Author Produced

Periferik Kan Bakteriyel Mikroflorası Sıralama: HIV ile enfekte olan hastalar ile bizim Deneyimi

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Bizim deney HIV pozitif hastaların periferik kan translocating bakteri türlerinin bir sıralama analizi gerçekleştirmek için nasıl gösterecektir.

Cite this Article

Copy Citation | Download Citations

Merlini, E., Bellistri, G. M., Tincati, C., d'Arminio Monforte, A., Marchetti, G. Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients. J. Vis. Exp. (52), e2830, doi:10.3791/2830 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Sağlıklı bir gastrointestinal sistem, humoral ve hücresel mukozal bağışıklık sistemi 1,2 gelişimini etkileyen komensal mikropların çok çeşitli fizyolojik tarafından kolonize.

Mikrobiyota bağışıklık sistemini güçlü bir mukozal bariyeri ile karşı korumalıdır. Enfeksiyonlar ve antibiyotikler normal gastrointestinal sistem bariyer ve yerleşik bakteri kompozisyonu, olası bağışıklık anormallikleri 3 sonuç değiştirmek için bilinmektedir.

HIV, sistemik immün aktivasyon 4-7 katkıda lipopolisakkarid ve bakteriyel DNA parçaları gibi bakteriyel bioproducts, sistemik dolaşıma mukozal bağışıklık ve kaçak ilerici yetmezliği olan gastrointestinal bariyer ihlali neden olur . Mikrobiyal translokasyon, HIV / AIDS immünopatogenezi ve tedavisi 4,8 yanıt alakalıdır .

Biz, HIV ile enfekte olan hastaların periferik kan translocating bakteriler bileşimi karakterize etmek amaçlanmıştır. Amacımız takip etmek, bir sıralama analizi ile takip panbacteric 16S ribosomial gen için PCR kurdu.

Kısaca, hem de HIV ile enfekte ve sağlıklı kişilerde tam kan kullanılır. Sağlıklı bireyler normal bağırsak homeostazı mevcut olduğu göz önüne alındığında, bu hastalarda mikroflora hiçbir translokasyon bekleniyor. Venipunktür ve plazma ayırma ile tam kan toplama, DNA plazmasından elde edilen ve gen 9 ribosomial panbacteric 16S için geniş bir PCR reaksiyonu gerçekleştirmek için kullanılır. Takiben PCR ürün arıtma, klonlama ve sıralama analizleri yapılmaktadır.

Protocol

HIV ile enfekte kan örneklerinin taşınması için bazı önemli tavsiyeler gerektirir.
Tüm kan örnekleri sağlam sızdırmaz kaplarda taşınmalıdır. Konteyner dış ve numune ile birlikte herhangi bir evrak kirlenmesini önlemek için numune toplarken dikkatli olmalıdır.
Enfekte kan işleme tüm kişilerin eldiven giymelidir. Eldiven değişti ve ellerini örnek işlem tamamlandıktan sonra yıkanmış olmalıdır.
HIV virüslü kan örnekleri İşleme sınıf II biohazard kabin kaput yapılmalıdır.
Mekanik pipetleme yardımcıları kullanılmalıdır.
Iğne veya diğer kavuz (cam, örneğin pipetler veya kılcal tüpleri dahil) herhangi bir alternatif var olduğu durumlar ile sınırlı olmalıdır.
Laboratuvar yüzeyler kan dökmek sonra uygun bir kimyasal dezenfektan ile dekontamine edilmeli ve iş faaliyetleri tamamlanmıştır.
Kullanılan kontamine malzeme, tekrar kullanmadan önce dekontamine edilmelidir ya da klinik atık yolla doğru atılmalıdır.
Müdahalelerin etkili olabilmesi için derhal başlatılmalıdır olarak potansiyel bulaşıcı kan veya sıvıları (yani, bu gerektiren evrensel önlemler) mesleki maruziyet Her olay bir tıbbi acil olarak tedavi edilmelidir.
Protokol, tamamlanması için 5 gün gerektirir. Zaman diliminde Şekil 1'de ayrıntılı olarak verilmiştir.
Şekil 2'de açıklanan yöntemleri kullanarak bakteri türlerinin tespit edilir.

1. Örnek Toplama

  1. 9 ml tam kan EDTA içeren tüplere içine çekilir.
  2. Tüpler plazma elde etmek için oda sıcaklığında 10 dakika 2000 rpm'de santrifüj.
  3. Plazma 2 ml steril Eppendorf-tüp içinde toplanır.

2. Plazma Örnekleri DNA Ekstraksiyon

  1. Kaput, pipetler ve deney için gerekli malzeme sterilite garanti altına almak için yeterince dezenfekte edin.
  2. UV ışıkları altında en az 30 dakika için tüm malzemeleri yerleştirin.
  3. Bir dezenfektan ile eldiven silin.
  4. Etanol içinde ıslatın ve birkaç kağıt havlu başlık altında koyun. Her zaman bir ipucu, ıslak kağıt havlu üzerine pipet silin atılır.

DNA, üreticinin talimatlarına (Easy-DNA Takımı, Invitrogen, Carlsbad CA, ABD) ticari kiti kullanılarak elde edilir.

  1. Plazma 350 mcL steril bir 2ml Eppendorf tüp yerleştirilir.
  2. 350 mcL süzülmüş ultra saf su negatif kontrol olarak kullanılmıştır.
  3. Örnekleri lizozim (1mg/ml) 10 mcL ekleyin.
  4. 37 az 30 dakika boyunca inkübe ° C
  5. 500 mcL Lizis Çözüm örnekleri ekleyin ve hafifçe karıştırın.
  6. 65 yaşında 7 dakika inkübe ° C
  7. Örnekleri kloroform 900 mcL ekleyin.
  8. Numunelerin düzgün viskoz kadar kuvvetlice karıştırın.
  9. Yağış Çözüm ve şiddetle vorteks 200 mcL ekleyin.
  10. Fazlar ayrı ve arayüz oluşturmak için oda sıcaklığında 10 dakika 10.500 rpm'de örnekleri santrifüjleyin.
  11. Üst sulu faz 1 ml% 100 etanol içeren taze mikrosantrifüj tüpüne aktarın.
  12. 4 10500 rpm'de 10 dakika boyunca örnek Santrifüj ° C
  13. Etanol çıkarın.
  14. % 70 etanol, 1 ml ekleyin.
  15. 4 10 dakika boyunca maksimum hızda örnekleri Santrifüj ° C
  16. Etanol çıkarın. Bir pipettator kalan etanol ile temizlenmesi gerekir.
  17. 50 mcL ultra saf su pelletini tekrar.
  18. Spektrofotometre ile DNA konsantrasyonu okuyun.

3. 16S rRNA gen PCR

PCR 9 Daha önce açıklandığı gibi yapılır.

  1. 10X PCR tampon, 5 mcL 25 mM MgCl2, 5 mcL 2 mM toplam dNTP, 50 mcM astar RW01 (AACTGGAGGAAGGTGGGGAT) 1 mcL, 50 mcM astar DG74 1 mcL 10 mcL oluşan 100 mcL reaksiyon karışımının DNA Amplify (AGGAGGTGATCCAACCGCA), H20 34 mcL ve Taq polimeraz (AmpliTaq Gold, Uygulamalı Biosystem, Foster City, CA, USA) 0.5 mcL.
  2. Bakteriyel Taq polimeraz ile olası kontaminasyonu önlemek amacıyla filtreler PCR karışımı aktarın.
  3. 4 500 RCF az 30 dakika santrifüj filtreleri (Microcon, Millipore, Billerica, MA, ABD) ° C
  4. (Pozitif ve negatif PCR denetimleri, örnekler ve çıkarılan su) yükseltilecek gereken örnekleri sayısına göre kısım PCR karışımı.
  5. Aşağıdaki termal cycler koşulları: 94 ° C 10 dakika boyunca, her zaman için 1 dakika 40 kez 94 ° C, 55 ° C ve 72 ° C ve 72 ° C'de 10 dakika
  6. PCR ürünü% 2 agaroz jel üzerinde gözünüzde canlandırın. 100 bp DNA merdiven kullanın. PCR ürününün boyutu 360 bp (Şekil 3) hakkında.

4. PCR Ürün Arıtma

Sadece PCR pozitif örnekler arındırılmalıdır. Arıtma kullanılarak yapılırticari kit aşağıdaki üreticinin talimatlarına (PCR PureLink microkit, Invitrogen, Carlsbad CA, USA).

  1. Izopropanol içeren PCR ürünü 1 hacim başına 4 cilt Cilt Tampon ekleyin.
  2. Bir sütun bağlama Tampon PCR ürünü aktarın.
  3. RT 10000 RCF 1 dakika boyunca santrifüjleyin.
  4. Yıkama Tamponu etanol içeren sütun yıkayın.
  5. RT 10000 RCF 1 dakika boyunca santrifüjleyin.
  6. Silika membran kuru ve etanol ile herhangi bir kalıntı Yıkama Tamponu kaldırmak için RT 1 dakika maksimum hızda santrifüjleyin.
  7. 10 mcL ultra saf su ekleyin.
  8. 1 dakika oda sıcaklığında inkübe edin.
  9. Saflaştırılmış DNA toplamak için oda sıcaklığında 2 dakika boyunca maksimum hızda santrifüjleyin.

5. Klonlama

Lysogeny Broth (LB) Levha Hazırlık

  1. LB karışımı yaklaşık 800 ml su 25 gr eritin.
  2. Son hacmi 1 L'ye getirin
  3. Bactoagar, 15 gr.
  4. 20 dakika için Otoklav.
  5. Otoklav sonrası şiddetle girdap balonuna çözüm erimiş agar karıştırmak için.
  6. 50 ° C'ye kadar çözüm soğutun
  7. Ampisilin (50 mg / ml) ve girdap eriyene kadar ekleyin.
  8. Yaklaşık 3mm derinliğe kadar plakaları dökün.
  9. Plakaları oda sıcaklığında bekletin.
  10. 37 her LB plaka ve inkübe yayıldı X-Gal (40mg/ml) ve IPTG (100 mM) ° C kullanıma hazır olana kadar.

Yetkili Hücreler Dönüşüm

Dönüşüm ticari kit aşağıdaki üreticinin talimatlarına (Topo TA klonlama kiti, Invitrogen, Carlsbad CA, USA) kullanılarak yapılır.

  1. Klonlama reaksiyon karışımı (1-4 mcL taze PCR ürünü, tuz solüsyonu 1 mcL, vektör ve gerekirse su 1 mcL) hazırlayın.
  2. Reaksiyon hafifçe karıştırın ve oda sıcaklığında 5-10 dakika inkübe edin.
  3. Buz üzerinde reaksiyon yerleştirin.
  4. Yetkili hücrelerinin bir şişe içine klonlama reaksiyon 2 mcL ekleyin ve hafifçe karıştırın.
  5. 30 dakika boyunca buz üzerinde inkübe edin.
  6. 42 az 30 saniye için ısı-şok hücreleri ° C
  7. Hemen buz tüp transferi.
  8. Orta 250 mcL ekleyin.
  9. Tighly tüp Cap ve 37 tüp yatay sallamak ° C 1 saat.
  10. Prewarmed seçici bir plaka üzerinde her dönüşümü 50 mcL sürün.
  11. 37 o gece inkübe ° C

Takiben kuluçka plakalar, beyaz ve mavi koloniler gelişir. Beyaz koloniler PCR ürününün yerleştirilmesi için pozitif ve mavi koloniler PCR ürününün yerleştirilmesi için negatif.

6. Sıralama Analizi

Sıralama Reaksiyon

  1. 2,5 ul DNA, 1 ul astar (ul / 5pmol) 1,1 ul BigDye (Uygulamalı Biosystem, Foster City, CA, USA): bir karışımı bu reaktifler kullanılarak yapılır.
  2. Termal cycler koşulları: 96 ° C 1 dakika, 4 dakika 15 saniye ve 60 ° C için 10 saniye, 55 ° C 96 ° C için 25 kez.

Sütun Arıtma

  1. Her reaksiyon için, bir MicroSpin Sütun (Qiagen, Milano, İtalya) hazırlar.
  2. Reçine karışımı sütun ve vorteks tersine çevirin.
  3. Snap, sütunun alt = kapağı gevşetin açın ve bir mikrosantrifüj tüp içinde yer sütun.
  4. 1 dakika için 3200 rpm santrifüjleyin.
  5. Sütun temiz bir mikrosantrifüj tüpüne aktarın.
  6. Dikkatle pipetlemeyin sütun merkezi haline tüm PCR sıralama tepki.
  7. 1 dakika için 3200 rpm santrifüjleyin.
  8. Arıtılmış DNA tüp (ultra saf su 20 ul) içine eluite.

Sıralama Analizi

  1. 96-multiwell plaka arıtılmış örnek (20 ul) yükleyin.
  2. Sequencer plaka yükleyin. Otomatik DNA Sekans sıralama vadede sonuçlarını gösteren bir dört renk kromatogram üretir.
  3. Kamu dizisi veritabanlarına karşı bir sorgu olarak nükleotid dizisi Girdi. Temel Yerel Hizalama Tarama Aracı (BLAST) arama, NCBI veritabanları ve sunucular üzerinde yapılır.
  4. 98-100% benzerliklerin sadece bakterileri ele alalım.

7. Temsilcisi Sonuçlar

Şekil 1
Şekil 1 prosedürü Timeline.

Şekil 2
Şekil 2 tüm bakteri tanımlama prosedürü akış şemaları.

Şekil 3
Şekil 3 gösteren geniş 16S rRNA geni PCR ürünleri% 2 agaroz jel. Lane 1 100bp DNA merdiveni içerir, şerit 2 PCR pozitif denetimi içeren, şerit 3 PCR negatif kontrol gösterir. Lane 4 HIV-pozitif hasta örnekleri gösterir ve şeritli 5 su içerir. Lane 6 shsağlıklı bir birey ve bir negatif PCR reaksiyonu insanı örnekleri; şeritli 7 su içerir. Sadece HIV pozitif hastalarda pozitif bir PCR görüntüler. Ultra Saf su çıkarma adımı sırasında bir negatif kontrol olarak kullanılan herhangi bir kirlenme meydana geldiğini gösterir.

Şekil 4
Plazmid gösteren Şekil 4.% 0.7 agaroz jel miniprep prosedürü ile ayıklanır. Lane 1, 1 kilobaz DNA merdiveni içerir, 2 şeritli mavi kontrol kolonisi, 12 üzerinden 3 beyaz koloniler içerir şeritleri içerir. Mavi koloni plazmid PCR ürün eklemek içermez. Tüm 10 beyaz koloniler doğru eklemek plazmid içerir.

Şekil 5
Şekil 5, HIV-pozitif bir kişiden plazma bakteri sıralama analiz bir örnek gösterir. Çalışmamızın sonuçları, HIV hastalığı mikrobiyal translokasyon bakterilerin translokasyonu kontrol bağırsak bağışıklığın önemli yetmezliği düşündüren HIV-negatif kişilerde görülür bir polimicrobic flora, içerdiğini göstermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Çıkar çatışması ilan etti.

Acknowledgements

Gianni Scimone video yapma ile mükemmel destek için minnettar.

Materials

Name Company Catalog Number Comments
Easty-DNA Kit Invitrogen K 180001
Chloroform Sigma-Aldrich C2432
Ethanol Sigma-Aldrich E7203
UltraPure Waer Invitrogen 10977049
Lysozyme Fluka 62970 10 μg/mL in Distillated Water
AmpliTaq Gold Applied Biosystems 26478701
Microcon 100 EMD Millipore 42413
PCR primers Invitrogen
Agarose Eppendorf C1343
DNA ladder Invitrogen 15628019
Purelink PCR micro kit Invitrogen K310050
LB Agar, powder Invitrogen 22700025
Bactoagar Invitrogen
Ampicillin Invitrogen 11593027 10 mg/mL in Distillated Water
X-gal Invitrogen 15520034 40mg/mL in DMF
IPTG Invitrogen 15529019 100mM in Distillated water
Topo TA cloning kit Invitrogen K450002
Purelink Quick Plasmid Miniprep kit Invitrogen K210010
Big dye Applied Biosystems 4337455
DyeEx 2.0 spin kit Qiagen 63204

DOWNLOAD MATERIALS LIST

References

  1. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  2. Macpherson, A. J., Harris, N. L. Interactions between commensal intestinal bacteria and the immune system. Nat Rev Immunol. 4, 478-485 (2004).
  3. Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. Modification of intestinal flora in the treatment of inflammatory bowel disease. Curr Pharm Des. 9, 333-346 (2003).
  4. Brenchley, J. M. Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat Med. 12, 1365-1371 (2006).
  5. Brenchley, J. M., Price, D. A., Douek, D. C. HIV disease: fallout from a mucosal catastrophe. Nat Immunol. 7, 235-239 (2006).
  6. Jiang, W. Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection. J Infect Dis. 199, 1177-1185 (2009).
  7. Marchetti, G. Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy. AIDS. 22, 2035-2038 (2008).
  8. Marchetti, G. Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART. The 17th Conference on Reteroviruses and Opportunistic Infections (CROI), San Francisco, CA, USA, (2010).
  9. Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol. 32, 335-351 (1994).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics