Endotel Cell Co-kultur formidler Modning af humane embryonale stamceller til pancreas-insulin-producerende celler i en rettet Differentiering Approach

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Den aktuelle undersøgelse beskriver en rettet differentiering tilgang til at fremkalde bugspytkirtlen differentiering af humane embryonale stamceller. Af stor betydning er konstateringen af, at endotelcelle co-kultur medierer modning af humane embryonale stamceller afledt pancreas stamfædre til insulin udtrykker celler.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Embryonale stamceller (ESC) har to egenskaber: de kan være uendeligt opformeres in vitro i en udifferentieret tilstand, og de ​​er pluripotente og har således potentialet til at differentiere til flere slægter. Sådanne egenskaber gør ESC særdeles attraktiv for celle-baseret terapi og regenererende behandling ansoegninger 1. Men for sit fulde potentiale skal realiseres cellerne skal differentieres til modne og funktionelle fænotyper, hvilket er en skræmmende opgave. En lovende fremgangsmåde til induktion af cellulær differentiering er nøje efterligner bane organogenese i in vitro indstilling. Pancreasudviklingen vides at forekomme i bestemte trin 2, startende med endoderm, som kan udvikle sig til adskillige organer, herunder lever og pancreas. Endoderm induktion kan opnås ved modulation af nodal vej gennem tilsætning af activin A 3 i kombination med adskillige vækstfaktorer 4-7 in vitro ved tilsætning af cyclopamine 8. Pancreas modning medieres af adskillige parallelle arrangementer, herunder inhibering af indskæringen signaler aggregering af pancreas progenitorer i 3-dimensionelle klynger, induktion af vaskularisering, for at nævne nogle få. Langt den mest succesfulde in vitro modning af ØSU afledte pancreasstamfaderceller, er blevet opnået gennem hæmning af hak signalering af DAPT tilskud 9. Selv succes. Resulterer i et lavt udbytte af det modne fænotype med nedsat funktionalitet En mindre undersøgte område er virkningen af endotelcelle signalering i pancreas modning, hvilket i stigende grad værdsat som en vigtig bidragende faktor i in vivo pancreasø modning 10,11.

Den aktuelle undersøgelse udforskes sådan virkning af endothelIAL celle-signalering i modning af humane ESC afledte pancreasstamfaderceller i insulinproducerende ø-lignende celler. Vi rapporterer en flertrins rettet differentiering protokol, hvor de humane ESC først induceres mod endoderm af activin A sammen med inhibering af PI3K pathway. Pankreatisk specifikation endoderm celler opnås ved inhibering af sonisk hedgehog signalering ved Cyclopamine sammen med retinoid induktion ved tilsætning af retinsyre. Den endelige modning induceres af endotelcelle signalering opnås ved en co-kultur konfiguration. Mens flere endotelceller er blevet testet i co-kultur, heri præsenterer vi vores data med rotte hjerte mikrovaskulære endotelceller (RHMVEC), primært for at lette analysen.

Protocol

1. Celle Vedligeholdelse

  1. H1 embryonale (WiCell) blev opretholdt på embryonale kvalificerede matrigel brønde med mTeSR1 medier, med medier skifter hver dag. Brønde blev overtrukket med fortyndet Matrigel-opløsning, fremstillet ved tilsætning af 300 pi embryonale matrigel i 25 ml DMEM: F12. 1 ml af denne matrigel opløsning blev tilsat til hver brønd i en seks brønds plade eller 400 pi tilsættes til hver brønd af en 12 brøndplade og tilladt at belægge i 1 time ved stuetemperatur. Cellerne blev mekanisk passeret i et split forholdet 1:4 ved at skrabe kolonier, når de nåede mellem 1 og 1,5 mm i diameter.
  2. RHMVEC (VEC teknologi) blev opretholdt i MCDB-131 medier med medier skifter hver anden dag. Cellerne blev opdelt ved trypsinisering, når 80% konfluens blev opnået på et delt 1:3. Endotelceller mellem passagerne 3 og 7 blev anvendt til denne undersøgelse.

2. Fremstilling af stamopløsninger

  1. Activin A blev rekonstitueret med 50 ug / ml i steril PBS indeholdende 0,1% bovint serumalbumin. Opløsningen blev alikvoteret og opbevaret ved -20 ° C.
  2. EGF blev rekonstitueret ved 500 ug / ml i steril 10 mM eddikesyre. Opløsningen blev alikvoteret og opbevaret ved -20 ° C.
  3. Insulin blev rekonstitueret med 10 mg / ml ved tilsætning af forsuret H2O (pH ≤ 2), fremstillet ved tilsætning af 0,1 ml iseddikesyre til 10 ml vand.
  4. DAPT blev rekonstitueret i DMSO ved 18 mg / ml. Det blev yderligere fortyndet til 300 uM koncentration i DMEM: F12, alikvoteret og opbevaret ved -20 ° C.
  5. Kaad-Cyclopamine blev rekonstitueret i DMSO ved 5mg/ml. Det blev yderligere fortyndet til 2 uM koncentration i DMEM: F12, alikvoteret og opbevaret ved -20 ° C.
  6. All-trans-retinsyre blev rekonstitueret ved 2,7 mg / ml i 95% ethanol. Det blev yderligere fortyndet til 2 mM koncentration i DMEM: F12, alikvoteret og opbevaret ved -80 ° C.

3. Endelig endoderm (DE) og pancreasstamfaderceller (PP) Induktion

  1. Når hESC kolonier opnået mellem 1 og 1,5 mm i diameter, blev DE induktion udført ved tilsætning af DMEM: F12 suppleret med B27, 0,2% BSA, 100 ng / ml activin A og 1 uM Wortmannin i 4 dage (dag 0-dag 4) med medier skifter hver dag.
  2. Efter DE induktion var fuldstændig, blev pancreasstamfaderceller induktion induceret ved at ændre mediet til DMEM: F12 suppleret med B27, 0,2% BSA og Kaad-Cyclopamine ved 0,2 uM koncentration i 24 timer (dag 4-Dag 5).
  3. Efter 24 timer blev mediet ændret til DMEM: F12 suppleret med B27, 0,2% BSA, Kaad-Cyclopamine ved 0,2 uM koncentration og all-trans-retinsyre i 2 uM koncentration i 3 dage med medium ændre hver dag (dag 5 dages 8) .

4. Pancreas Modning

  1. Efter PP induktion, blev alle grupper ændret til modning medier bestående af DMEM: F12 suppleret med B27, 0,2% BSA, 10 mM nikotinamid, 25 ug / ml insulin, 30 nM Na2 SEO 3 og 50 ug / ml transferrin i 2 dagelav e med medier skifter hver dag (dag 8-Dag 10).
  2. Efter 2 dage i modningsformer medier, er den endelige modning trin udføres parallelt under anvendelse af flere forskellige betingelser til sammenligning. Differentiering blev induceret under følgende betingelser: (i) ved indskæringen inhibitor DAPT (ii) anvendelse af co-dyrkningsmedier kun uden endotelceller som kontrol og (iii) under anvendelse af kontakt co-kultur med RHMVEC celler. Cellerne blev opretholdt i DAPT eller co-dyrkningsmedium i en uge (dag 10-dag 17) med medier ændre hver dag.
    1. DAPT medier blev udarbejdet ved at supplere de modningsformer medierne med 30 pM DAPT. Cellerne i denne gruppe blev først udsat for at fuldføre MCDB131 i 24 timer og derefter udsat for DAPT medier til 6 dage (dag 11-dag 17).
    2. Co-dyrkningsmedier blev fremstillet ved at supplere MCDB-131 medium med B27, 0,2% BSA, 10 mM nikotinamid, 10 ng / ml EGF, 1 ug / ml hydrocortison, 10 mg EndoGro, 90 ug / ml heparin. For mediekontrol tilstand de differentierende celler blev eksponerettil MCDB-131 komplet medium i 24 timer (dag 10-dag 11), hvorefter mediet blev ændret til co-dyrkningsmedier i 6 dage (dag 11-dag 17) (ikke endotelceller).
    3. Til kontakt co-kultur tilstand blev millioner RHMVEC tilsat til de differentierende celler i komplet MCDB-131 medium (VEC teknologier) i 24 timer (dag 10-dag 11) for at tillade fastgørelse. Efter 24 timer medier blev ændret til co-dyrkningsmedier til 6 dage (dag 11-Day 17) med medier skifter hver dag.

5. QRT-PCR-analyse

  1. Ved slutningen af ​​hvert trin af differentiering (endoderm, pancreasstamfaderceller, modent ø) blev lyseret, og RNA blev ekstraheret under anvendelse NucleoSpin RNA II ekstraktion kittet ifølge producentens anvisninger.
  2. RNA kvalitet blev analyseret ved at kontrollere RNA absorbans ved 260 nm og 280 nm, efterfulgt af RNA kvantificering under anvendelse af en SmartSpec Plus spektrofotometer.
  3. Revers transkription blev udført under anvendelse ImProm II revers transkription kDet ifølge producentens instruktioner. Alle reaktioner blev udført med 100 ng RNA.
  4. QRT-PCR blev udført under anvendelse af Mx3005P qPCR system (Agilent) og Brilliant II SYBR Green qPCR stamblanding ifølge producentens instruktioner. De anvendte primere er anført i tabel 1. Initialiseringen trin blev udført ved 50 ° C i 2 minutter efterfulgt af 95 ° C i 10 minutter. 50 amplifikationscykler udført som følger: 95 ° C i 30 sekunder, 54 ° C i 30 sekunder og 72 ° C i 1 minut.
  5. Fold ændring af mål-mRNA ekspression i udifferentierede celler blev beregnet ud fra CT-værdier ud fra følgende formel:
    ΔCT (Marker i) = CT (Marker i) - CT (GAPDH)
    Δ ΔCT (markør i) = ΔCT (markør i) (prøve) - ΔCT (markør i) (udifferentierede celler)
    Relativ ekspression (markør i) = 2-ΔΔCT(Markør i)

6. Immuncytokemi

  1. Ved slutningen af ​​hvert trin af differentiering (endoderm, pancreasstamfaderceller, modne ø-celler) blev fikseret i 4% formaldehyd i 15 minutter ved stuetemperatur.
  2. Fikserede celler blev permeabiliseret under anvendelse af 0,25% Triton X-100 (TX) i 15 minutter.
  3. Ikke-specifik farvning blev blokeret ved inkubering i 10% æsel serum i 0,05% TX i 30 minutter.
  4. Primært antistof inkubering blev udført natten over ved 4 ° C i blokeringspuffer i den anbefalede antistof fortynding (se tabel 1).
  5. Cellerne blev vasket med 0,05% TX tre gange i 5 minutter.
  6. Sekundært antistof inkubering blev udført i en time ved stuetemperatur i mørke med egnede antistoffer fortyndet i blokeringsbuffer.
  7. Cellerne blev vasket med 0,05% TX tre gange i 5 minutter.
  8. Nuklear farvning blev udført ved inkubering med Hoescht farve ved 1:1000 fortynding i PBSi 5 minutter efterfulgt af 3 vaske med PBS.
  9. Faste og farvede celler blev afbildet ved hjælp af Olympus IX81 omvendt mikroskop og Metamorph imaging software.

7. Repræsentative resultater

Tilsætningen af activin A og Wortmannin til udifferentierede embryonale i 4 dage inducerer endelig endoderm som bekræftet ved QRT-PCR-analyse for DE markører Sox17, CXCR4 og Foxa2 og immunfarvning for Sox17 som illustreret i figur 2. Differentiering til pancreasstamfaderceller efter tilsætning af cyclopamine og retinsyre blev bekræftet ved QRT-PCR af pancreasstamfaderceller markører og immunfarvning for Pdx1 som illustreret i figur 3.

Ved det endelige trin af differentiering kontakt co-kultur med RHMVEC celler kraftigt induceret opregulering af insulin ekspression i embryonale afledte pancreasstamfadercellerne. Effektiviteten af ​​co-kultur medieret differentiering blev analyseret ved comparing med kontrol tilstand ved hjælp DAPT. DAPT blev brugt som en positiv kontrol, da det er i øjeblikket en af ​​de mest udbredte metoder til at opnå bugspytkirtlen modning. Idet co-kultur blev udført i en modificeret medier suppleret med faktorer understøttende af endotelceller, blev der yderligere kontrol udført med medierne i fravær af endothelceller til at kontrollere virkningen af ​​medier på differentiering. Detaljer af denne analyse er præsenteret i figur 4.

Figur 1.
Figur 1. Etapevis protokol til differentiering af embryonale i insulin-udtrykkende celler.

Figur 2.
Figur 2. Endelig endoderm induktion af humane embryonale stamceller. A) QRT-PCR-analyse af repræsentative DE markører i embryonale celler udsat for activin A og Wortmannin i 4 dage. Resultater ar e normaliseres med hensyn til udifferentierede embryonale. B) Sox17 farvning (grøn) og DAPI (blå) viser nuklear ekspression af Sox17. Målestok: 50 um.

Figur 3.
Figur 3. Pancreasstamfaderceller induktion af embryonale stamceller afledt endoderm celler. A) QRT-PCR-analyse af tidlige pancreas markører i embryonale afledt endoderm celler udsat for cyclopamine og retinsyre i 4 dage efter DE induktion. Resultaterne normaliseres med hensyn til udifferentierede embryonale. B) Pdx1-farvning (violet) og DAPI (blå) viser nuklear ekspression af Pdx1. Målestok: 50 um.

">

Figur 4.
Figur 4. Pancreas modning trin A) QRT-PCR-analyse af pankreatiske hormoner embryonale efter pancreas modning ved hjælp DAPT, co-kultur eller co-dyrkningsmedium (kontrol) kontakt. Resultaterne normaliseres med hensyn til udifferentierede embryonale. P-værdier opnået ved student t-test. B) co-kultur med Dil-Ac-LDL mærket RHMVEC (rød) viser områder, hvor EC'er fastgøres til pladen, hvis der er hulrum (øverst), kan andre RHMVEC findes i direkte kontakt med den differentierende ESC (nederst). C) C-peptid (Green) farvning af celler differentieret under anvendelse co-kultur-metoden. Målestok: 12,5 um (øverst) og 50 um (nederst) D) immunfarvning af RHMVEC viser ingen insulin udtryk i RHMVEC.

Marker Primer1 (5 'til 3') </ Td> Primer2 (5 'til 3') Ref
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
Pax6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
Glucagon AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
INSULIN AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Tabel 1. Primere anvendt til qPCR reaktioner.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Under pancreasudviklingen er differentierende pancreasceller i umiddelbar nærhed af endotelceller fra aorta, endvidere pancreasøer er tæt vaskulariseret at fremme en hurtig udveksling af blodglucose og ø-hormoner. I betragtning af disse fakta, er det ikke overraskende, at endotelceller spiller en vigtig rolle i processen med pancreas organogenese. Medens betydningen af endotelceller under pancreasudviklingen stigende grad værdsat, er dens rolle i in vitro differentiering af embryoniske celler mindre undersøgt. I vores tidligere rapport har vi etableret den positive rolle, endotelceller på bugspytkirtlen modning af muse embryonale stamceller 13. I den aktuelle undersøgelse vi undersøge effekten af ​​endotelcelle signalering på at differentiere humane embryonale stamceller.

Multiple endotelceller blev anvendt i denne protokol, som alle resulterede i lignende overordnede virkning although med variationer i effektivitet differentiering. I den aktuelle rapport præsenterer vi effekten af ​​co-dyrkning af embryonale afledte Pancreasstamfadercellerne med rotter hjerte mikrovaskulære endotelceller (RHMVEC). Endotelceller kan være bekvemt visualiseres ved AC-LDL-farvning, som er specifik for kun endotelceller. Co-kultur af de differentierende ESC med præ-farvede endotelceller viste, at mens størstedelen af ​​endotelceller var levedygtige i kultur i længere tid, det RHMEV gradvist forsvinder efter 4 dage og kan ikke længere påvises efter 6 dages modning. Fravær af RHMVEC forenkler analyse ved at eliminere behovet for sortering, og derfor blev valgt til optimering af co-kultur protokol.

Mens den foreliggende undersøgelse viser klart positiv virkning af endotelceller i inducerende pancreatisk modning, den nøjagtige mekanisme af en sådan induktion er stadig ukendt og er i øjeblikket undersøges i vores laboratorium. En few plausible mekanismer kan være (i) virkningen af ​​celle-udskilte molekyler (ii) endotelcelle-medierede inhibering af indskæringen signalering (iii) den rolle ekstracellulære matrix udskilt fra endotelceller. Medens den første kategori ikke kræver celle-celle-kontakt, en sådan kontakt er obligatorisk for den anden og tredje kategori. Derfor har vi udført en foreløbig analyse under anvendelse af forskellige co-kultur konfigurationer: (i) kontakt co-kultur (ii) trans-brønd co-kultur og (iii) konditionerede medier kultur. Det blev observeret, at kontakt co-dyrkning resulterede i maksimal differentiering, som bedømt ved insulin ekspression, efterfulgt af transwell co-dyrkning, medens konditioneret medie kultur førte minimal virkning på insulin-ekspression (data ikke vist). Disse analyser viser, at mens celle-celle-kontakt er vigtig, kan der være nogle kortlivede secernerede molekyler, der er vigtig.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Vi har intet at afsløre.

Acknowledgements

Vi anerkender støtte fra NIH New Innovator Award DP2 116520 og ORAU Ralph Powe Junior Faculty Enhancement Award.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics