Author Produced

परिधीय रक्त में बैक्टीरियल microflora के अनुक्रमण: एचआईवी संक्रमित मरीजों के साथ हमारे अनुभव

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

हमारे प्रयोग में दिखा देंगे कि कैसे बैक्टीरियल एचआईवी पॉजिटिव रोगियों के परिधीय रक्त में translocating प्रजातियों के अनुक्रमण विश्लेषण प्रदर्शन करने के लिए.

Cite this Article

Copy Citation | Download Citations

Merlini, E., Bellistri, G. M., Tincati, C., d'Arminio Monforte, A., Marchetti, G. Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients. J. Vis. Exp. (52), e2830, doi:10.3791/2830 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

स्वस्थ जठरांत्र संबंधी मार्ग physiologically खानेवाला रोगाणुओं कि humoral और सेलुलर mucosal प्रतिरक्षा प्रणाली 1,2 के विकास के प्रभाव का एक विशाल विविधता के द्वारा colonized है.

Microbiota एक मजबूत mucosal बाधा के माध्यम से प्रतिरक्षा प्रणाली से परिरक्षित है. संक्रमण और एंटीबायोटिक दवाओं के लिए दोनों सामान्य जठरांत्र संबंधी मार्ग बाधा है और निवासी बैक्टीरिया की संरचना है, जो संभव प्रतिरक्षा असामान्यताएं में 3 परिणाम हो सकता है बदल जाना जाता है.

एचआईवी mucosal और lipopolysaccharide और बैक्टीरियल डीएनए टुकड़े के रूप में बैक्टीरिया bioproducts, जो प्रणालीगत प्रतिरक्षा सक्रियण 4-7 योगदान के प्रणालीगत संचलन में प्रतिरक्षा रिसाव के प्रगतिशील विफलता के साथ जठरांत्र बाधा में एक दरार का कारण बनता है . माइक्रोबियल स्थानान्तरण एचआईवी / एड्स immunopathogenesis और 4,8 चिकित्सा के जवाब में फंसा है.

हम एचआईवी संक्रमित रोगियों के परिधीय रक्त में translocating बैक्टीरिया की संरचना विशेषताएँ के उद्देश्य से. हमारा उद्देश्य को आगे बढ़ाने के लिए हम panbacteric -16 ribosomial एक अनुक्रमण विश्लेषण द्वारा पीछा जीन के लिए एक पीसीआर प्रतिक्रिया सेट.

संक्षेप में, दोनों एचआईवी संक्रमित और स्वस्थ विषयों से पूरे रक्त का प्रयोग किया जाता है. यह देखते हुए कि स्वस्थ व्यक्तियों सामान्य आंत्र homeostasis वर्तमान microflora की कोई स्थानान्तरण इन रोगियों में होने की उम्मीद है. Venipuncture और प्लाज्मा जुदाई से पूरे रक्त संग्रह के बाद, डीएनए प्लाज्मा से निकाला जाता है और 9 जीन ribosomial panbacteric -16 के लिए एक व्यापक रेंज पीसीआर प्रतिक्रिया करने के लिए इस्तेमाल किया. के बाद पीसीआर उत्पाद शुद्धि, क्लोनिंग और अनुक्रमण विश्लेषण प्रदर्शन कर रहे हैं.

Protocol

एचआईवी संक्रमित रक्त के नमूनों की हैंडलिंग के लिए कुछ महत्वपूर्ण सिफारिशें की आवश्यकता है.
रक्त के सभी नमूनों को मजबूत रिसाव सबूत कंटेनर में ले जाया जाना चाहिए. देखभाल जब नमूना इकट्ठा करने के लिए कंटेनर बाहरी और किसी भी कागजी कार्रवाई के साथ नमूना के संक्रमण से बचने लिया जाना चाहिए.
सभी व्यक्तियों को संक्रमित रक्त प्रसंस्करण दस्ताने पहनना चाहिए. दस्ताने और परिवर्तित किया जाना चाहिए नमूना प्रसंस्करण के पूरा होने के बाद हाथ धोए.
एक वर्ग द्वितीय biohazard कैबिनेट हुड में एचआईवी संक्रमित रक्त के नमूनों का प्रसंस्करण किया जाना चाहिए.
यांत्रिक pipetting एड्स इस्तेमाल किया जाना चाहिए.
सुई या अन्य sharps (कांच जैसे pipettes या केशिका ट्यूब सहित) का प्रयोग स्थितियों में कोई विकल्प नहीं है के लिए सीमित होना चाहिए.
प्रयोगशाला सतहों रक्त के एक फैल के बाद एक उपयुक्त रासायनिक निस्संक्रामक के साथ decontaminated होना चाहिए और जब काम गतिविधियों को पूरा कर रहे हैं.
दूषित इस्तेमाल सामग्री पुन: उपयोग से पहले decontaminated होना चाहिए या से निपटाया जाना चाहिए नैदानिक ​​बर्बाद मार्ग के माध्यम से सही ढंग से.
संभावित संक्रामक खून या तरल पदार्थ (यानी, उन सार्वभौमिक सावधानियों की आवश्यकता होती है) के लिए व्यावसायिक जोखिम का हर घटना एक आपातकालीन चिकित्सा के रूप में व्यवहार किया जाना चाहिए के रूप में हस्तक्षेप तुरंत शुरू किया जाना चाहिए करने के लिए प्रभावी हो.
प्रोटोकॉल इसके पूरा करने के लिए 5 दिन की आवश्यकता है. समय सीमा चित्रा 1 में विस्तृत है.
बैक्टीरियल प्रजातियों चित्रा 2 में वर्णित विधियों का उपयोग कर की पहचान कर रहे हैं.

1. नमूना संग्रह

  1. पूरे रक्त का 9 मिलीलीटर EDTA युक्त ट्यूबों में तैयार की है.
  2. ट्यूब आरटी से कम 10 मिनट के लिए 2000 rpm पर centrifuged प्लाज्मा प्राप्त करने के लिए.
  3. प्लाज्मा एक बाँझ 2 मिलीलीटर Eppendorf - ट्यूब में एकत्र किया जाता है.

2. प्लाज्मा के नमूने से डीएनए निष्कर्षण

  1. पर्याप्त रूप से हुड pipettes, और प्रयोग के लिए आवश्यक क्रम में बाँझपन गारंटी सामग्री कीटाणुरहित.
  2. यूवी लाइट के तहत कम से कम 30 मिनट के लिए सभी सामग्री की स्थिति.
  3. एक निस्संक्रामक के साथ दस्ताने पोछो.
  4. इथेनॉल में कुछ कागज तौलिए भिगोएँ और हुड के तहत उन्हें जगह. हर बार एक टिप खारिज कर दिया है गीला कागज तौलिए पर विंदुक पोंछ.

डीएनए निर्माता के निर्देशों (आसान डीएनए किट, Invitrogen, Carlsbad सीए, संयुक्त राज्य अमेरिका) के बाद एक वाणिज्यिक किट का उपयोग करने के लिए निकाला जाता है.

  1. प्लाज्मा के 350 μL एक बाँझ 2ml Eppendorf ट्यूब में रखा जाता है.
  2. फ़िल्टर ultrapure पानी के 350 μL नकारात्मक नियंत्रण के रूप में उपयोग किया जाता है.
  3. नमूने के lysozyme (1mg/ml) के 10 μL जोड़ें.
  4. 37 पर 30 मिनट के लिए सेते डिग्री सेल्सियस
  5. Lysis समाधान के 500 μL जोड़ें और नमूने के लिए धीरे मिश्रण.
  6. 65 में 7 मिनट के लिए सेते ° सी.
  7. नमूने के क्लोरोफॉर्म की 900 μL जोड़ें.
  8. सख्ती भंवर जब तक नमूने समान चिपचिपा हैं.
  9. वर्षा समाधान और सख्ती भंवर 200 μL जोड़ें.
  10. आरटी से कम 10 मिनट के लिए 10,500 rpm पर नमूने अपकेंद्रित्र चरणों अलग और इंटरफ़ेस फार्म.
  11. एक ताजा microcentrifuge इथेनॉल 100% की एक मिलीलीटर युक्त ट्यूब ऊपरी जलीय चरण स्थानांतरण.
  12. 4 में 10 मिनट के लिए 10,500 rpm पर नमूने अपकेंद्रित्र डिग्री सेल्सियस
  13. इथेनॉल निकालें.
  14. 70% इथेनॉल 1ml जोड़ें.
  15. 4 में 10 मिनट के लिए अधिकतम गति पर नमूने अपकेंद्रित्र डिग्री सेल्सियस
  16. इथेनॉल निकालें. अवशिष्ट इथेनॉल pipettator के साथ हटा दिया जाना चाहिए.
  17. Ultrapure पानी की 50 μL में गोली Resuspend.
  18. एक स्पेक्ट्रोफोटोमीटर के साथ डीएनए एकाग्रता पढ़ें.

3. -16 RRNA जीन पीसीआर

पीसीआर प्रवर्धन 9 पहले से वर्णित के रूप में किया जाता है.

  1. एक 100 μL प्रतिक्रिया 10X पीसीआर बफर, 25 MgCl2 मिमी के 5 μL, 2 मिमी कुल dNTPs 5 μL, 50 सुक्ष्ममापी RW01 प्राइमर (AACTGGAGGAAGGTGGGGAT) के 1 μL, 50 सुक्ष्ममापी DG74 प्राइमर के 1 μL के 10 μL मिलकर मिश्रण में डीएनए बढ़ाना (AGGAGGTGATCCAACCGCA), H20 के 34 μL और Taq पोलीमरेज़ (AmpliTaq गोल्ड, एप्लाइड Biosystem, फोस्टर शहर, सीए, संयुक्त राज्य अमेरिका) के 0.5 μL.
  2. फिल्टर में पीसीआर मिश्रण स्थानांतरण क्रम में बैक्टीरियल Taq पोलीमरेज़ द्वारा संभव संक्रमण से बचने के लिए.
  3. 500 आरसीएफ में 30 मिनट के लिए अपकेंद्रित्र (Microcon, Millipore, Billerica, MA, संयुक्त राज्य अमरीका) 4 फिल्टर ° सी.
  4. विभाज्य पीसीआर नमूने जो (सकारात्मक और नकारात्मक पीसीआर नियंत्रण, नमूनों और पानी निकाले) परिलक्षित हो की जरूरत की संख्या के अनुसार मिश्रण.
  5. निम्नलिखित थर्मल cycler शर्तों का उपयोग करें: 94 ° C 10 मिनट के लिए, 94 पर 1 मिनट प्रत्येक समय के लिए 40 बार डिग्री सेल्सियस, 55 डिग्री सेल्सियस और 72 डिग्री सेल्सियस और 72 डिग्री सेल्सियस पर 10 मिनट
  6. एक 2% agarose जेल पर पीसीआर उत्पाद कल्पना. 100 बीपी डीएनए सीढ़ी का उपयोग करें. पीसीआर उत्पाद का आकार 360 बीपी (चित्रा 3) के बारे में है.

4. पीसीआर उत्पाद शोधन

केवल पीसीआर सकारात्मक नमूने शुद्ध होना चाहिए. शोधन का उपयोग किया जाता हैएक वाणिज्यिक किट निम्नलिखित निर्माता के निर्देशों (पीसीआर PureLink microkit, Invitrogen, Carlsbad सीए, संयुक्त राज्य अमरीका).

  1. पीसीआर उत्पाद का 1 मात्रा प्रति isopropanol युक्त बंधन बफर के 4 संस्करणों जोड़ें.
  2. पीसीआर उत्पाद बंधन बफर के साथ एक स्तंभ के लिए स्थानांतरण.
  3. आरटी पर 10000 आरसीएफ में 1 मिनट के लिए अपकेंद्रित्र.
  4. धो इथेनॉल युक्त बफर के साथ स्तंभ धो लें.
  5. आरटी पर 10000 आरसीएफ में 1 मिनट के लिए अपकेंद्रित्र.
  6. आरटी पर 1 मिनट के लिए सिलिका झिल्ली सूखी और इथेनॉल के साथ किसी भी अवशिष्ट धो बफर हटाने के लिए अधिकतम गति से अपकेंद्रित्र.
  7. Ultrapure पानी की 10 μL जोड़ें.
  8. आरटी पर 1 मिनट के लिए सेते हैं.
  9. आरटी पर 2 मिनट के लिए अधिकतम गति पर अपकेंद्रित्र शुद्ध डीएनए एकत्र.

5. क्लोनिंग

Lysogeny (पौंड) प्लेट तैयार शोरबा

  1. लेग मिश्रण के पानी की 800 मिलीलीटर में लगभग 25 जीआर भंग.
  2. अंतिम मात्रा 1 एल लाओ
  3. Bactoagar के 15 जीआर जोड़ें.
  4. 20 मिनट के लिए आटोक्लेव.
  5. Autoclaving बाद ज़ुल्फ़, सख्ती कुप्पी में समाधान पिघला हुआ अगर मिश्रण करने के लिए.
  6. 50 डिग्री सेल्सियस समाधान कूल
  7. एम्पीसिलीन (50 μg / मिलीलीटर) और ज़ुल्फ़ है जब तक यह घुल जोड़ें.
  8. लगभग 3mm की गहराई प्लेटें डालो.
  9. प्लेटें कमरे के तापमान पर छोड़ दें.
  10. फैल (40mg/ml) एक्स - लड़की और IPTG (100 मिमी) 37 पर प्रत्येक लेग थाली और सेते पर डिग्री सेल्सियस तक इस्तेमाल के लिए तैयार है.

सक्षम कक्ष परिवर्तन

परिवर्तन एक वाणिज्यिक किट निम्नलिखित निर्माता के निर्देशों (Topo टीए क्लोनिंग किट, Invitrogen, Carlsbad सीए, संयुक्त राज्य अमरीका) का उपयोग किया जाता है.

  1. क्लोनिंग प्रतिक्रिया मिश्रण (ताजा पीसीआर उत्पाद के μL 1-4, नमक समाधान के 1 μL, वेक्टर और यदि आवश्यक हो तो पानी की एक μL) तैयार करें.
  2. प्रतिक्रिया धीरे मिक्स और आरटी पर 5-10 मिनट के लिए सेते हैं.
  3. बर्फ पर प्रतिक्रिया रखें.
  4. सक्षम कोशिकाओं की एक शीशी में क्लोनिंग प्रतिक्रिया के 2 μL जोड़ें और धीरे मिश्रण.
  5. 30 मिनट के लिए बर्फ पर सेते हैं.
  6. हीट झटका 42 30 सेकंड के लिए कोशिकाओं डिग्री सेल्सियस
  7. तुरंत बर्फ में ट्यूब हस्तांतरण.
  8. माध्यम के 250 μL जोड़ें.
  9. ट्यूब tighly कैप और ट्यूब क्षैतिज 37 ° C 1 घंटे के लिए हिला.
  10. एक prewarmed चयनात्मक थाली पर प्रत्येक परिवर्तन से 50 μL बिखरा हुआ है.
  11. 37 पर रातोंरात सेते डिग्री सेल्सियस

निम्नलिखित ऊष्मायन, सफेद और नीले रंग की कालोनियों प्लेटों पर विकसित. व्हाइट कालोनियों पीसीआर उत्पाद प्रविष्टि के लिए सकारात्मक रहे हैं और नीले कालोनियों पीसीआर उत्पाद प्रविष्टि के लिए नकारात्मक हैं.

6. अनुक्रमण विश्लेषण

अनुक्रमण रिएक्शन

  1. 2,5 μl डीएनए, एक μl प्राइमर (5pmol / μl) 1,1 μl BigDye (एप्लाइड Biosystem, फोस्टर शहर, सीए, संयुक्त राज्य अमरीका): एक मिश्रण इन अभिकर्मकों का उपयोग किया है.
  2. थर्मल cycler शर्तों: 96 ° सी, 1 मिनट के लिए 10 सेकंड, 55 डिग्री सेल्सियस के लिए 25 96 ° C के लिए 4 मिनट के लिए 15 सेकंड और 60 डिग्री सेंटीग्रेड के लिए समय है.

कॉलम शोधन

  1. प्रत्येक प्रतिक्रिया के लिए, एक MicroSpin स्तंभ (Qiagen, मिलान, इटली) तैयार करते हैं.
  2. स्तंभ और भंवर उलटें राल मिश्रण.
  3. स्तंभ के नीचे बंद स्नैप, ढक्कन ढीला ¼ बारी है, और एक microcentrifuge ट्यूब में जगह स्तंभ.
  4. 1 मिनट के लिए 3200 rpm अपकेंद्रित्र.
  5. एक स्वच्छ microcentrifuge ट्यूब स्तंभ स्थानांतरण.
  6. ध्यान pipet स्तंभ के केंद्र में पूरी अनुक्रमण पीसीआर प्रतिक्रिया.
  7. 1 मिनट के लिए 3200 rpm अपकेंद्रित्र.
  8. शुद्ध डीएनए ट्यूब (ultrapure पानी की 20 μl) में eluite जाएगा.

अनुक्रमण विश्लेषण

  1. 96 multiwell थाली में शुद्ध नमूना (20 μl) लोड.
  2. Sequencer में थाली लोड. स्वचालित डीएनए sequencers एक चार रंग अनुक्रमण रन के परिणाम दिखाने के chromatogram उत्पन्न करते हैं.
  3. इनपुट सार्वजनिक अनुक्रम डेटाबेस के खिलाफ एक क्वेरी के रूप में nucleotide अनुक्रम. खोज NCBI डेटाबेस और सर्वर पर बेसिक स्थानीय संरेखण खोज उपकरण (ब्लास्ट) के साथ किया जाता है.
  4. 98-100% homologies के साथ ही बैक्टीरिया पर विचार करें.

7. प्रतिनिधि परिणाम

चित्रा 1
चित्रा 1 प्रक्रिया की समयरेखा.

चित्रा 2
चित्रा 2 पूरे जीवाणु पहचान प्रक्रिया का प्रवाह चार्ट.

चित्रा 3
चित्रा 3 2% agarose जेल दिखा व्यापक रेंज -16 rRNA जीन पीसीआर उत्पादों. 3 लेन, लेन 2, 1 लेन एक 100bp डीएनए सीढ़ी होता पीसीआर सकारात्मक नियंत्रण है नकारात्मक पीसीआर नियंत्रण से पता चलता है. 4 लेन एक एचआईवी पॉजिटिव मरीज से नमूनों से पता चलता है, और 5 लेन पानी शामिल है. लेन 6 शएक स्वस्थ व्यक्ति है और एक नकारात्मक पीसीआर प्रतिक्रिया से ows के नमूने, 7 लेन पानी शामिल हैं. केवल एचआईवी पॉजिटिव रोगियों एक सकारात्मक पीसीआर प्रवर्धन प्रदर्शित करता है. Ultrapure निष्कर्षण कदम के दौरान एक नकारात्मक नियंत्रण के रूप में इस्तेमाल किया पानी को इंगित करता है कि कोई संदूषण हुआ.

चित्रा 4
चित्रा 4 0.7% agarose प्लाज्मिड दिखा जेल miniprep प्रक्रिया के साथ निकाली गई . 2 लेन, 1 लेन एक 1 Kilobase डीएनए सीढ़ी होता नीले नियंत्रण कॉलोनी, गलियों 12 के माध्यम से 3 सफेद कालोनियों होते हैं. नीले कॉलोनी से प्लाज्मिड पीसीआर उत्पाद डालने शामिल नहीं करता है. सभी 10 सफेद कालोनियों सही डालने के साथ प्लाज्मिड होते हैं.

चित्रा 5
5 चित्रा एक एचआईवी पॉजिटिव व्यक्ति से प्लाज्मा में बैक्टीरियल अनुक्रमण विश्लेषण का एक उदाहरण दिखाता है. हमारे परिणाम बताते हैं कि एचआईवी रोग में माइक्रोबियल स्थानान्तरण polimicrobic वनस्पति है, जो एचआईवी नेगेटिव विषयों में नहीं देखा जाता है बैक्टीरिया स्थानान्तरण को नियंत्रित करने में आंत रोगक्षमता की पर्याप्त विफलता सुझाव शामिल हैं.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ब्याज की कोई संघर्ष की घोषणा की.

Acknowledgements

हम उत्कृष्ट सहायता के लिए वीडियो बनाने के साथ Gianni Scimone के लिए आभारी हैं.

Materials

Name Company Catalog Number Comments
Easty-DNA Kit Invitrogen K 180001
Chloroform Sigma-Aldrich C2432
Ethanol Sigma-Aldrich E7203
UltraPure Waer Invitrogen 10977049
Lysozyme Fluka 62970 10 μg/mL in Distillated Water
AmpliTaq Gold Applied Biosystems 26478701
Microcon 100 EMD Millipore 42413
PCR primers Invitrogen
Agarose Eppendorf C1343
DNA ladder Invitrogen 15628019
Purelink PCR micro kit Invitrogen K310050
LB Agar, powder Invitrogen 22700025
Bactoagar Invitrogen
Ampicillin Invitrogen 11593027 10 mg/mL in Distillated Water
X-gal Invitrogen 15520034 40mg/mL in DMF
IPTG Invitrogen 15529019 100mM in Distillated water
Topo TA cloning kit Invitrogen K450002
Purelink Quick Plasmid Miniprep kit Invitrogen K210010
Big dye Applied Biosystems 4337455
DyeEx 2.0 spin kit Qiagen 63204

DOWNLOAD MATERIALS LIST

References

  1. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  2. Macpherson, A. J., Harris, N. L. Interactions between commensal intestinal bacteria and the immune system. Nat Rev Immunol. 4, 478-485 (2004).
  3. Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. Modification of intestinal flora in the treatment of inflammatory bowel disease. Curr Pharm Des. 9, 333-346 (2003).
  4. Brenchley, J. M. Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat Med. 12, 1365-1371 (2006).
  5. Brenchley, J. M., Price, D. A., Douek, D. C. HIV disease: fallout from a mucosal catastrophe. Nat Immunol. 7, 235-239 (2006).
  6. Jiang, W. Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection. J Infect Dis. 199, 1177-1185 (2009).
  7. Marchetti, G. Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy. AIDS. 22, 2035-2038 (2008).
  8. Marchetti, G. Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART. The 17th Conference on Reteroviruses and Opportunistic Infections (CROI), San Francisco, CA, USA, (2010).
  9. Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol. 32, 335-351 (1994).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics