In ovo Elektroporering av miRNA-baserade plasmider i utvecklingsländer neuralröret och bedömning av fenotyper av Dil injektion i öppen bok Förberedelser

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

En metod genom vilken genexpression i neuralröret kan vara nedreglerade i en celltyp-specifik, spårbart sätt beskrivs. Vi visar hur

Cite this Article

Copy Citation | Download Citations

Wilson, N. H., Stoeckli, E. T. In ovo Electroporation of miRNA-based Plasmids in the Developing Neural Tube and Assessment of Phenotypes by DiI Injection in Open-book Preparations. J. Vis. Exp. (68), e4384, doi:10.3791/4384 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Kommissurala DI1 nervceller har studerats utförligt för att belysa mekanismerna bakom axon vägledning under utveckling 1,2. Dessa nervceller finns i den dorsala ryggmärgen och skicka sina axoner längs stereotypa banor. Kommissurala axoner ursprungliga projektet ventralt mot och sedan över floorplate. Efter att ha korsat mittlinjen, dessa axoner gör en skarp rostralt sväng och projekt longitudinellt mot hjärnan. Vart och ett av dessa steg regleras de samordnade insatserna av attraktiva och frånstötande vägledning ledtrådar. Den korrekta tolkningen av dessa ledtrådar är avgörande för vägledning av axoner längs sin avgränsade väg. Sålunda, är den fysiologiska bidrag av en speciell molekyl till kommissurala axon vägledning idealiskt undersöktes i samband med levande embryo. Därför måste gen ÖVERVÄLDIGANDE in vivo styras exakt för att noga skilja axon handledning av gener som kan spela fleraroller under utvecklingen.

Här beskriver vi en metod för att knockdown genuttryck i kyckling neuralröret i en celltyp-specifik, spårbart sätt. Vi använder nya plasmidvektorer 3 härbärgerande cell typ-specifika promotorer / förstärkare som driver uttrycket av ett fluorescerande protein markör, följt direkt av en miR30-RNAi transkript 4 (belägen inuti 3'-UTR av den cDNA som kodar det fluorescerande proteinet) ( Figur 1). När elektroporerades in utvecklingsländerna neuralröret, dessa vektorer framkallar effektiv nedreglering av genuttryck och uttrycka ljusa fluorescerande markörproteiner att möjliggöra direkt spåra celler upplever knockdown 3. Blanda olika RNAi vektorer före elektroporering möjliggör samtidig ÖVERVÄLDIGANDE av två eller flera gener i oberoende regioner av ryggmärgen. Detta möjliggör komplexa cellulära och molekylära interaktioner som skall undersökas under utveckling, på ett sätt som är snabb, sgenomföra, exakt och billigt. I kombination med Dil spårning av kommissurala axon banor i öppna bok förberedelser 5, är denna metod ett användbart verktyg för in vivo-studier av cellulära och molekylära mekanismer för kommissurala axon tillväxt och vägledning. I princip kan vilken som helst promotor / förstärkare kan användas, eventuellt gör tekniken mer allmänt tillämplig för in vivo studier av genfunktion vid utveckling 6.

Denna video demonstrerar först hur att hantera och ägg fönster, injektion av DNA plasmider i neuralröret och elektroporering proceduren. För att undersöka kommissurala axon vägledning är ryggmärgen avlägsnas från embryot som en öppen bok förberedelser, fasta och injiceras med Dil för att axon vägar kan spåras. Ryggmärgen monteras mellan täckglas och visualiseras med hjälp konfokalmikroskopi.

Protocol

1. Beredning av RNAi plasmid-DNA för Cell typspecifika geners uttryck

Plasmider (figur 1) syntetiseras med användning av standardtekniker molekylära kloningstekniker, såsom tidigare beskrivits i detalj 3,4.

1,1 Kloning in i vektorerna: oligonucelotide konstruktion

  1. Vi använder samma universella oligonukleotider och protokoll kloning som beskrivs i produktinformationen som följer med pRFPRNAiC vektorn 4 (ARK-Genomics).
    1. För kloning in i den första hårnålen webbplats:
      5 '-primer HP1:
      5'-GGCGGGGCTAGCTGGAGAAGATGCCTTCCGGAGAGGTGCTGCTGAGCG
      3 '-primer HP1:
      5'-GGGTGGACGCGTAAGAGGGGAAGAAAGCTTCTAACCCCGCTATTCACCACCACTAGGCA
    2. För kloning in i den andra hårnålen webbplats:
      5 '-primer HP2:
      5'-GGCGGGACGCGTGCTGTGAAGATCCGAAGATGCCTTGCGCTGGTTCCTCCGTGAGCG
      3 '-primer HP2:
    3. 5'-CGCCGCGCATGCACCAAGCAGAGCAGCCTGAAGACCAGTAGGCA
  2. Vi använder Genscript s Finder siRNA Mål att välja genspecifika målsekvenser: https://www.genscript.com/ssl-bin/app/rnai .
  3. Primrar för kloning av en gen-specifik miRNA i den första hårnålen webbplatsen:

Ett exempel för tystande GFP visas nedan.
Målsekvens (22nt): 5'-GGCACAAGCTGGAGTACAACTA
GFP Framåt VP1 = 59mer
Sekvens 1
GFP Omvänd VP1 = 58mer
Sekvens 2
Det finns gemensamma sekvenser i dessa oligos som utgör en del av miRNA flankerande sekvenser (kyckling-specifik), och vanliga slinga / stam sekvenser (från människa miRNA30). De genspecifika målsekvenser är understrukna. Observera att det är amismatch vid 5 'bas främre strängen (visad i fetstil, G → A i detta exempel) för att efterlikna den naturliga missanpassning miRNA30 vid denna position.

  1. Primrar för kloning av en gen-specifik miRNA i den andra hårnålen webbplatsen:

Ett exempel för tystande LacZ visas nedan.
Målsekvens (22nt): 5'-CGCGCTGTATCGCTGGATCAAA
LacZ Framåt HP2:
Sekvens 3
LacZ Omvänd HP2:
Sekvens 4
Observera att åter har 5 'bas målsekvensen i den främre delen ändrats (visas i fetstil, C → A i detta exempel) så att den inte stämmer överens med antisenssekvensen, imitera miRNA30.

1,2 PCR-reaktion och subkloning

  1. De genspecifika oligonukleotider är ossed tillsammans med de universella oligos i en PCR-reaktion för att generera miRNA30-liknande hårnål med kyckling miRNA flankerande sekvenser.
Kloning i första hårnål webbplats:
1 il - 10 ng GFP Forward primer VP1
1 il - 100 ng 5 'primer VP1
1 il - 100 ng 3-primer VP1
1 il dNTP (10 mM)
5 pl 10x Pfu reaktionsbuffert
1 il Pfu DNA-polymeras (Promega)
39 il PCR-Grade vatten
ELLER Kloning in i den andra hårnål webbplats:
1 il - 10 ng LacZ Forward primer HP2
1 il - 100 ng 5 'primer HP2
1 il - 100 ng 3 'primer HP2
1 il dNTP (10 mM)
5 pl 10x Pfu reaktionsbuffert
1 il Pfu DNA-polymeras (Promega)
39 il PCR-Grade vatten

Cykler:

94 ° C 94 ° C 55 ° C 72 ° C 72 ° C 4 ° C
1 minut 30 sek 30 sek 1 minut 9 min håll
30 cykler
  1. Rena PCR-produkten, smälta med restriktionsenzymer och subklon i vektorn:
    1. Första hårnål webbplats: använd Nhel och Mlul
    2. Andra hårnål webbplats: använd Mlul och Sphl
  2. Följ standardtekniker för transformation av kompetenta bakterieceller. Plate celler på LB-agar (innehållande ampicillin) och skörd DNA genom plasmid midipreparation (t.ex. Nucleobond Xtra Midi kit, Machery-Nagel).
  3. Suspendera koncentrerad plasmid-DNAi steril DDH 2 0, mått koncentration genom spektrofotometri och förvara vid -20 ° C.

1,3 Sequencing miRNA plasmider

Under standardförhållanden sekvenseringsreaktionen misslyckas ofta på grund av stark sekundär struktur hårnålar. För att förbättra denna 7:

  1. Utför sekvenseringsreaktion i 10 mM Tris-Cl med 0,01 mM EDTA (pH 8,0) i stället för vatten. Detta ökar omvandlingen av övertvinnat DNA till ssDNA, som är mer mottaglig för sekvensbestämning.
  2. Lägg ett steg värmedenaturering (98 ° C, 5 minuter) före sekvensering. Detta omvandlar övertvinnat plasmid-DNA till ssDNA.

2. Elektroporation

2,1 ägg hantering

  1. Placera äggen i en inkubator inställd på 38,5 ° C och ~ 45% luftfuktighet.
  2. Inkubera äggen tills embryona har nått den önskade utvecklingsstadium. Att studera axon ledning av kommissurala neuroner, typicall viy elektroporera embryon när de nått hamburgare & Hamilton (HH) steg 17-18 (efter ca 3 dagars inkubation) 8. Men injektion och elektroporation måste göras innan proteinet av intresse har samlats för att göra knockdown effektivt.
  3. Ta äggen från inkubatom och lägg dem i en stabil horisontell position under 20 min, för att flytta embryot ovanpå gulan vid den övre sidan av ägget. Återgå äggen till inkubatorn under denna period.

2,2 Framställning av reagens och utrustning

  1. Förbered fosfatbuffrad saltlösning (PBS) och sterilisera genom autoklavering eller låta lösningen passera genom ett 0,2 pm filter.
  2. Gör glas mikropipetter genom att dra kapillärer (World precisionsinstrument 1B120F-4, 1,2 / 0,68 OD / ID (mm)) i en lämplig draganordning (t.ex. Narishige PC-10). Bryt av spetsen på en mikropipett för att få ett tips diameter på ~ 5 pm och ansluta den till en slang medlämplig diameter.
  3. Montera platinaelektroder (0,5 cm lång) fast i en handhållen ram med en inter-elektrod avstånd 0,5 cm. Ansluter elektroderna till en fyrkantvåg pulsgenerator (BTX ECM 830).
  4. Ställ pulsgeneratorn med följande parametrar:
    1. För ensidig elektroporering: spänning: 25 V, antal pulser: 5, längd puls: 50 msek, interpulse intervall: 1 sek
    2. För bilaterala elektroporering: spänning: 18 V, antal pulser: 5, längd puls: 50 msek, interpulse intervall: 1 sek
  5. Förbered en spruta med 18 G nål, en skalpell, en spritz flaska 70% etanol och tejp.
  6. Smält paraffin i en bägare på en värmeplatta vid 80 ° C.

2,3 Fönstring

  1. Torka av ägg med en servett indränkt i 70% etanol.
  2. Placera en remsa av tejp längs den långa axeln av ägget.
  3. Gör två små hål i äggskalet med användning av en skalpell, ett vidden trubbiga änden av ägget och den andra vid hörnet av det område som skall fönsterläge.
  4. Med hjälp av en spruta, ta bort ca. 3 ml äggvita från varje ägg genom att införa nålen med en vinkel av 45 ° i hålet vid den trubbiga änden av ägget. Försiktigt undvika skador på äggula.
  5. Skär ett fönster i äggskalet med en liten sax, som hålls horisontellt för att undvika skador på embryot. Om så erfordras, kan positionen av embryot kontrolleras och markeras med en penna genom att hålla en starkt ljus mot den trubbiga änden av ägget. Ett fönster av 1,5 till 2 cm kvadrat är användbar för de flesta tillämpningar.
  6. Täta hålet vid den trubbiga änden av ägget och eventuella sprickor i äggskalet med smält paraffinvax, appliceras med en pensel.
  7. Täta fönster med genomskinlig tejp (t ex Scotch Magic).
  8. Returnera ägget till inkubatorn.

2,4 Elektroporation

  1. Förbered sterila verktyg och torka arbetsområdet med 70% etanol.
  2. Förbered jagnjection lösning. Den lämpliga DNA-koncentrationen måste bestämmas av användaren och kommer att variera beroende på förstärkare / promotor som används för att driva expression. Som vägledning använder vi vanligtvis 0,2-2,0 ug / ul (se diskussion). I totalt 20 ul, bör injektionen blandningen innehålla:
RNAi plasmid-DNA (i H 2 0) X ul
20x PBS 1 il
0,4% trypanblått 2 pl
steril DDH 2 0, till en slutlig volym av 20 il

Använd skonsam sugkraft för att ladda DNA-blandningen i glaset mikrokapillär fäst slangen.

  1. Ta bort tejpen från fönsterläge ägg och steg embryot enligt Hamburger och Hamilton 8.
  2. Använd pincett och sax våren försiktigt bort extraembryonic membran från den kaudala delen av embryot. Membranen kan lätt lyftas bort från embryot i det område där de stora högra och vänstra vitelline vener in i stammen. Försiktigt riva eller klippa membranen och dra dem mot svansen. Vid behov kan embryot kan visualiseras bättre genom att injicera en lösning av tusch eller Fast Green mellan embryonala skivan och äggula som visas i en video från Boulland och kollegor 9.
  3. Injicera DNA-lösningen i den centrala kanalen av neuralröret, strax ovanför bakbenen. Styr injektionsvolymen genom munnen. Den blå färgen bör spridas från svansspetsen upp till ventrikeln av den växande hjärnan.
  4. Tillsätt ett par droppar av steril PBS ovanpå embryot.
  5. Placera elektroderna parallellt med den främre-bakre axeln hos embryot. Undvik att vidröra embryot eller blodkärl.
  6. Håll elektroderna stadigt och elektroporera.
  7. Ta försiktigt bort elektroderna och skölj dem medsterilt vatten för att avlägsna denaturerade proteiner från äggvita.
    1. För bilaterala elektroporering, växla polaritet på elektroderna, flytta elektroderna parallellt med embryot och upprepa elektroporering. Skölj elektroderna i sterilt vatten.
  8. Släpp lite mer steril PBS på embryot. Återförslut ägg med tejp och returnera den till inkubatorn tills önskad utvecklingsstadiet uppnåtts. Korrekt tätning är avgörande för att undvika uttorkning av embryot.

3. Spinal Cord Förberedelser

3,1 Dissektion av embryon

  1. Vid HH25-26 (dag 5 av inkubation), ta bort embryot från ägget med pincett eller en liten sked. Placera den i PBS i en petriskål belagd med silikon (Sylgard elastomer).
  2. Ta bort extraembryonic membranen och lägga embryot på rygg. Stabilisera den på plattan genom att fästa den genom halsen och svansen (med 0,20 stift mm insekt), med mild stretching.
    1. Hela embryon (för sektionering senare) kan fixeras här, genom att ersätta PBS med 4% paraformaldehyd (PFA) och inkubera under 1 timme vid rumstemperatur. För att öppna boken förberedelser fortsätter protokollet med ofixerade vävnad som beskrivs nedan.

3,2 Isolering av ryggmärg från embryon

  1. Pin lemmarna, säkerställer att stiften är införda i en vinkel bort från embryot så att de inte interfererar med dissektion. Embryot ska belysas underifrån för att möjliggöra vävnadsdensitet skall uppfattas i följande steg.
  2. Ta hjärta och inre organ med Spring sax och försiktigt skrapa med pincett. Den segmenterade kotor och ryggmärgen bör vara synlig om alla organ har tagits bort helt och hållet.
  3. Med Spring sax, gör ett grunt snitt genom kotorna överliggande ryggmärgen i nacken. Vrid embryot 180 ° och gör två kortalängsgående snitt genom kotorna på vardera sidan av ryggmärgen, från halsen mot svansen. Använd pincett för att lyfta fliken av kotorna bort från ryggmärgen och skal vävnaden (innehållande alla kotorna) i en enda remsa mot svansen.
  4. Försiktigt sträcka och åter stift embryot genom svansen och benen.
  5. Använd en fin mikrokirurgisk skalpell (t.ex. Grieshaber 68.101) eller volfram nål för att skära bort meningerna överliggande ryggmärgen. Leta efter en mörk, tät linje av vävnad mellan neuralröret och dorsala rotganglier. Justera infallsvinkel, om nödvändigt. Försiktigt skära längdled utmed denna linje på varje sida av ryggmärgen, från halsen till svansen. Meningerna skulle separera från ryggmärgen på grund av den milda sträckningen av den stiftförsedda embryot.
  6. Skär genom ryggmärgen vid nivån av vingen knopp och kaudalt benet knopp, och lyfta hela ryggmärgen ur embryot i en jämn rostralt till kaudalt rörelse, med pincett. Den isolerade ryggmärgen bör hållas nedsänkt i PBS under detta steg. Lyft inte ut den ur skålen.

3,3 Fixering av öppna-böcker

  1. Sprid isolerade ryggmärgen på en spatel och överföra den till en ny silikon-fodrade petriskål innehållande 4% paraformaldehyd i PBS.
  2. Producera en platt-mount förberedelse genom att försiktigt sätter ryggmärgen i sex lägen (rostrally, medialt och kaudalt på varje sida, med 0,10 stift mm insekt). Vi märker varje preparat med lite "flagga" som inte bara identifierar embryot men anger också den främre änden av den öppna boken beredning.
  3. Inkubera vid rumstemperatur i 30 minuter till 1 timme. Öppet-böcker ska inte över-fast eftersom det minskar effektiviteten i Dil spridning 10 och ökar bakgrund.
  4. Häll försiktigt bort 4% PFA och ersätta det med PBS. Håll rätter vid 4 ° C tills den ska injicera med Dil eller montera.
e_step "> 3,4 Dil injektion i kommissurala neuroner

  1. Beakta öppna-böcker under fluorescens miscroscopy och välj rätt sida av den öppna boken att injicera med Dil.
  2. Förbered Snabb Dil (5 mg / ml i etanol) och dra lösningen till en glasmikropipett kopplad till plaströr. Bryt änden av mikropipett så fint som möjligt för att erhålla en mycket liten diameter spets. Stick in nålen i en maträtt av PBS och kontrollera att Dil inte läcker från nålen. Om Dil läcker, är nålen diametern för stor. I så fall förbereda en ny nål.
  3. Belysa öppna boken förberedelser underifrån. Leta efter en tätare längsgående rand av vävnad, som ligger ca 1/5 av bredden på en hemibook från den laterala kanten av preparatet. Detta motsvarar cellkroppama de kommissurala nervceller, som finns precis ventrala till takplåten. Börjar på ena änden av den öppna boken sätter glaset nålen i vävnaden och som nålen is tillbaka, puff i en liten mängd Dil med en mun pipett.
  4. Arbeta snabbt, göra flera injektioner utmed längden av den öppna boken med regelbundna intervall av ungefär 0,5 mm. Om nålen blir igensatt, försiktigt bort den med pincett. Om spetsen blir för stor (och Dil läcker), byt ut nålen.
  5. När du har slutfört varje öppen bok, använd en överföringspipett att suga bort och kasta eventuellt överskott, läckte Dil. Underlåtenhet att göra detta kommer att resultera i hög bakgrund.
  6. Låt förberedelserna för cirka tre dagar vid 4 ° C för att göra det möjligt för Dil att sprida längs axoner.

3,5 Montering för avbildning

  1. Använd en spruta med en 18 G nål för att sprida ett tunt, oavbruten gräns vakuum fett (t.ex. Dow Corning # 976V) runt kanterna på en 24 mm x 24 mm täckglas. Tillsätt flera droppar av steril PBS till brunnen. Observera att montering medium innehållande glycerol med n-propylgallat inte kan sammpatible med Dil 11. På liknande sätt kan vakuum fett med låg viskositet blandas med PBS och resultera i hög bakgrund.
  2. Ta bort stiften från den öppna boken och överför till PBS droppen. Sänk den öppna boken och placera den i mitten av brunnen.
  3. Placera försiktigt en 24 mm x 24 mm täckglas ovanpå, och se till att öppna boken förblir öppen. Om nödvändigt, kan det täckglas avlägsnas, och den öppna boken omplaceras. Tryck försiktigt runt kanterna på beredningen för att skapa en fullständig tätning av fett. Överskott PBS kommer att pressas ut under detta steg. Undvik luftbubblor.
  4. Håll förberedelserna i mörker vid 4 ° C tills redo för inspektion och dokumentation av fluorescensmikroskopi. Detta bör ske snabbt (inom en vecka), för att se till att förberedelserna inte torkar ut.

4. Representativa resultat

Elektroporering och expression av plasmider

Enligtbetingelser som beskrivs ovan bör fluorescerande protein vara klart detekterbart i lämplig celltyp utan behov av ytterligare förstärkning av signalen genom antikroppsmärkning. Det fluorescerande proteinet bör endast vara detekterbar i den önskade celltypen / s.. Representativa exempel på öppen bok preparat och tvärsnitt av embryon elektroporerades med de olika plasmider visas i figur 2.

Effektivitet av konstgjorda miRNA

Konstgjorda miRNA mot en ny gen av intresse först måste screenas för effektivitet och specificitet deras knockdown effekter. Vi finner att β-aktin promotor-drivna konstruktioner, elektroporerades vid 0,25 ug / ul, är lämpliga för detta 3. Knockdown in vivo kan testas genom immunhistokemi eller in situ hybridisering.

Dil märkning

Lämpligt riktade Dil injektioner i vildtyp embryonbör ge mer än 80% av injektionsställen med ideala, arketypiska banor 3, såsom visas i figur 3. Djur till djur variabilitet bör vara låg.

Figur 1
Figur 1. Generaliserad schematiskt av miRNA-uttryckande plasmidvektorer. Användningen av olika RNA-polymeras II promotorer / förstärkare möjliggör celltyp-specifik expression. De transfekterade cellerna kan identifieras genom expression av en fluorescerande reporter som är direkt kopplad (inom ett enda transkript) till en eller två artificiella miRNA, som riva genuttryck. Fet text indikerar senssträngen av en artificiell miRNA mot LacZ, såsom beskrivs i texten.

Figur 2
Figur 2. Representativa exempel Of fluorescerande protein expression patterns erhållits efter elektroporering av de angivna plasmidvektorer. Tvärsnitt och öppna böcker är från HH25-26 kycklingembryon som elektroporerades vid HH18. β-aktin promotor driver ubiquitous uttryck driver Math1 förstärkare uttryck i DI1 nervceller och Hoxa1 förstärkare driver uttryck specifikt i bottenplattan. CN, kommissurala neuron, FP, bottenplanet.

Figur 3
Figur 3. Tillämpning och analys av Dil injektionsställen i öppen bok preparat. Dil ska injiceras i ett punktformig mönster, nära den laterala kanten av öppna boken på elektroporerade sidan (identifieras av fluorescerande protein expression). Efter 3 dagar av diffusion bör kommissurala axon banor kunna vara visualiseras under fluorescensmikroskopi. Normala axon banor kommer att växa mot golvet psent, korsa bottenplattan och sedan vända och växa rostrally. Onormala fenotyper härrör från gen knock ned kan jämföras med denna arketypiska bana. I exemplet, några axoner stall i bottenplattan eller göra felaktiga vänder beslut på den kontralaterala sidan.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denna enkla, vektor-baserad artificiell miRNA expression strategi kan användas för att ÖVERVÄLDIGANDE endogen genexpression i kyckling neuralröret. Dessa funktionella verktyg erbjuder flera geners uttryck, temporal kontroll och celltyp specificitet, för att underlätta klargörande av komplexa utvecklingsbanor. Framför allt har vi visat nyttan av dessa plasmider i kommissurala axon vägledning, eftersom plasmider kan användas för att knockdown distinkta gener i kommissurala neuroner eller i mellanliggande mål, floorplate 3.

Intensiteten och placeringen av fluorescerande protein expression genereras från miRNA-uttryckande plasmider (och därmed de tystade cellerna) kommer att bero på följande parametrar:

  1. Enhancer används:
    1. β-aktinpromotorn är överallt aktiv
    2. Math1 förstärkare är aktiv endast i DI1 nervceller 12
    3. 13
  2. Koncentration av plasmiden.
    Om plasmiden koncentrationen är alltför hög, kan det orsaka "läckage" av förstärkaren aktiviteten och efterföljande expression i oönskade celler, medan för lite plasmiden kan reducera uttrycket av det fluorescerande proteinet och förhindra elektroporerade cellerna från att spåras. Höga koncentrationer av RNAi plasmider bör också undvikas för att minska utanför mål effekter och minimera risken för ospecifik toxicitet till följd av mättnad av endogena miRNA biogenes väg. Vi använder:
    1. β-aktin-promotor: 0,25 ug / ul
    2. Math1 förstärkare: 0,7 ug / ul
    3. Hoxa1 förstärkare III: 0,5-1,0 ug / ul
  3. Noggrannhet för elektroporering.
    Hantering kycklingembryon in ovo kräver manuella färdigheter som måste förvärvas genom utbildning. Vi och andrahar tidigare publicerats felsökningstips för detta förfarande 14,15.

Flera miRNA kan behöva prövas innan en lämplig kandidat hittats. Denna process bör innehålla identifiering av flera oberoende miRNA för att bekräfta en observerad fenotyp, negativa kontroller (oordning och / eller obesläktade miRNA) och räddning konstruerar 16.

Öppen bok preparat skall fastställas optimalt och injiceras med Dil i rätt läge för att visualisera strukturella detaljer om axonala projektioner av kommissurala nervceller. Hög bakgrund kan orsakas av långvarig fixering av den öppna böcker eller spill av Dil. Injektion av Dil i celler belägna alltför dorsalt vanligtvis resulterar i en brist på märkta axonala projektioner mot golvplåten. Celler som ligger alltför ventralt kommer att ha många ipsilaterala och kontralaterala prognoser på mittlinjen, och bör därför undvikas. För beginners, rekommenderar vi öva på öppen-böcker hämtade från vildtyp embryon för att säkerställa korrekt och reproducerbar placering av Dil.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Inga intressekonflikter deklareras.

Acknowledgements

Arbete i labbet av ES stöds av den schweiziska National Science Foundation. Vi vill tacka Dr Vispa Kunz för hjälp med filmning.

Materials

Name Company Catalog Number Comments
0.5 mm glass capillaries World Precision Instruments 1B120F-4
Glass needle puller Narishige PC-10
Electroporator BTX ECM 830
Sylgard silicone elastomer World Precision Instruments SYLG184
Tungsten wire, 0.075 mm World Precision Instruments TGW0325
Insect pins, 0.20 mm Fine Science Tools 26002-20
Insect pins, 0.10 mm Fine Science Tools 26002-10
Spring scissors Fine Science Tools 15003-08
Dumont #5 forceps Fine Science Tools 11252-20
Dumont #55 forceps Fine Science Tools 11255-20
Fast DiI Molecular Probes D-7756
Fluorescent microscopes Olympus SZX12, BX51

DOWNLOAD MATERIALS LIST

References

  1. Chédotal, A. Further tales of the midline. Current Opinion in Neurobiology. 21, 68-75 (2011).
  2. Avraham, O., Hadas, Y., Vald, L., Zisman, S., Schejter, A., Visel, A., Klar, A. Transcriptional control of axonal guidance and sorting in dorsal interneurons by the Lim-HD proteins Lhx9 and Lhx1. Neural Development. 4, 21 (2009).
  3. Wilson, N. H., Stoeckli, E. T. Cell type specific, traceable gene silencing for functional gene analysis during vertebrate neural development. Nucleic Acids Research. 39, e133 (2011).
  4. Das, R. M., van Hateren, N. J., Howell, G. R., Farrell, E. R., Bangs, F. K., Porteous, V. C. A robust system for RNA interference in the chicken using a modified microRNA operon. Developmental Biology. 294, 554-563 (2006).
  5. Perrin, F. E., Stoeckli, E. T. Use of lipophilic dyes in studies of axonal pathfinding in vivo. Microscopy Research and Technique. 48, 25-31 (2000).
  6. Timmer, J., Johnson, J., Niswander, L. The use of in ovo electroporation for the rapid analysis of neural-specific murine enhancers. Genesis. 29, 123-132 (2001).
  7. Kieleczawa, J. Simple modifications of the standard DNA sequencing protocol allow for sequencing through siRNA hairpins and other repeats. Journal of Biomolecular Techniques. 16, 220-223 (2005).
  8. Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Journal of Morphology. 88, 49-92 (1951).
  9. Boulland, J., Halasi, G., Kasumacic, N., Glover, J. C. Xenotransplantation of Human Stem Cells into the Chicken Embryo. J. Vis. Exp. (41), e2071 (2010).
  10. Kim, B. G., Dai, H. -N., McAtee, M., Vicini, S., Bregman, B. S. Labeling of dendritic spines with the carbocyanine dye DiI for confocal microscopic imaging in lightly fixed cortical slices. Journal of Neuroscience Methods. 162, 237-243 (2007).
  11. Murphy, M. C., Fox, E. A. Anterograde tracing method using DiI to label vagal innervation of the embryonic and early postnatal mouse gastrointestinal tract. Journal of Neuroscience Methods. 163, 213-225 (2007).
  12. Helms, A. W., Abney, A. L., Ben-Arie, N., Zoghbi, H. Y., Johnson, J. E. Autoregulation and multiple enhancers control Math1 expression in the developing nervous system. Development. 127, 1185-1196 (2000).
  13. Li, X., Lufkin, T. Cre recombinase expression in the floorplate, notochord and gut epithelium in transgenic embryos driven by the Hoxa-1 enhancer III. Genesis. 26, 121-122 (2000).
  14. Mauti, O., Baeriswyl, T., Stoeckli, E. T. G. ene Silencing by Injection and Electroporation of dsRNA in Avian Embryos. Cold Spring Harbor Protocols. (2008).
  15. Krull, C. E. A primer on using in ovo electroporation to analyze gene function. Developmental Dynamics. 229, 433-439 (2004).
  16. Cullen, B. R. Enhancing and confirming the specificity of RNAi experiments. Nature Methods. 3, 677-681 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics