Author Produced

Секвенирование бактериальной микрофлоры в периферической крови: Наш опыт работы с ВИЧ-инфицированных пациентов

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Наш эксперимент покажет, как выполнить последовательность анализа видов бактерий translocating в периферической крови ВИЧ-инфицированных пациентов.

Cite this Article

Copy Citation | Download Citations

Merlini, E., Bellistri, G. M., Tincati, C., d'Arminio Monforte, A., Marchetti, G. Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients. J. Vis. Exp. (52), e2830, doi:10.3791/2830 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Здоровый желудочно-кишечного тракта является физиологически колонизирована большое разнообразие комменсальной микробов, которые влияют на развитие гуморального и клеточного иммунного 1,2 слизистой системы.

Микробиоты защищена от иммунной системы с помощью сильного слизистый барьер. Инфекции и антибиотики, как известно, изменить как в нормальном, желудочно-кишечного тракта и барьер состав резидентов бактерий, которые могут привести к возможной иммунных нарушений 3.

ВИЧ вызывает нарушения в желудочно-кишечный барьер с прогрессивной провал иммунитет слизистой оболочки и утечки в системный кровоток бактериальных биопродуктов, таких как липополисахарида и бактериальных фрагментов ДНК, которые способствуют системной активации иммунной 4-7. Микробная транслокация замешана в борьбе с ВИЧ / СПИДом иммунопатогенеза и реакции на лечение 4,8.

Мы стремились, чтобы характеризовать состав бактерий translocating в периферической крови ВИЧ-инфицированных пациентов. Для осуществления нашей цели мы создали для реакции ПЦР для panbacteric 16S ribosomial генов последующим секвенирования.

Короче говоря, цельная кровь с обеих ВИЧ-инфицированных и здоровых людей используется. Учитывая, что здоровых людей настоящее нормальной кишечной гомеостаза не транслокация микрофлоры, как ожидается, у этих пациентов. После целого сбора крови из вены и плазмы разделение, ДНК, извлеченных из плазмы и используется для выполнения широкого спектра ПЦР-реакции panbacteric 16S ribosomial ген 9. После очистки продукт ПЦР, клонирования и секвенирования анализы выполняются.

Protocol

Обработка ВИЧ-инфицированных образцов крови требует некоторых важных рекомендаций.
Все образцы крови должны перевозиться в надежных герметичных контейнерах. Необходимо соблюдать осторожность при сборе образцов, чтобы избежать загрязнения внешней контейнера и любых сопровождающих документов образца.
Все лица, обработки зараженной кровью, должны носить перчатки. Перчатки должны быть изменены и руки мыть после завершения обработки образцов.
Обработка ВИЧ-инфицированных образцов крови должно быть сделано в классе II капот кабинет биологической опасности.
Механические пипетки средства должны быть использованы.
Использование игл и других острых инструментов (в том числе, например, стеклянные пипетки или капиллярной трубки) должно быть ограничено ситуациями, в которых нет альтернативы.
Лаборатория поверхности должны быть обеззаражены дезинфицирующим раствором химического после разлива крови и при работе мероприятия будут завершены.
Загрязненная используемые материалы должны быть обеззаражены перед повторным использованием или должны быть уничтожены с помощью правильного клинического маршрут отходов.
Каждый случай профессионального контакта с потенциально инфицированными кровью или жидкостями (т.е. тех, которые требуют универсальных мер предосторожности) следует рассматривать в качестве неотложной медицинской помощи, как мероприятия должны быть начаты незамедлительно быть эффективным.
Протокол требует 5 дней для его завершения. Таймфрейма, изображенной на рисунке 1.
Бактериальные виды идентифицируются с помощью методов, описанных на рисунке 2.

1. Забора проб

  1. 9 мл цельной крови втягивается в ЭДТА содержащие труб.
  2. Трубы центрифугировали при 2000 оборотов в минуту в течение 10 минут при комнатной температуре для получения плазмы.
  3. Плазма собирается в стерильный 2 мл Eppendorf-трубку.

2. Экстракции ДНК из плазмы крови

  1. Адекватно дезинфекции капот, пипетки и материалы, необходимые для эксперимента, чтобы гарантировать стерильность.
  2. Установите все материалы под ультрафиолетовых ламп в течение 30 минут.
  3. Протрите перчатки с дезинфицирующим средством.
  4. Замочите несколько бумажных полотенец в этаноле и поставить их под капотом. Каждый раз, когда кончик отбрасывается протрите пипетки на мокрой бумажные полотенца.

ДНК извлекали с помощью коммерческого набора следующими инструкциями изготовителя (Easy-DNA Kit, Invitrogen, Карлсбад Калифорния, США).

  1. 350 мкл плазмы помещают в стерильную пробирку 2 мл Эппендорф.
  2. 350 мкл с фильтром сверхчистой воды используются в качестве отрицательного контроля.
  3. Добавьте 10 мкл лизоцима (1mg/ml) для образцов.
  4. Инкубировать 30 минут при 37 ° C.
  5. Добавить 500 мкл Лизис решения и осторожно смешать с образцами.
  6. Инкубируйте в течение 7 минут при температуре 65 ° C.
  7. Добавить 900 мкл хлороформа в образцах.
  8. Vortex энергично, пока образцы равномерно вязкой.
  9. Добавьте 200 мкл раствора осадков и вихревые энергично.
  10. Центрифуга образцов при 10500 оборотов в минуту в течение 10 минут при комнатной температуре для разделения фаз и образуют интерфейс.
  11. Передача верхней водной фазы в новую пробирку микроцентрифужных, содержащей 1 мл этанола 100%.
  12. Центрифуга образцов при 10500 оборотов в минуту в течение 10 минут при 4 ° C.
  13. Удалить этанола.
  14. Добавить 1 мл этилового спирта 70%.
  15. Центрифуга образцов при максимальной скорости в течение 10 минут при 4 ° C.
  16. Удалить этанола. Остаточного этанола должна быть удалена с pipettator.
  17. Ресуспендируют гранул в 50 мкл воды высокой степени очистки.
  18. Прочитано концентрации ДНК с помощью спектрофотометра.

3. 16S рРНК генов ПЦР

ПЦР-амплификации проводят, как описано выше 9.

  1. Amplify ДНК в 100 мкл реакционной смеси, состоящей из 10 мкл 10х буфера ПЦР, 5 мкл 25 мМ MgCl2, 5 мкл 2 мМ общего дНТФ, 1 мкл 50 мкМ грунтовки RW01 (AACTGGAGGAAGGTGGGGAT), 1 мкл 50 мкМ грунтовки DG74 (AGGAGGTGATCCAACCGCA), 34 мкл H20 и 0,5 мкл Taq-полимеразы (AmpliTaq Золото, прикладной Biosystem, Фостер Сити, Калифорния, США).
  2. Передача ПЦР смеси в фильтры, чтобы избежать возможного заражения бактериальными полимеразы Taq.
  3. Центрифуга фильтры (микроконтроллер, Millipore, Billerica, Массачусетс, США) в течение 30 минут при 500 RCF при 4 ° C.
  4. Аликвотировать смесь ПЦР в зависимости от количества проб, которые должны быть усилены (положительный и отрицательный ПЦР-контроль, образцы и экстрагируют водой).
  5. Используйте следующие тепловые условия циклер: 94 ° С в течение 10 минут, 40 раз в течение 1 минуты каждый раз при 94 ° С, 55 ° C и 72 ° С и 10 мин при 72 ° C.
  6. Визуализация продукта ПЦР на 2% агарозном геле. Используйте 100 б.п. ДНК лестнице. ПЦР-продукта размером около 360 б.п. (рис. 3).

4. ПЦР продукт очистки

Только ПЦР-положительных образцов должны быть очищены. Очистка производится с помощьюкоммерческим производителем следующий набор инструкций (PureLink ПЦР microkit, Invitrogen, Карлсбад Калифорния, США).

  1. Добавить 4 тома Привязка буфер, содержащий изопропиловый спирт на 1 объем продукта ПЦР.
  2. Передача продукта ПЦР Связующее Буфер колонки.
  3. Центрифуга в течение 1 минуты при 10000 RCF при комнатной температуре.
  4. Промыть колонку с промывочного буфера, содержащих этанол.
  5. Центрифуга в течение 1 минуты при 10000 RCF при комнатной температуре.
  6. Центрифуга с максимальной скоростью в течение 1 минуты при комнатной температуре в сухом кремнезема мембраны и удалить остатки промывочного буфера с этанолом.
  7. Добавьте 10 мкл воды высокой степени очистки.
  8. Инкубируйте в течение 1 минуты при комнатной температуре.
  9. Центрифуга на максимальной скорости в течение 2 минут при комнатной температуре для сбора очищенной ДНК.

5. Клонирование

Лизогении Отвар (LB) пластина подготовка

  1. Растворить 25 г смеси в LB примерно 800 мл воды.
  2. Довести до конечного объема 1 л
  3. Добавьте 15 г Bactoagar.
  4. Автоклав на 20 минут.
  5. После автоклавирования, энергично водоворот раствор в колбе смешать расплавленный агар.
  6. Охладите раствор до 50 ° C.
  7. Добавить ампициллин (50 мкг / мл) и водоворот, пока он не растворится.
  8. Налейте пластины на глубину около 3 мм.
  9. Оставьте пластин при комнатной температуре.
  10. Распространение X-Gal (40mg/ml) и IPTG (100 мм) на каждой пластине LB и инкубировать при 37 ° С до готовности к использованию.

Компетентные Преобразование Клетки

Преобразование производится с помощью инструкции коммерческим производителем следующий комплект (Topo Т. А. Клонирование комплект, Invitrogen, Карлсбад Калифорния, США).

  1. Подготовьте смесь клонирования реакции (1-4 мкл свежий продукт ПЦР, 1 мкл раствора соли, 1 мкл вектора и воды, если это необходимо).
  2. Смешайте реакции мягко и инкубировать в течение 5-10 минут при комнатной температуре.
  3. Место реакции на льду.
  4. Добавьте 2 мкл клонирования реакции в пузырек компетентных клеток и аккуратно перемешать.
  5. Инкубировать на льду в течение 30 минут.
  6. Тепло-шок клетки в течение 30 секунд при температуре 42 ° C.
  7. Сразу передачи трубки в лед.
  8. Добавьте 250 мкл среды.
  9. Крышка трубки tighly и встряхните пробирку горизонтально при температуре 37 ° С в течение 1 часа.
  10. Спред 50 мкл из каждого преобразования на нагретого селективного пластины.
  11. Выдержите в течение ночи при температуре 37 ° C.

После инкубации, белый и синий колонии развиваться по тарелкам. Белый колонии являются позитивными для вставки продуктов ПЦР и синие колонии отрицательным для вставки продуктов ПЦР.

6. Последовательность анализа

Последовательность реакций

  1. Смеси производится с использованием этих реагентов: 2,5 мкл ДНК, 1 мкл праймера (5pmol / мкл) 1,1 мкл BigDye (Applied Biosystem, Фостер Сити, Калифорния, США).
  2. Температурные условия циклер: 96 ° С в течение 1 минуты, 25 раз за 96 ° С в течение 10 сек, 55 ° С в течение 15 сек и 60 ° С в течение 4 мин.

Колонка очистки

  1. Для каждой реакции, подготовить один MicroSpin Колонка (Qiagen,, Милан, Италия).
  2. Обратить колонки и вихревые смешать смолу.
  3. Привязка от нижней части колонны, ослабьте крышку ¼ оборота, и место в колонке микроцентрифужных трубки.
  4. Центрифуга 3200 оборотов в минуту в течение 1 минуты.
  5. Передача колонку в чистую пробирку микроцентрифужных.
  6. Тщательно пипетки всей последовательности ПЦР-реакции в центре колонны.
  7. Центрифуга 3200 оборотов в минуту в течение 1 минуты.
  8. Очищенная ДНК eluite в трубку (20 мкл воды высокой степени очистки).

Последовательность анализа

  1. Нагрузка очищенного образца (20 мкл) в 96-многоямного пластины.
  2. Нагрузка пластинки в секвенсор. Автоматизированная Секвенсоры ДНК генерировать с четырьмя цветами хроматограмме, показывающей результаты секвенирования перспективе.
  3. Входной нуклеотидную последовательность, запрос к общедоступные базы данных последовательности. Поиск осуществляется по NCBI баз данных и серверов, с базовой инструмент местной Поиск Выравнивание (BLAST).
  4. Рассмотрим только бактерии с 98-100% гомологии.

7. Представитель Результаты

Рисунок 1
Рисунок 1. Хронология процедуры.

Рисунок 2
Рисунок 2. Технологические схемы всей бактериальной процедуру идентификации.

Рисунок 3
Рисунок 3. 2% агарозном геле показывает широкий спектр гена 16S рРНК продуктов ПЦР. Лейн 1 содержит 100bp лестницу ДНК, переулок 2 содержит ПЦР положительный контроль, переулок 3 показывает отрицательный контроль ПЦР. Лейн 4 показаны образцы из ВИЧ-позитивных пациентов, и переулок 5 содержит воду. Лейн 6 шРМО образцы из здорового человека и негативной реакции ПЦР, переулок 7 содержит воду. Только ВИЧ-положительных пациентов показывает положительный ПЦР. Сверхчистой воды, используемой в качестве отрицательного контроля в процессе добычи шаг, указывает, что загрязнение произошло.

Рисунок 4
Рисунок 4. 0,7% агарозном геле показывает плазмиды экстрагируют процедуры miniprep. Лейн 1 содержит 1 Kilobase ДНК лестнице, переулок 2 содержит синий колонии контроль, переулков с 3 по 12 содержат белые колонии. Плазмиды из синего колонии не содержит ПЦР вставить продукта. Все 10 белых колоний содержат плазмиду с правильной вставки.

Рисунок 5
Рисунок 5. Показывает пример бактериального анализа последовательности в плазме крови от одного ВИЧ-позитивным человеком. Наши результаты показывают, что микробная транслокация в ВИЧ-инфекции включает в себя polimicrobic флоры, которая не видела у ВИЧ-отрицательных субъектов, предлагая существенные неудачи кишечника иммунитет в борьбе с бактериями транслокации.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Нет конфликта интересов объявлены.

Acknowledgements

Мы благодарны Джанни Scimone за отличную помощь с видео-решений.

Materials

Name Company Catalog Number Comments
Easty-DNA Kit Invitrogen K 180001
Chloroform Sigma-Aldrich C2432
Ethanol Sigma-Aldrich E7203
UltraPure Waer Invitrogen 10977049
Lysozyme Fluka 62970 10 μg/mL in Distillated Water
AmpliTaq Gold Applied Biosystems 26478701
Microcon 100 EMD Millipore 42413
PCR primers Invitrogen
Agarose Eppendorf C1343
DNA ladder Invitrogen 15628019
Purelink PCR micro kit Invitrogen K310050
LB Agar, powder Invitrogen 22700025
Bactoagar Invitrogen
Ampicillin Invitrogen 11593027 10 mg/mL in Distillated Water
X-gal Invitrogen 15520034 40mg/mL in DMF
IPTG Invitrogen 15529019 100mM in Distillated water
Topo TA cloning kit Invitrogen K450002
Purelink Quick Plasmid Miniprep kit Invitrogen K210010
Big dye Applied Biosystems 4337455
DyeEx 2.0 spin kit Qiagen 63204

DOWNLOAD MATERIALS LIST

References

  1. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  2. Macpherson, A. J., Harris, N. L. Interactions between commensal intestinal bacteria and the immune system. Nat Rev Immunol. 4, 478-485 (2004).
  3. Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. Modification of intestinal flora in the treatment of inflammatory bowel disease. Curr Pharm Des. 9, 333-346 (2003).
  4. Brenchley, J. M. Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat Med. 12, 1365-1371 (2006).
  5. Brenchley, J. M., Price, D. A., Douek, D. C. HIV disease: fallout from a mucosal catastrophe. Nat Immunol. 7, 235-239 (2006).
  6. Jiang, W. Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection. J Infect Dis. 199, 1177-1185 (2009).
  7. Marchetti, G. Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy. AIDS. 22, 2035-2038 (2008).
  8. Marchetti, G. Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART. The 17th Conference on Reteroviruses and Opportunistic Infections (CROI), San Francisco, CA, USA, (2010).
  9. Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol. 32, 335-351 (1994).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics