Author Produced

주변 혈액에 세균 Microflora의 시퀀싱 : HIV에 감염된 환자 경험

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

우리의 실험은 HIV 양성 환자의 말초 혈액에서 translocating 세균 종의 시퀀싱 분석을 수행하는 방법을 보여줍니다.

Cite this Article

Copy Citation | Download Citations

Merlini, E., Bellistri, G. M., Tincati, C., d'Arminio Monforte, A., Marchetti, G. Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients. J. Vis. Exp. (52), e2830, doi:10.3791/2830 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

건강한 위장관은 생리학적으로 체액성 및 세포 점막 면역 시스템 1,2의 발전에 영향을 공생 미생물의 큰 다양성에 의해 식민지입니다.

Microbiota은 강한 점막 장벽을 통해 면역 시스템에서 격리됩니다. 감염 및 항생제는 정상적인 위장관의 장벽 가능한 면역 이상에 3 발생할 수 있습니다 상주 세균의 구성을 모두 변경하는 것으로 알려져 있습니다.

HIV는 면역 체계 활성화 4-7에 기여하는 등 lipopolysaccharide와 박테리아 DNA 조각과 같은 세균 bioproducts,의 체계 순환에 점막 면역 및 누설의 진보적인 장애와 위장 장애에 위반됩니다. 미생물 translocation은 HIV / AIDS immunopathogenesis 및 치료 4,8에 대한 응답으로 연관되어 있습니다.

우리는 HIV에 감염된 환자의 말초 혈액에 translocating 박테리아의 구성을 특징으로 목표. 우리의 목표를 추구하기 위해 우리는 시퀀싱 분석을 다음 panbacteric 16 ribosomial 유전자에 대해 PCR 반응을 설정합니다.

간단히, 모두 HIV에 감염된 건강한 과목에서 전체 혈액이 사용됩니다. 건강한 개인이 정상적인 창자 항상성을 제시 것을 감안할 때 microflora에 대한 translocation 이러한 환자에서 예상되지 않습니다. venipuncture와 플라즈마 분리하여 전체 혈액 컬렉션을 따라 DNA는 플라즈마에서 추출 및 유전자 9 ribosomial panbacteric 16에 대한 광범위한 PCR 반응을 수행하는 데 사용됩니다. 다음 PCR 제품 정화, 복제 및 시퀀싱 분석이 수행됩니다.

Protocol

HIV에 감염된 혈액 샘플 처리가 중요한 권고 사항이 필요합니다.
혈액의 모든 표본은 강력한 누출 방지 용기에 이송해야합니다. 컨테이너의 외관 및 표본 함께 모든 서류의 오염을 방지하기 위해 표본을 수집시주의해야합니다.
감염된 혈액을 처리하는 모든 사람은 장갑을 착용해야합니다. 장갑이 변경 및 손을 표본 처리 완료 후 세탁해야합니다.
HIV에 감염된 혈액 샘플의 처리는 클래스 II 생물 학적 캐비닛 후드에서 수행되어야합니다.
기계 pipetting 보조를 사용해야합니다.
바늘이나 다른 샵스 (유리 예 : pipettes 또는 모세관 튜브 포함)의 사용은 아무런 대안이 없다는있는 경우로 제한되어야합니다.
실험실 표면은 혈액의 유출 후 적절한 화학 살균제로 소독해야하며 작업 활동을 완료하는 경우.
사용 오염된 물질은 재사용 전에 소독해야하거나 임상 폐기물 경로를 통해 정확하게 폐기해야합니다.
중재가 효과가 즉시 시작되어야합니다와 같은 잠재적으로 전염성이 혈액이나 체액 (즉, 이러한 요구하는 보편적인 예방 조치)에 직업 노출의 모든 사건은 응급으로 치료해야합니다.
프로토콜은 완성 오일이 필요합니다. 기간은 그림 1에 자세히 있습니다.
박테리아 종은 그림 2에서 설명한 방법을 사용 구분됩니다.

1. 샘플 컬렉션

  1. 전체 혈액 9 ML은 EDTA (에틸렌 다이아 민 테트라 초산) 포함 튜브로 그린 것입니다.
  2. 튜브는 플라즈마를 얻을 RT 10 분 2000 RPM에서 centrifuged 있습니다.
  3. 플라즈마 멸균이 ML - Eppendorf 튜브에 수집됩니다.

2. 플라즈마 샘플에서 DNA 추출

  1. 적절히 후드, pipettes 및 불임을 보장하기 위해 실험에 필요한 자료를 소독.
  2. 최소한 30 분 동안 자외선 불빛 아래에서 모든 자료를 놓습니다.
  3. 살균제로 소독 장갑을 닦으십시오.
  4. 에탄올 몇 종이 타올을 만끽하고 후드 아래에 그들을 놓으십시오. 때마다 팁을는 젖은 종이 타월에 피펫을 닦아 삭제됩니다.

DNA는 제조 업체의 지침 (예 : Easy - DNA 키트, Invitrogen, 칼스 배드 CA, 미국) 다음과 같은 상용 키트를 사용하여 추출됩니다.

  1. 플라즈마 350 μL은 살균 2ml eppendorf 튜브에 배치됩니다.
  2. 필터링 ultrapure 물 350 μL는 대조군으로 사용됩니다.
  3. 샘플로 라이 소 자임 (1mg/ml) 10 μL를 추가합니다.
  4. 37 30 분 품어 ° C.
  5. 용해 용액 500 μL를 추가하고 샘플을 부드럽게 섞는다.
  6. 65 7 분 동안 품어 ° C.
  7. 샘플에 클로로포름 900 μL를 추가합니다.
  8. 샘플이 균일하게 점성 때까지 적극적으로 소용돌이.
  9. 강수량 솔루션과 적극적으로 와동 200 μL를 추가합니다.
  10. 단계를 분리하고 인터페이스를 형성 RT에서 10 분 동안 10,500 rpm으로 샘플을 원심 분리기.
  11. 에탄올 100 % 1 ML를 포함하는 새로운 microcentrifuge 관에 상단 수성 단계를 전송합니다.
  12. 4 10 분 10,500 RPM에서 샘플을 원심 분리기 ° C.
  13. 에탄올을 제거합니다.
  14. 에탄올 70 % 1ml를 추가합니다.
  15. 4 10 분 최대 속도로 샘플을 원심 분리기 ° C.
  16. 에탄올을 제거합니다. 잔여 에탄올은 pipettator로 제거하여야한다.
  17. ultrapure 물 50 μL의 펠렛을 Resuspend.
  18. 분광 광도계로 DNA 농도를 읽으십시오.

3. 16 rRNA 유전자 PCR

PCR 증폭은 앞에서 설명한 9로 수행됩니다.

  1. 10X PCR 버퍼, 25 MM MgCl2 5 μL, 2 MM 총 dNTPs 5 μL, 50 μm의 프라이머 RW01 (AACTGGAGGAAGGTGGGGAT) 1 μL, 50 μm의 프라이머 DG74 1 μL의 10 μL로 구성된 100 μL 반응 혼합물에서 DNA를 증폭 (AGGAGGTGATCCAACCGCA), H20 34 μL와 DNA 형성 촉매 효소 (AmpliTaq 골드, 응용 Biosystem, 포스터 시티, CA, 미국) 0.5 μL.
  2. 박테리아 DNA 형성 촉매 효소에 의해 오염 가능성을 방지하기 위해 필터의 PCR 믹스를 전송합니다.
  3. 4 500 RCF에서 30 분 원심 분리기 필터 (Microcon, Millipore, 빌레 리카, MA, 미국) ° C.
  4. (긍정적이고 부정적인 PCR 컨트롤, 샘플 및 추출 물) 증폭해야 샘플의 개수에 따라 나누어지는 PCR 믹스.
  5. 다음과 같은 온도 조건에 자전거 타는 사람 사용 : 94 ° 10 분 C, 94시 일분 때마다 40 번 ° C, 55 ° C 72 ° C, 72 ° C. 10 분
  6. 2 % 아가로 오스 겔에 PCR 제품을 시각화. 100 BP의 DNA의 사다리를 사용하십시오. PCR 제품 크기는 360 BP (그림 3)입니다.

4. PCR 제품 정화

단지 PCR 양성 샘플은 정화되어야합니다. 정화는 사용이 수행됩니다상용 키트 다음과 같은 제조 업체의 지침 (PureLink PCR microkit, Invitrogen, 칼스 배드 CA, 미국).

  1. PCR 제품의 1 볼륨 당 이소프로판올를 포함하는 바인딩 버퍼 4 볼륨을 추가합니다.
  2. 열 바인딩 버퍼와 PCR 제품을 전송합니다.
  3. RT에서 10,000 RCF에서 1 분 원심 분리기.
  4. 에탄올을 포함 씻어 버퍼와 컬럼을 씻으십시오.
  5. RT에서 10,000 RCF에서 1 분 원심 분리기.
  6. 실리카 막 건조하고 에탄올과 잔여 씻으 버퍼를 제거하는 RT에서 1 분 최대 속도로 원심 분리기.
  7. ultrapure 물 10 μL를 추가합니다.
  8. RT에서 1 분 알을 품다.
  9. 정화 DNA를 수집하기 위해 RT에서 2 분 동안 최대 속도로 원심 분리기.

5. 복제

Lysogeny 맛을 (LB) 플레이트 준비

  1. 물을 약 800 ML에 LB 믹스 25 GR을 디졸브.
  2. 1 L.로 최종 볼륨을 가지고
  3. Bactoagar 15 GR을 추가합니다.
  4. 20 분 압력솥.
  5. autoclaving 후에 적극적으로 소용돌이 술병의 솔루션은 녹은 한천을 섞어.
  6. 50 ° C.에 대한 해결책을 쿨
  7. 암피실린 (50 μg / ML)와 소용돌이가 해체까지를 추가합니다.
  8. 약 3mm의 깊이로 번호판을 하거라.
  9. 상온에서 접시를 둡니다.
  10. 37 각 LB 판과 부화에 확산 X - 걸 (40mg/ml)와 IPTG (100 ㎜) ° C 사용할 준비까지.

관할 셀 변환

변환은 상용 키트 다음과 같은 제조 업체의 지시 사항을 (토포 TA 클로닝 키트, Invitrogen, 칼스 배드 CA, 미국)를 사용하여 수행됩니다.

  1. 복제 반응 믹스 (신선한 PCR 제품 1-4 μL, 소금 용액 1 μL, 벡터 및 물 필요한 경우 1 μL) 준비합니다.
  2. 부드럽게 반응을 혼합하고 RT에서 5-10분 위해 알을 품다.
  3. 얼음에서 반응을 놓으십시오.
  4. 관할 세포의 유리병으로 복제 반응 2 μL를 추가하고 부드럽게 섞는다.
  5. 30 분 얼음에 품어.
  6. 42 30 초 동안 열 충격 세포 ° C.
  7. 즉시 얼음에 튜브를 전송합니다.
  8. 중간 250 μL를 추가합니다.
  9. tighly 튜브 캡 37에서 수평 튜브를 흔들 ° C를 1 시간.
  10. prewarmed 선택 접시에 각각의 변환부터 50 μL를 벌리고.
  11. 37 밤새 품어 ° C.

다음 부화, 흰색과 파란색 식민지가 접시에 개발할 수 있습니다. 화이트 식민지는 PCR 제품 삽입에 대한 긍정이며, 파란색 식민지 PCR 제품 삽입에 대해 아무것도 없습니다.

6. 시퀀싱 분석

시퀀싱 반응

  1. 2,5 μl DNA 1 μl 프라이머 (μl / 5pmol) 1,1 μl BigDye (응용 Biosystem, 포스터 시티, CA, 미국) : 믹스는이 시약을 사용하여 이루어집니다.
  2. 자전거 타는 사람 열 조건 : 96 ° 일분에 대한 C, 4 분 15 초 및 60 ° C 10 초, 55 ° C에 대해 96 ° C 25 번.

열 정제

  1. 각 반응 들어, 하나의 MicroSpin 칼럼 (Qiagen, 밀란, 이탈리아)를 준비합니다.
  2. 수지를 섞어 열과 와동 반전.
  3. 칼럼의 맨 아래를 뜯어보면, ¼ 뚜껑을 느슨하게 설정하고, microcentrifuge 관에서 개최 칼럼.
  4. 1 분 3,200 RPM을 원심 분리기.
  5. 깨끗한 microcentrifuge 튜브에 열을 전송.
  6. 조심스럽게 pipet 칼럼의 중심에 전체 배열 PCR 반응.
  7. 1 분 3,200 RPM을 원심 분리기.
  8. 정화의 DNA는 튜브 (ultrapure 물 20 μl)에 eluite합니다.

시퀀싱 분석

  1. 96 multiwell 판에 정화 샘플 (20 μl)을로드합니다.
  2. 시퀀서에 접시를로드합니다. 자동 DNA의 Sequencers은 시퀀스 실행의 결과를 보여주는 4 색 크로마토 그램을 생성합니다.
  3. 공개 시퀀스 데이터베이스에 대한 쿼리로 뉴클레오 티드 시퀀스 입력. 검색은 기본 지역 정렬 검색 도구 (BLAST)와 함께 NCBI 데이터베이스 및 서버에서 수행됩니다.
  4. 98~100%의 homologies에서만 박테리아를 고려하십시오.

7. 대표 결과

그림 1
그림 1. 절차의 타임 라인.

그림 2
그림 2. 전체 세균성 식별 절차의 흐름 차트.

그림 3
그림 3. 광범위한 범위 16 rRNA 유전자 PCR 제품을 보여주는 2% 아가로 오스 겔. 레인 1은 100bp의 DNA 사다리를 포함, 레인 2 PCR 긍정적인 컨트롤을 포함, 레인 3 부정적인 PCR 컨트롤을 보여줍니다. 레인 4 HIV 양성 환자에서 샘플을 보여줍니다, 그리고 레인 5 물이 포함되어 있습니다. 레인 6 쉬건강한 개인 및 부정적인 PCR 반응에서 ows 샘플, 레인 7 물이 포함되어 있습니다. 만이 HIV 양성 환자는 긍정적인 PCR 증폭을 표시합니다. 추출 단계에서 대조군으로 사용 Ultrapure의 물, 오염이 발생 없다는 것을 나타냅니다.

그림 4
플라스미드 보여주는 그림 4. 0.7 % 아가로 오스 겔은 miniprep 절차를 추출. 레인 1 1 Kilobase의 DNA를 사다리를 포함, 레인 2 블루 제어 식민지, 12 3 백색 식민지를 포함하는 차선을 포함하고 있습니다. 파란 식민지에서 플라스미드는 PCR 제품의 삽입을 포함하지 않습니다. 총 10 개의 백색 식민지는 올바른 삽입과 플라스미드가 포함되어 있습니다.

그림 5
그림 5. 하나 HIV 양성 개인의 플라즈마 세균 시퀀싱 분석의 예를 보여줍니다. 우리의 결과는 HIV 질환에서 미생물의 translocation이 세균 translocation을 제어에 창자가 면역의 실질적인 실패를 제안 HIV - 부정적인 과목에서 볼 수없는 polimicrobic 식물을, 포함 것으로 나타났습니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

관심 없음 충돌 선언하지 않습니다.

Acknowledgements

우리는 비디오 제작과 우수한 지원 밀라노 Scimone에 감사하고 있습니다.

Materials

Name Company Catalog Number Comments
Easty-DNA Kit Invitrogen K 180001
Chloroform Sigma-Aldrich C2432
Ethanol Sigma-Aldrich E7203
UltraPure Waer Invitrogen 10977049
Lysozyme Fluka 62970 10 μg/mL in Distillated Water
AmpliTaq Gold Applied Biosystems 26478701
Microcon 100 EMD Millipore 42413
PCR primers Invitrogen
Agarose Eppendorf C1343
DNA ladder Invitrogen 15628019
Purelink PCR micro kit Invitrogen K310050
LB Agar, powder Invitrogen 22700025
Bactoagar Invitrogen
Ampicillin Invitrogen 11593027 10 mg/mL in Distillated Water
X-gal Invitrogen 15520034 40mg/mL in DMF
IPTG Invitrogen 15529019 100mM in Distillated water
Topo TA cloning kit Invitrogen K450002
Purelink Quick Plasmid Miniprep kit Invitrogen K210010
Big dye Applied Biosystems 4337455
DyeEx 2.0 spin kit Qiagen 63204

DOWNLOAD MATERIALS LIST

References

  1. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  2. Macpherson, A. J., Harris, N. L. Interactions between commensal intestinal bacteria and the immune system. Nat Rev Immunol. 4, 478-485 (2004).
  3. Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. Modification of intestinal flora in the treatment of inflammatory bowel disease. Curr Pharm Des. 9, 333-346 (2003).
  4. Brenchley, J. M. Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat Med. 12, 1365-1371 (2006).
  5. Brenchley, J. M., Price, D. A., Douek, D. C. HIV disease: fallout from a mucosal catastrophe. Nat Immunol. 7, 235-239 (2006).
  6. Jiang, W. Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection. J Infect Dis. 199, 1177-1185 (2009).
  7. Marchetti, G. Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy. AIDS. 22, 2035-2038 (2008).
  8. Marchetti, G. Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART. The 17th Conference on Reteroviruses and Opportunistic Infections (CROI), San Francisco, CA, USA, (2010).
  9. Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol. 32, 335-351 (1994).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics