ° C), 0,1% w / v BSA, Magnetic Separator, Rotator.

  1. Resuspendeer de voorraad oplossing van kralen en de overdracht van een kleine hoeveelheid in de eppendorfbuisje. Plaats de buis in een sleuf van de magnetische separator en incubeer tot oplossing wist, dan supernatans verwijderen door pipetteren.
  2. Voeg buffer A, die zal tosyl groepen voor antilichaam koppeling te activeren. Meng voorzichtig door pipetteren en verwijder buffer met de magnetische separator.
  3. Opnieuw toe te voegen Fab-fragment en resuspendeer kralen in buffer A, grondig te mengen, en incubeer 16-24 uur bij 37 ° C met behulp van rotator. Na incubatie, aparte kralen met behulp van de magnetische separator en verwijder de buffer.
  4. Was kralen door het toevoegen van buffer B en incuberen bij 4 ° C gedurende 5 minuten. Verwijder de buffer met behulp van magnetische scheider. Herhaal het wassen twee keer.
  5. Voeg buffer C en incubeer bij 37 ° C gedurende 4 uur om gratis tosyl groepen te blokkeren. Aparte kralen met behulp van magnetische scheider en verwijder de buffer.
  6. Was twee keer in buffer B en aliquot voor gebruik. Kralen kunnen worden opgeslagen bij 4 ° C gedurende 1 jaar of langer zonder substantieel verlies van kwaliteit (onze voorraad oplossing bevat 1 - 2x10 9 kralen / ml).

3. Gefunctionaliseerde Dekglaasjes

Toe te staan ​​bevestiging van het DNA aan het glas dekglaasje, is het glas eerste gefunctionaliseerd met een aminosilaan, die vervolgens is gekoppeld aan gebiotinyleerd PEG-moleculen. Deze coating helpt om de niet-specifieke interacties tussen DNA en eiwitten replicatie te verminderen met het oppervlak 3,4.

Materialen: Glas dekglaasjes, vlekken potten, 3-aminopropyltriethoxysilaan, Methoxy-PEG5k-NHS ester, biotine-PEG5k-NHSester, aceton, 1M KOH, Ethanol, Oven, Bad ultrasoonapparaat

  1. Het glas zorgvuldig schoonmaken dekglaasjes door ze in de kleuren van potten en het vullen van de potten met ethanol. Sonificeer gedurende 30 minuten, spoel uit de potten en vul aan met 1 M KOH. Herhaal beide wast.
  2. Voor de eerste functionalisering reactie, alle sporen van water moeten worden verwijderd. Vul de potten met aceton en ultrasone trillingen gedurende 10 minuten. Leeg en vul weer met aceton.
  3. Bereid een 2% v / v oplossing van het silaan reagens in aceton. Toe te voegen aan de kleuring potten en schud gedurende 2 minuten. Deze reactie koppels de alkoxygroep van de aminosilaan aan het glas, waardoor een reactieve amine voor de volgende koppeling stap. Quench de reactie met een grote hoeveelheid water.
  4. Droog de dekglaasjes door het bakken ze op 110 °; C in de oven gedurende 30 minuten.
  5. Bereid een 50:1 methoxy: biotine PEG mengsel in 100 mM NaHCO 3 pH 8,2. Streven naar circa 0,2% w / v gebiotinyleerd PEG.
  6. Pipetteer 100 ul van de PEG mengsel op een droge gesilaniseerd dekglaasje aan en plaats nog een dekglaasje bovenop. Inclusief een glazen dekglaasje spacer zal scheiden van de dekglaasjes.
  7. Incubeer de dekglaasjes in de PEG-oplossing gedurende 3 uur, dan scheidt je elk paar van dekglaasjes en was uitgebreid met water. Wees voorzichtig om de dekglaasjes gefunctionaliseerde kant naar boven als slechts een keer zijde zal worden bekleed met PEG.
  8. Droog de dekglaasjes met lucht en op te slaan onder vacuüm bij een exsiccator. Het oppervlak blijft stabiel gedurende tenminste een maand, zodat tientallen dekglaasjes kunnen worden gemaakt in een batch en gebruikt als dat nodig is.

4. Flow Kamer Voorbereiding

Het experiment is uitgevoerd met behulp van een eenvoudige stroom kamer gebouwd met een gefunctionaliseerde dekglaasje, dubbelzijdige tape, een glijbaan en kwarts buizen. Een stroom kamer is bereid voor elke single-molecule experiment 2,4.

Materiaal: Dubbelzijdig tape, scheermesje, kwarts glijbaan met gaten voor slangen, snel droog epoxy, Gefunctionaliseerde dekglaasje, streptavidine-oplossing (25 il van 1 mg / ml in PBS), slangen, het blokkeren van buffer (5X: 20 mM Tris pH 7,5, 2 mM EDTA, 50 mM NaCl, 0,2 mg / ml BSA, 0,005% Tween-20), het werken buffer (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl).

  1. Begin met het mengen en het plaatsen van 5 ml van het blokkeren van buffer en 20 ml van het werken buffer in een exsiccator tot eventuele luchtbellen te verwijderen om later te stappen.
  2. Neem een ​​PEG-gefunctionaliseerde dekglaasje en de verspreiding van 125 PBS-verdunde streptavidine-oplossing over het oppervlak. Laat dit gedurende 20 minuten incuberen bij kamertemperatuur tijdens de voorbereiding van andere delen van de kamer, waardoor streptavidine aan de oppervlakte biotins te binden.
  3. Knip een stuk dubbelzijdig plakband om de grootte van de kwarts slide wedstrijd. Markeer de positie van de buis gaten in de tape, zodat een overzicht van de stroom kamer kan worden getrokken op de band.
  4. Maak een 3 mm brede center kanaal en rechthoeken die zowel gaten. We maken gebruik van stroom kamers met twee inlaat-en twee outlet Y-vormige kanalen.
  5. Knip langs de getekende omtrek, het maken van rechte, schoon snijdt dat er geen lijm steekt te maken in het kanaal.
  6. Reinig de kwarts grondig met aceton of ethanol om lijm te verwijderen van de vorige stroom cel constructie.
  7. Vind de beste uitlijning van het kanaal omtrek, verwijder de ene kant van de zelfklevende achterzijde en de zorgvuldig de tape plaats op de kwarts dia. Wees voorzichtig om de tape goed af te stemmen, omdat de inlaat en uitlaat gaten moeten blijven gedeblokkeerd.
  8. Lengte gesneden van buizen voor de inlaat en uitlaat van de stroom cel. Het helpt om het einde van de buis gesneden op ongeveer een hoek van 30 °, zodat de buis zal niet plat drukken tegen de kamer bodem. Plaats de buizen op een soort van ondersteuning (bv. buisvormige rekken) op te schorten voor eenvoudige bevestiging aan de stroom cel in de volgende stappen.
  9. Spoel de streptavidine-gecoate dekglaasje met water en droog met perslucht. Vergeet niet dat slechts een zijde is gefunctionaliseerd. Verwijder de andere zijde van de cassette en plaats de steun kwarts schuif op het dekglaasje.
  10. Druk lichtjes op het dekglaasje te duwen uit alle lucht in de lijm. Dit zal helpen voorkomen dat eventuele luchtbellen krijgen in de stroom-kanaal.
  11. Sluit de zijkanten van de kamer met epoxy. Steek de gesneden slang in de gaten van de kwarts en afdichting op zijn plaats met epoxy. Dit moet drogen voor een paar minuten.
  12. Eenmaal droog, beginnen te blokkeren het oppervlak door te trekken sommige van de ontgast blokkerende buffer via een van de buizen. Een 21-gauge naald past perfect in de 0,76 mm slang. Spoel een paar keer om luchtbellen te verwijderen, en laat de kamer om te incuberen gedurende minstens een half uur.

5. Single-molecule replicatie Experiment

Zodra de DNA-template en gefunctionaliseerde kralen zijn voorbereid, en de stroom kamer klaar is, kan een enkel-molecuul experiment worden uitgevoerd.

Materialen: Bereid stroom kamer, blokkeren buffer (5X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl, 1 mg / ml BSA, 0,025% Tween-20), Working buffer (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl), T7 replicatie buffers met of zonder 10 mM MgCl 2 (1X: 40 mM Tris-HCl pH 7,5, 50 mM K-glutamaat, 2 mM EDTA, 100 ug / ml BSA, 10 mM DTT, 600 uM dNTP's), replicatie eiwitten, omgekeerde optische microscoop met 10x objectief, CCD-camera, permanente zeldzame-aarde-magneet, spuit pomp, Luchtvering, fiber verlichting, computer met beeld acquisitie software.

  1. Na de stroom cel is geblokkeerd, is het klaar om het experiment te beginnen.
  2. Neem de stroom cel en plaats het op de microscoop podium. Houd de kamer op zijn plaats met podium clipsen zorg ervoor dat de stroom kanaal is gepositioneerd in lijn met CCD-camera.
  3. Sluit de stroom cel uitlaat buizen naar de Luchtvering met een grotere diameter connector buis of een naald. De Luchtvering wordt gebruikt om stroom onregelmatigheden te stabiliseren. Een 50 ml plastic buis wordt gevuld met 45 ml water. Het deksel van de buis wordt afgedicht met epoxy. Drie gaten doorboord in het deksel, en drie stukken van de buis worden ingebracht in de buis. Met behulp van epoxy, worden de buizen vervolgens verzegeld op het deksel, te voorkomen dat lucht in of ontsnappen. De Luchtvering is aangesloten op de spuit pomp, en de uitlaat buizen van de stroom cel.
  4. Plaats de inlaat buizen van de stroom cel in blokkeerbuffer en trek terug op de spuit om eventuele lucht te verwijderen in de buis. Een zachte tik van de afvoerbuis zal helpen duidelijke eventuele luchtbellen gevangen in de stroom cel.
  5. Zodra alle luchtbellen zijn verwijderd, blokkeren een van de inlaat buizen met een naald, en een van de uitlaat buizen door het buigen van het door 1800 en het veiligstellen van de buis met plakband.
  6. Verdun de voorraad DNA-template tot 10 uur in 1 ml ontgast blokkerende buffer. Stroom in de kamer bij matige debiet een goede oppervlakte-dekking van DNA (0.01 tot 0.05 ml / min gedurende 20 minuten werkt goed) mogelijk te maken. Dit kan worden gevarieerd op basis van het aantal DNA-moleculen op het oppervlak van elke partij dekglaasjes of hoeveel gewenst zijn voor het experiment.
  7. Verdun de voorraad kraal oplossing voor de 2-4x10 6 kralen / ml in 1 ml ontgast blokkerende buffer. Stroom in de kamer bij 0,01-0,05 ml / min gedurende 15 minuten.
  8. Zodra kralen worden toegevoegd, schakelt u de stroom uit en laat ruimte om evenwicht te bereiken. Sluit vervolgens beide uitlaatbuizen. Eventuele wijzigingen in de buizen zonder de kamer gesloten is zal veroorzaken drukschommelingen die een sterke kracht op de kralen en afschuiving van de vastgebonden DNA-moleculen zal uitoefenen.
  9. Blokkeer de inlaat buis die werd gebruikt voor het laden van kralen met een naald, en beginnen met het wassen van de stroom cel met behulp van de tweede inlaat met ontgaste 1X oplossing van het blokkeren van buffer in het werken buffer. Was uitgebreid met een snelheid van 0.01-0.05 ml / min. Schud de hand het podium door te tikken op een niet-specifiek kralen vast aan het oppervlak (verwijder Tappen ).
  10. Eenmaal vrij kralen zijn voldoende verwijderd, schakelt de stroom uit en laat ruimte voor evenwicht te bereiken. Sluit de open uitlaat buis en schakel de inlaat reservoir aan eiwit-oplossing, langzaam het openen van het stopcontact om snelle drukveranderingen te vermijden
  11. U kunt controleren of kralen worden aangebonden, om DNA door het veranderen van de richting van de stroming ( DNA ).
  12. Nu kan de enzymatische reactie worden uitgevoerd. Voor het leiden van-streng synthese experimenten maken 20nm oplossing van gp4 helicase en 20nm oplossing van GP5 polymerase (gezuiverd als een complex met zijn processivity factor thioredoxine) in ontgast T7 replicatie buffer die niet bevat MgCl 2.
  13. Doorstroming van het eiwit-oplossing in de kamer bij gematigde debiet voor een efficiënte binding te laten DNA. We maken gebruik van 0.037 ml / min gedurende 8 minuten, en dan 0,012 ml / min voor 7 minuten.
  14. Was de kamer met ontgast T7 replicatie buffer zonder MgCl 2 tot en met vrij eiwitten te verwijderen. De snelheid van 0,037 ml / min gedurende 3-10 minuten werkt prima.
  15. Na het wassen, stroming T7 replicatie buffer met MgCl 2 en begint data-acquisitie. Gebruik een debiet van 0.012 ml / min, overeenkomend met 3 pN slepen werking op de DNA aanbinden onder de voorwaarden beschreven in dit protocol.
  16. Plaats een zeldzame-aarde permanente magneet boven de stroom cel voor beeldvorming om niet-specifieke interacties tussen kralen en het oppervlak te voorkomen.
  17. Bekijk veld met een 10x objectief en CCD-camera. Focus met behulp van een vastgebonden kraal.
  18. Plaats een vezel illuminator met een incidentie hoek tussen 10 graden en parallel aan de microscoop stadium de buurt van de microscoop. Dark-veld verlichting wordt gebruikt om het contrast in de kraal beeldvorming te verhogen.
  19. Verkrijgen gegevens voor 20 30 min bij een trage frame rate (meestal 2-4 Hz).

6. Representatieve resultaten

In een geslaagd experiment moet je in staat zijn om gelijktijdig waarnemen meer dan 100 kralen ( Leading streng synthese ). Het experiment moet opleveren talrijke sporen weergave van toonaangevende streng DNA-synthese.

Data-analyse:

Om de tarieven en processivities van DNA tot rust te komen en polymerisatie te meten, moet de precieze posities van kralen worden bepaald. Je kan bereiken door het aanbrengen van deze posities met 2-dimensionale Gaussiaanse functies. Trajecten kunnen vervolgens worden uitgepakt door het volgen van kraal positie op elk frame met behulp van tracking software (bijv. DiaTrack). Nu bent u klaar om trajecten te visualiseren door het plotten kraal positie als een functie van de tijd met behulp van een grafisch, zodatftware (bijv. Origin). Voor het verkrijgen van snelheid gegevens, passen de percelen met een lineaire regressie en het berekenen van de helling. Voor processivity, bepalen van de totale lengte van het DNA van het begin tot het einde van een verkorting gebeurtenis (figuur 3). Beide nummers zullen moeten worden omgezet naar baseparen. Om te converteren kraal beweging om basenparen, moet u eerst de lengte van een uitgestrekt λ DNA-molecuul te meten over de reactie debiet. Omdat de lengte van de λ DNA bekend is (48.502 bp) kunt u kalibreren van het aantal basenparen / pixel aan experimentele kracht. Voor een betere nauwkeurigheid, aftrekken van de sporen van belang een baseline spoor van een kraal ketting die niet enzymatisch is veranderd. Combineer alle single metingen en plot snelheid en processivity distributies. Passen bij de gegevens met behulp van Gauss en single-exponentiële functies, respectievelijk (figuur 3).

Figuur 1
Figuur 1. Single-molecule experimentele opstelling. (A) Duplex λ DNA (48,5 kb) wordt gehecht aan het oppervlak van de flow cel via het 5 'uiteinde van een streng met behulp van een biotine-streptavidine interactie, en het 3' uiteinde van dezelfde streng is bevestigd aan een kraal met behulp van een digoxigenine anti-digoxigenine interactie. Een primer replicatie vork is gevormd aan het eind tegenover de kraal om het laden van de polymerase. (B) Bead-DNA assemblies zijn opgerekt met behulp van laminaire stroming van buffer en beeld gebracht met behulp van wide-field optische microscopie. Door het volgen van de posities van de kralen in de tijd, met behoud van een constante kracht die zich uitstrekt, kan de lengte van de DNA-constructen worden gecontroleerd. (C) Uitbreiding profiel van ssDNA (gevulde cirkel) en dsDNA (open cirkel) onder lage krachten. Stippellijn geeft kristallografische lengte van volledig ds-λ DNA, 16,3 micrometer. Het grote verschil in lengte tussen ssDNA en dsDNA op krachten rond 3 pN maakt een directe observatie van conversies tussen ss-en dsDNA door het bewaken van veranderingen in het DNA lengte. De gelijktijdige visualisatie van grote aantallen DNA-gekoppelde beads maakt voor de studie van de vele individuele replisomes in een experiment.

Figuur 2
Figuur 2 bacteriofaag T7 replicatie eiwitten:. DNA-polymerase (complex van GP5 en thioredoxine) en DNA helicase (GP4) synthese van DNA toonaangevende streng in de aanwezigheid van deoxyribonucleotiden en magnesium. Dit proces gaat gepaard met verkorting van de DNA-streng te wijten aan achterblijvende wikkelen. Conversie van dsDNA in ssDNA veranderingen positie van de kraal. Het meten van positie van de hiel zorgt voor een precieze bepaling van de snelheid en processivity van DNA-replicatie.

Figuur 3
Figuur 3. Voorbeeld van een typische gegevens van een single-molecule leading-streng synthese van experiment. Processivity van de DNA-replicatie is gelijk aan een totale lengte van het DNA van het begin tot het einde van een verkorting gebeurtenis. Het tarief van de DNA-replicatie wordt verkregen door de montage van de plot met een lineaire regressie en de berekening van de helling. De inzet toont snelheid en processivity distributies die werden verkregen door het combineren van gegevens van een aantal metingen. De gegevens werden gemonteerd met behulp van Gauss en single-exponentiële functies, respectievelijk.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Het is belangrijk om ervoor te zorgen dat de weerstand kracht uitgeoefend op kralen door laminaire stroming niet enzymatische activiteiten van de replicatie eiwitten beïnvloeden. Bijvoorbeeld, heeft een 3 pN kracht die overeenkomt met een debiet van 0.012 ml / min geen invloed op de replicatie van het DNA toonaangevende streng. Het heeft echter wel invloed op enzymatische activiteiten die plaatsvinden tijdens gecoördineerd DNA-synthese, en daarom moet worden teruggebracht tot 1,5 PN. De wrijving kan eenvoudig worden gecontroleerd door het veranderen van het debiet of een breedte van de stroom kanaal 5.

De DNA-test maakt gebruik van stretching lengte verschillen tussen de dubbel-en enkelstrengs DNA. In het experiment hier beschreven de omzetting van dsDNA om ssDNA optreedt als gevolg van de leidende streng synthese (Figuur 2). Je moet niet vergeten dat de ssDNA is alleen korter dan dsDNA bij lage rekken krachten onder de 6 pN (figuur 1).

Een mogelijke verbetering van deze methode is om de achterblijvende streng van de replicatie template te wijzigen door het aanbrengen van een tweede kraal aan zijn 3'-uiteinde. Een dergelijke afwisseling zou directe observatie van enzymatische activiteiten die plaatsvinden op beide strengen van het DNA.

Naast studies van de toonaangevende streng synthese en gecoördineerd replicatie, heeft de DNA-stretching test met succes toegepast om de single-molecule kinetiek van λ exonuclease, en de dynamiek van polymerase-uitwisseling te onderzoeken tijdens de replicatie 5,6. In principe kan deze methode worden gebruikt om een ​​DNA-verwerking enzym te bestuderen.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

De ontwikkeling van de DNA-stretching test werd geholpen door Paul Blainey, Jong-Bong Lee, en Samir Hamdan. Dit werk wordt ondersteund door de National Institutes of Health beurzen aan Charles Richardson (GM54397) en Antoine van Oijen (GM077248).

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics